ObjectiveTo investigate the therapeutic effects and mechanism of decoctions from four kinds of processed products of Aconiti Radix Lateralis Praeparata（ARLP） in deficiency-cold syndrome. MethodsA total of 36 SD rats were randomly divided into the control group， model group， Shengfupian（SFP） group， Paofuzi（PFZ） group， Heishunpian（HSP） group and Paofupian（PFP） group with 6 rats in each group. Except for the control group， rats in other groups were administered hydrocortisone sodium succinate via intramuscular injection to induce a cold deficiency syndrome model. After 14 consecutive days， each ARLP decoction pieces was administered via continuous gastric lavage at a dose of 12 g·kg^-1·d^-1 for 7 d， while the control and model groups received an equivalent volume of physiological saline. After the end of administration， body weight， spleen weight and thymus weight were measured for calculating the spleen and thymus indexes. Hematoxylin-eosin（HE） staining was used to observe the pathological morphology of adrenal tissue. The fully automatic biochemistry analyzer was used to measure the total cholesterol（TC）， triglyceride（TG）， lactic dehydrogenase（LDH） and lactate（LAC） levels in serum. Enzyme-linked immunosorbent assay（ELISA） was employed to measure the contents of 17-hydroxycorticosteroid（17-OHCS）， cortisol（CORT）， triiodothyronine（T₃）， thyroxine（T₄）， thyrotropin（TSH）， immunoglobulin（Ig） M， IgG， cyclic adenosine monophosphate（cAMP） and cyclic guanosine monophosphate（cGMP）. Western blot was used to measure the protein expression levels of protein kinase A（PKA）， cAMP response element-binding protein（CREB）， silent information regulator 1（Sirt1） and peroxisome proliferator-activated receptor γ coactivator-1α（PGC-1α）. And high performance liquid chromatography（HPLC） was used to determine the content of major alkaloids， followed by Pearson correlation analysis with pharmacodynamic indicators. ResultsAfter modeling， compare with the control group， the model rats exhibited symptoms such as lethargy and loose stools， mild abnormalities were observed in adrenal tissue structure， and both spleen and thymus indices were significantly reduced（P<0.01）. Thyroid， adrenal and immune system functions were suppressed， with decreased serum cAMP level and significantly elevated cGMP level（P<0.01）. Compared with the model group， the adrenal injury by hydrocortisone sodium succinate were repaired and the spleen index were increased significantly in all four ARLP groups（P<0.05， P<0.01）. The thymus index in SFP and PFZ groups were increased significantly（P<0.05）. The contents of T₃， TSH， 17-OHCS and CORT were increased significantly in SFP and PFZ groups（P<0.05）. In addition， the content of IgG in SFP， PFZ and PFP groups were increased significantly（P<0.01）， while the content of IgM in PFZ and HSP groups were also increased significantly（P<0.05）. Regarding the cyclic nucleotide system， PFZ significantly elevated cAMP level while reducing cGMP level（P<0.05）， exhibiting the most pronounced effect among the four decoction pieces. For energy metabolism indicators， PFZ significantly improved abnormal markers including TC， TG， LDH， and LAC（P<0.05）. HSP showed marked improvement effects on TG， LDH， and LAC（P<0.05）. Both PFZ and SFP significantly elevated the expression levels of PKA， CREB， Sirt1， and PGC-1α proteins（P<0.01）. Additionally， the diester alkaloids in ARLP showed a strong positive correlation with TG， IgG， and CORT， a strong negative correlation with LAC， a moderate positive correlation with T₄， and moderate negative correlations with cAMP and spleen index. Monomeric alkaloids showed strong positive correlations with TG and IgG， strong negative correlations with LAC， moderate positive correlations with CORT and T₄， and moderate negative correlations with cAMP and spleen index. However， the content of water-soluble alkaloids showed strong positive correlations with TC， LDH， 17-OHCS， T₃， TSH， and thymus index， moderate positive correlations with cAMP， CORT， T₄， and spleen index， and moderate negative correlation with cGMP. ConclusionAmong different processed ARLP decoction pieces， PFZ processed according to ZHANG Zhongjing's method exhibits the most potent warming and cold-dispelling effects. Its pharmacological actions are mediated through regulating the thyroid， adrenal， immune， cyclic nucleotide systems， and material-energy metabolism pathways. Among these， water-soluble alkaloids show strong or moderate correlations with more indicators of deficiency-cold syndrome and exhibit the highest content in PFZ. Therefore， PFZ processed according to ZHANG Zhongjing's method may exert its warming and cold-dispelling effects through water-soluble alkaloids.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective To analyze the current status of human papillomavirus(HPV) vaccination among women aged 9-45 years in Chaoyang District of Beijing, and to provide a basis for further promoting population vaccination.Methods The HPV vaccination(including HPV2, HPV4 and HPV9) data among women aged 9-45 in Chaoyang District of Beijing as of December 31, 2024 in Beijing's immunization planning information system were derived, and the estimated HPV vaccination rate in Beijing's female population was obtained by data analysis.Results By December 31, 2024, the estimated first dose vaccination rate of HPV vaccine among women aged 9-45 years in Chaoyang District of Beijing had been 50. 88%, and the estimated full dose vaccination rate was 48. 66%. The estimated coverage of the first dose and the full dose among girls aged9-15 years was 4. 62% and 2. 87%, respectively. The estimated full dose coverage rate was 62. 73% in subdistrict and 37. 33%in district.Conclusion The estimated HPV vaccination rate of 9-45-year-old women in Chaoyang District of Beijing is higher than that in other regions of China, but the estimated vaccination rate of adolescent women aged 9-15 is significantly lower than that of other age groups. It is recommended to improve the HPV vaccination rate through multiple joint efforts to achieve the action goal of accelerating the elimination of cervical cancer in China and the world as soon as possible.

