【Objective】 To investigate the effect of isoliquiritigenin on inflammatory response of vascular endothelial cells and whether the regulatory effect of isoliquiritigenin on inflammation is mediated by histone deacetylase 3 (HDAC3). 【Methods】 Human umbilical vein endothelial cells (HUVECs) were cultured in vitro and treated with LPS, different concentrations of isoliquiritigenin and HDAC3 specific inhibitor, respectively. Real-time PCR and Western blotting were used to detect the mRNA and protein expressions of inflammatory cytokines and HDAC3. Male C57BL/6J mice were randomly divided into vehicle group and isoliquiritigenin treatment group. The vascular inflammation model of C57BL/6J mice was established by ligation of the left carotid arteries. The mRNA expressions of inflammatory cytokines and HDAC3 in the carotid arteries of mice were detected by Real-time PCR. A molecular docking study was performed to investigate the interaction between isoliquiritigenin and HDAC3. 【Results】 Compared with the vehicle group, isoliquiritigenin reduced the mRNA expressions of inflammatory cytokines NLRP3, IL-1β, IL-18, MCP-1 and ICAM-1 and decreased the expression of HDAC3 mRNA and protein in HUVECs stimulated with LPS. In addition, isoliquiritigenin also decreased the mRNA expressions of NLRP3, IL-1β and HDAC3 in carotid arteries of ligated C57BL/6J mice. The docking of isoliquiritigenin in the active site of HDAC3 showed that isoliquiritigenin might act through HDAC3. Furthermore, HDAC3 specific inhibitor RGFP966 further promoted the inhibitory effect of isoliquiritigenin on the expression of inflammatory cytokines in vascular endothelial cells. 【Conclusion】 These results suggest that isoliquiritigenin suppresses the inflammatory response of vascular endothelial cells via HDAC3.

Background Although transforming growth factor-β (TGF-β)/Smad signaling pathway is important in regulating the occurrence and development of pulmonary fibrosis, the pathogenesis of pulmonary fibrosis remains elusive. Objective To explore the functions of genes associated with TGF-β/Smad signaling pathway in the progression of pulmonary fibrosis. Methods A NIH-3T3 fibroblast model induced by TGF-β1 was established. The experiment samples were divided into a control group and a TGF-β1 treatment group. The control group was exposed to normal saline, while the TGF-β1 treatment group was exposed to 10 ng·mL⁻¹ TGF-β1 for 12 h. The RNAs of the two groups were extracted, sequenced, and analyzed by bioinformatics methods to identify seven key genes in TGF-β pathway, including Dcn, Smad3, Smad7, Fbn1, Thbs1, TGF-β1, and TGF-β3. The gene expression levels of five markers [Collagen1α1, Collagen1α2, α-smooth muscle actin (α-SMA), TGF-β1, and TGF-β3] and the seven key genes were detected by quantitative real-time PCR (qRT-PCR). The proteins of the two groups were extracted. The important marker protein expression levels of Smad3, the phosphorylation of Smad3 (P-Smad3), and α-SMA were detected by Western blotting. At the same time, 30 healthy SPF-grade C57BL/6 mice were randomly divided into three groups, with 10 mice in each group: a control group, a SiO₂ inhalation exposure group for 28 d (10 mice), and a SiO₂ inhalation exposure group for 56 d (10 mice). The mice in the two treatment groups were exposed to a natural SiO₂ environment for 4 h per day with a 10-min pause for breathing fresh air at 2 h intervals. The lung tissues of the mice were taken after execution. The changes of pulmonary fibrosis were detected by Masson staining, and mRNAs and proteins were extracted to detect the expression of the above key genes and proteins. Results The expression levels of the five marker genes Collagen1α1, Collagen1α2, α-SMA, TGF-β1, and TGF-β3 were significantly increased in the TGF-β1-induced NIH-3T3 fibroblasts than those in the control group (P < 0.01); the expression levels of P-Smad3 and α-SMA proteins increased significantly (P < 0.01); the expression results of the seven key genes screened in the TGF pathway were that Dcn and Smad3 were obviously down-regulated (P < 0.01), and Smad7, Fbn1, Thbs1, TGF-β1, and TGF-β3 were obviously up-regulated (P < 0.01). The changes in gene expression levels of the transcriptome sequencing showed the same trend. The results of Masson staining showed that the content of collagen fibers in the lung tissues also increased in the SiO₂ inhalation exposure groups over time. In the mouse experiment, five marker genes were obviously up-regulated compared with the control group (P < 0.01); no obvious change was found in the expression of Smad3 protein, and the expression levels of P-Smad3 and α-SMA were obviously higher in the SiO₂ exposure groups than those in the control group (P < 0.01); the expression levels of Dcn and Smad3 showed a down-regulated trend, while the expression levels of Smad7, Fbn1, Thbs1, TGF-β1, and TGF-β3 showed an up-regulated trend with the increase of SiO₂ inhalation exposure days (P < 0.01). The expression levels of the above five marker genes, three important marker proteins, and seven key genes were consistent with the expression trends of TGF-β1-induced NIH-3T3 fibroblasts. Conclusion The expression levels of pulmonary fibrosis-related marker genes and proteins change significantly in TGF-β1-induced fibroblast cells, and the lung tissues of mice under natural SiO₂ inhalation exposure has obvious fibrosis characteristics. Seven genes (Dcn, Smad3, Smad7, Fbn1, Thbs1, TGF-β1, and TGF-β3) may be involved in the regulation of pulmonary fibrosis by the TGF-β/Smad signaling pathway.