OBJECTIVE To explore a model for constructing a platform for medical institution formulation and provide insights for promoting their development. METHODS By systematically reviewing the development status and challenges of medical institution preparations in China， and based on the theory of industry-university-research collaborative innovation， the organizational structure， collaborative processes， and safeguard mechanisms of the platform were designed. RESULTS & CONCLUSIONS Medical institution formulations in China mainly faced challenges such as weak research and development （R&D） capacity， uneven quality standards， and blocked transformation pathways. This study established a full-chain， whole- industry collaborative innovation network covering the government， medical institutions， universities/research institutes， pharmaceutical enterprises， and the market， forming a new “government-industry-university-research-application” five-in-one platform model for medical institution formulations. By establishing mechanisms such as multi-entity collaborative cooperation， full- chain intellectual property management， contribution-based benefit distribution， staged risk-sharing， and third-party evaluation， the model clarified the responsibilities and collaborative pathways of all parties. The new model highlights the whole-process transformation of clinical experience-based prescriptions， enabling precise alignment between clinical needs and technological R&D， as well as between preparation achievements and industrial transformation. While breaking down the barriers of traditional platform construction， it effectively achieves optimal resource allocation and complementary advantages， addresses problems emerging in the development of medical institution preparations， and provides reference value for the formulation of relevant systems.

Oral squamous cell carcinoma (OSCC) is a common head and neck malignancy. Approximately 50% to 60% of patients with OSCC are diagnosed at a locally advanced stage (clinical staging III-IVa). Even with comprehensive and sequential treatment primarily based on surgery, the 5-year overall survival rate remains below 50%, and patients often suffer from postoperative functional impairments such as difficulties with speaking and swallowing. Programmed death receptor-1 (PD-1) inhibitors are increasingly used in the neoadjuvant treatment of locally advanced OSCC and have shown encouraging efficacy. However, clinical practice still faces key challenges, including the definition of indications, optimization of combination regimens, and standards for efficacy evaluation. Based on the latest research advances worldwide and the clinical experience of the expert group, this expert consensus systematically evaluates the application of PD-1 inhibitors in the neoadjuvant treatment of locally advanced OSCC, covering combination strategies, treatment cycles and surgical timing, efficacy assessment, use of biomarkers, management of special populations and immune related adverse events, principles for immunotherapy rechallenge, and function preservation strategies. After multiple rounds of panel discussion and through anonymous voting using the Delphi method, the following consensus statements have been formulated: 1) Neoadjuvant therapy with PD-1 inhibitors can be used preoperatively in patients with locally advanced OSCC. The preferred regimen is a PD-1 inhibitor combined with platinum based chemotherapy, administered for 2-3 cycles. 2) During the efficacy evaluation of neoadjuvant therapy, radiographic assessment should follow the dual criteria of Response Evaluation Criteria in Solid Tumors (RECIST) version 1.1 and immune RECIST (iRECIST). After surgery, systematic pathological evaluation of both the primary lesion and regional lymph nodes is required. For combination chemotherapy regimens, PD-L1 expression and combined positive score need not be used as mandatory inclusion or exclusion criteria. 3) For special populations such as the elderly (≥ 70 years), individuals with stable HIV viral load, and carriers of chronic HBV/HCV, PD-1 inhibitors may be used cautiously under the guidance of a multidisciplinary team (MDT), with close monitoring for adverse events. 4) For patients with a poor response to neoadjuvant therapy, continuation of the original treatment regimen is not recommended; the subsequent treatment plan should be adjusted promptly after MDT assessment. Organ transplant recipients and patients with active autoimmune diseases are not recommended to receive neoadjuvant PD-1 inhibitor therapy due to the high risk of immune related activation. Rechallenge is generally not advised for patients who have experienced high risk immune related adverse events such as immune mediated myocarditis, neurotoxicity, or pneumonitis. 5) For patients with a good pathological response, individualized de escalation surgery and function preservation strategies can be explored. This consensus aims to promote the standardized, safe, and precise application of neoadjuvant PD-1 inhibitor strategies in the management of locally advanced OSCC patients.

Objective: To investigate whether membrane vesicles (MVs) of Streptococcus mutans （S.mutans） contain autoinducer-2 (AI-2) and to preliminarily explore the effects of these MVs on the growth and biofilm formation of S. mutans. Methods: MVs were isolated from the S. mutans UA159 strain using differential centrifugation. The isolated MVs were characterized by nanoparticle tracking analysis for particle size and concentration and observed by transmission electron microscopy. The presence of AI-2 was identified using the Vibrio harveyi BB170 bioluminescence assay: the BB170 diluent was supplemented with AB medium (control group), MV extract (MVs group), pre-ultrafiltration supernatant (Sup group), or post-ultrafiltration supernatant (Sup-af group). The effects of MVs on growth and biofilm formation were assessed using the S.mutans UA159 strain or a luxS deletion mutant as the control group, compared with experimental groups stimulated with gradient concentrations of MVs (MVs-2.0E+7, MVs-2.0E+8, and MVs-2.0E+9 groups). Growth curves, MTT assay, and colony-forming unit (CFU) counts were used to determine changes in growth capacity. Biofilm formation was evaluated using crystal violet staining, confocal laser scanning microscopy, and the anthrone method for polysaccharide quantification. Results: Enriched S. mutans MVs were successfully obtained, with an average particle size of approximately 94.19 nm and a concentration of 1.87E+11 particles/mL. The bioluminescence assay showed that the luminescence intensity of the Sup group was higher than that of the Sup-af group, and the MVs group exhibited higher intensity than the control group. Assessments via growth curves, MTT assay, and CFU counts indicated no significant differences in the growth capacity of the various S. mutans strains after treatment with different concentrations of MVs. Crystal violet staining quantification and confocal laser scanning microscopy observations revealed that high-concentration MV treatment (2.0E+9 particles/mL group) resulted in lower biofilm mass compared to the control. The anthrone method showed that the production of both water-soluble and water-insoluble polysaccharides was significantly lower in the high-concentration MV group than in the control. Conclusion S. mutans MVs contain the quorum sensing signal molecule AI-2. These MVs do not significantly affect the growth of S. mutans, but they can regulate biofilm formation and exhibit an inhibitory effect at high concentrations.

Objective: To evaluate the performance of 5T magnetic resonance imaging (MRI) in visualizing dental pulp and periodontal ligament (PDL) tissues in vivo in the young adult population, thereby providing a basis for the application of high-field MRI technology in clinical oral examinations. Methods: The study was approved by the Ethics Committee of the hospital. A total of 15 healthy volunteers (413 permanent teeth altogether) were recruited and underwent full-mouth 5T MRI scans. Among them, six volunteers (168 permanent teeth) also received both 3T MRI and cone-beam computed tomography (CBCT) scans. Two dental specialists independently evaluated the imaging quality of the dental pulp and PDL on the images using a 5-point Likert scale and recorded the number of detectable root canals for each tooth. Inter-rater agreement was assessed using weighted kappa statistics and intraclass correlation coefficient (ICC). Non-parametric tests were employed to compare differences in imaging performance among different tissue structures, tooth positions, and imaging modalities. Results: 5T MRI can achieve in vivo imaging for most dental pulp tissues and partial periodontal membrane structures. There was a high level of agreement between the two raters in their imaging scores for the dental pulp and PDL (dental pulp κ = 0.934, PDL κ = 0.737). The imaging scores for dental pulp were significantly higher than those for PDL (P < 0.001), and the scores for molar dental pulp were lower than those for premolars and anterior teeth. In the multimodal comparison involving six volunteers, the raters showed good consistency in scoring dental pulp and PDL imaging across 5T MRI, 3T MRI, and CBCT, as well as in root canal counts (5T MRI for dental pulp κ = 0.971, 3T MRI for dental pulp κ = 0.933, CBCT for dental pulp κ = 0.964; 5T MRI for PDL κ = 0.625, 3T MRI for PDL κ = 0.667, CBCT for PDL κ = 0.571; ICC for root canal counts all ≥ 0.990). The imaging scores for dental pulp and PDL using 5T MRI were significantly higher than those using 3T MRI (dental pulp: P < 0.001; PDL: P = 0.022), but there was no statistically significant difference in the detection rate of the number of root canals between the two (P > 0.05). Although the imaging scores for dental pulp and PDL as well as the detection rate of the number of root canals with 5T MRI were inferior to those with CBCT (dental pulp: P < 0.001; PDL: P = 0.02; number of root canals: P < 0.05), 5T MRI can truly achieve "direct imaging" of these two soft tissues. Conclusion 5T MRI enables effective in vivo direct imaging of dental pulp and PDL tissues in the young adult population, indicating its potential clinical application value in the diagnosis and treatment of pulp and periodontal diseases.

OBJECTIVE: To summarize the clinical features and management of two brothers affected with X-linked inhibitor of apoptosis protein (XIAP) deficiency. METHODS: This study retrospectively analyzed the clinical presentations, treatment, and follow-up of two brothers with XIAP deficiency diagnosed at Shanghai Children's Hospital in 2020, and summarized similar cases recorded in databases such as PubMed, Wanfang, Chinese Medical Association Journals, and WIP from January 2006 to November 2024. This study was approved by the Medical Ethics Committee of our hospital (Ethics No.: 2025R128-E01). RESULTS: Patient 1 was the younger brother, who presented at 8 years of age with growth retardation, folliculitis, erythema nodosum, and perineal abscess. Sequencing revealed that he has carried a hemizygous c.566T>C (p.Leu189Pro) variant of the XIAP gene, which was inherited from his mother. He was allergic to infliximab treatment and underwent allogeneic stem cell transplantation (HSCT) in January 2021. During a follow-up of 3 years and 10 months post-transplantation, he showed no gastrointestinal symptoms and had a good outcome. Patient 2 was the elder brother, who presented at 10 years and 6 months of age with growth retardation, rash, and anal fistula. Genetic testing revealed the same variant. He was treated with oral azathioprine but did not have regular follow-ups. At 14-years-and-6-months of age, he had developed severe gastrointestinal infection and hemophagocytic lymphohistiocytosis, which was alleviated after treatment with antibiotics, glucocorticoids, immunoglobulin, and rituximab. He is currently being prepared for HSCT. A total of 13 publications were retrieved, which involved 64 patients from 23 families, with 23 different variants identified. The main clinical manifestations included splenomegaly (34 cases, 53.1%), hemophagocytic lymphohistiocytosis (27 cases, 42.2%), and inflammatory bowel disease or colitis (20 cases, 31.8%). There were significant phenotypic differences among patients from the same family. Thirteen patients (20.3%) underwent HSCT, with a survival rate of 61.5%. CONCLUSION For male children with early onset, poor treatment response, especially those with unexplained splenomegaly and IBD-like symptoms, early genetic testing is recommended. HSCT is a safe and effective treatment for XIAP deficiency. For patients with developmental delay, early onset, and severe IBD phenotype, early transplantation is recommended.
Humans ; Male ; X-Linked Inhibitor of Apoptosis Protein/deficiency* ; Child ; Genetic Diseases, X-Linked/therapy* ; Phenotype ; Siblings ; Retrospective Studies ; Hematopoietic Stem Cell Transplantation

Objective: To investigate the prevalence of overweight and obesity among children and adolescents in Yangzhou City, and its association with screen behaviors, so as to provide scientific evidence for weight management among students. Methods: In May 2025, an electronic questionnaire survey was conducted among children and adolescents in Yangzhou City. A total of 3 722 participants were selected from grades 4 to 12 in 18 primary and secondary schools (108 classes) by using stratified cluster random sampling. The Chi square test was used to compare the differences in the detection rates of overweight and obesity among children and adolescents with 5 types of screen behaviors (watching TV, playing electronic games, scrolling short videos, screen based learning, electronic socializing) in different time groups each day (never, >0~<2 h, ≥2 h). Multivariate Logistic regression analysis was performed to examine the associations of five types of screen behaviors, presence of electronic devices in the bedroom, and screen use during meals on the weight status of children and adolescents. Results: The prevalence of overweight and obesity among children and adolescents was 37.3%. For all five types of screen behaviors, the differences in the distribution of overweight and obesity detection rates among children and adolescents across the three time spent categories were statistically significant ( χ 2=30.76- 70.78 , all P <0.01). After adjusting for confounding factors, multivariate Logistic regression analysis revealed that frequent or always using screens during meals( OR =1.63, 95％ CI =1.14~2.31), playing video games ( OR =1.28, 95% CI =1.11-1.48), browsing short videos ( OR =1.29, 95％ CI=1.09-1.54), and screen based learning ( OR =1.26, 95％ CI =1.10-1.44) were significantly associated with overweight and obesity among children and adolescents (all P <0.05). Conclusions Excessive screen use is positively correlated with the incidence of overweight and obesity in children and adolescents. Targeted interventions on screen behaviors among children and adolescents are therefore warranted.

ObjectiveTo investigate the mechanism through which miR‑21 improves chronic renal fibrosis in mice via targeted modulation of the phosphatase and tensin homolog （PTEN）/protein kinase B （AKT）/mammalian target of rapamycin （mTOR） pathway. MethodsThirty‑two chronic kidney disease model mice were randomly divided into four groups （n=8 each group）： model group， miR‑21 overexpression group， miR‑21 inhibition group， and miR‑21 inhibition + MK‑2206 group. Eight healthy mice were included as the control group. The miR‑21 overexpression， miR‑21 inhibition， and miR‑21 inhibition + MK‑2206 groups received tail‑vein injections of lentivirus （50 μL， 1×10⁸ TU per mouse） once weekly for three weeks. The control and model groups were injected with an equal volume of empty vector （LV‑NC）. The miR‑21 inhibition + MK‑2206 group additionally received gavage of the AKT/mTOR pathway inhibitor MK‑2206 （480 mg/kg） once weekly for three weeks. The expressions of miR‑21， 24 h urinary protein， serum creatinine （Scr）， blood urea nitrogen （BUN）， and renal tissue levels of collagen Ⅰ， collagen Ⅲ， α‑smooth muscle actin （α‑SMA）， and PTEN protein， as well as p‑AKT/AKT and p‑mTOR/mTOR ratios， were compared among groups. HE staining was used to observe pathological changes in renal tissue， and Masson staining was used to observe the degree of renal fibrosis. A dual‑luciferase assay was performed to verify the targeting relationship between miR‑21 and PTEN. ResultsCompared with the model group， miR‑21 expression in renal tissue increased in the miR‑21 overexpression group （P<0.05） and decreased in the miR‑21 inhibition group （P<0.05）. Compared with the model group， the miR‑21 overexpression group showed increased 24 h urinary protein， Scr， BUN， and renal tissue expression of collagen Ⅰ， collagen Ⅲ， and α‑SMA （all P<0.05）， while these indicators decreased in the miR‑21 inhibition group （P<0.05）. Compared with the miR‑21 inhibition group， the miR‑21 inhibition + MK‑2206 group exhibited lower 24‑h urinary protein， Scr， BUN， and renal tissue expression of Collagen Ⅰ， Collagen Ⅲ， and α‑SMA （all P<0.05）. Compared with the model group， the miR‑21 overexpression group showed decreased PTEN protein expression （P<0.05） and increased p‑AKT/AKT and p‑mTOR/mTOR ratios （P<0.05）， while the miR‑21 inhibition group showed increased PTEN expression （P<0.05） and decreased p‑AKT/AKT and p‑mTOR/mTOR ratios （P<0.05）. Compared with the miR‑21 inhibition group， the miR‑21 inhibition + MK‑2206 group had lower p‑AKT/AKT and p‑mTOR/mTOR ratios （P<0.05）， with no significant difference in PTEN protein expression. HE and Masson staining showed normal kidney structure and almost no fibrosis in the control group. The model group exhibited glomerular enlargement， capillary loop adhesion， and focal fibrosis. The miR-21 overexpression group showed severe destruction of glomerular structure， accompanied by extensive fibrosis and renal tubular atrophy. The pathological changes and degree of fibrosis were alleviated in the miR-21 inhibition group. The miR-21 inhibition + MK-2206 group showed only mild pathological changes and mild fibrosis， with the interstitium being largely normal. Compared with PTEN-WT + NC mimics 1， the relative luciferase activity in the PTEN-WT + miR-21 mimics group decreased （P<0.001）. There was no statistically significant difference in relative luciferase activity between PTEN-WT + NC mimics group and PTEN-MUT + miR-21 mimics group. ConclusionmiR‑21 may improve renal function indicators and alleviate renal fibrosis in chronic kidney disease mice via targeted modulation of PTEN and subsequently inhibiting the AKT/mTOR pathway.