OBJECTIVE: To explore the genetic basis for three children patients with CHARGE syndrome. METHODS: The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing. RESULTS: All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo. CONCLUSION Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.
CHARGE Syndrome/genetics* ; Child ; DNA Helicases/genetics* ; DNA-Binding Proteins/genetics* ; Genetic Variation ; Humans ; Mutation ; Phenotype

OBJECTIVE: To explore the genetic basis for a child with ocular anomaly, microcephaly, growth retardation and intrauterine growth restriction. METHODS: The patient underwent ophthalmologic examinations including anterior segment photography, fundus color photography, and fundus fluorescein angiography. The patient and her parents were subjected to whole exome sequencing. Candidate variants were verified by Sanger sequencing and bioinformatic analysis. RESULTS: The patient was found to have bilateral persistent pupillary membrane and coloboma of inferior iris, in addition with macular dysplasia and radial pigmentation near the hemal arch of the temporal retina. She was found to have carried compound heterozygous missense variants of the PHGDH gene, namely c.196G>A and c.1177G>A, which were respectively inherited from her father and mother. Bioinformatic analysis suggested both variants to be pathogenic. CONCLUSION The patient was diagnosed with phosphoglycerate dehydrogenase deficiency. Above finding has enriched the phenotypic spectrum of the disease with ocular manifestations.
Carbohydrate Metabolism, Inborn Errors/genetics* ; Child ; Coloboma ; Female ; Humans ; Microcephaly/genetics* ; Mutation ; Phenotype ; Phosphoglycerate Dehydrogenase/genetics* ; Psychomotor Disorders/genetics* ; Seizures/genetics* ; Whole Exome Sequencing

Objective:To investigate the MRI features of progressive multifocal leukoencephalopathy (PML) in acquired immunodeficiency syndrome (AIDS) patients, and to provide evidence for clinical diagnosis, evaluation and staging.Methods:Form Janurary 2016 to April 2018, 11 AIDS patients with clinical diagnosis of PML were enrolled at Zhongnan Hospital of Wuhan University. A total of 25 MRI examination data of 11 patients (5 patients underwent multiple examinations) were reviewed. The distribution, morphology and signal characteristics of the lesions were analyzed, and the changes of the lesions between multiple MRI examinations were compared. The lesions of all 25 MR images were staged according to MR features.Results:Typical image findings of PML included confluent, bilateral but asymmetric distributed, supratentorial white matter abnormal signal lesions. The parietal lobe was most commonly involved, followed by the frontal lobe. The lesions often showed hypointensity on T 1 and hyperintensity on T 2 weighted images. No obvious mass effect or enhancement was found. In advanced stage, multifocal white matter lesions were enlarged in size and more confluent, displaying large patchy abnormal signal intensity, with gradually involving the deep white matter, and occasionally combing with gray matter and cerebellar lesions. The disease showed heterogenous signal intensity due to necrosis in the lesion. The newly appeared lesions showed obvious diffusion restriction, demonstrating high signal intensity on diffusion weighted imaing with low apparent diffusion coefficient value. The main finding of the later stage was necrosis, with focal asymmetric brain atrophy was observed. Conclusions:PML in AIDS patients has characteristic MRI findings, and MRI features varies in different stages. MRI can be helpful in clinical diagnosis, evaluation and staging of PML.

Objective To summarize the computed tomographic (CT) manifestations of pulmonary aspergillosis after organ transplantation and compare different signs between pulmonary aspergillosis and bacterial pneumonia.Methods CT images of pulmonary aspergillosis (n =62) and bacterial pneumonia (n =68) in post-transplantation patients were reviewed.The signs were categorized with consolidation,mass,large nodule (≥1crn),small nodule and bud-in-tree pattern.Some detailed useful differentiating signs such as halo sign,air bronchogram sign,reversed halo sign,hypodensity sign and cavitation were also analyzed.Results CT patterns of pulmonary aspergillosis included consolidation,mass,large nodule,small nodule and bud-in-tree pattern.The most common was large nodule (75.8％),followed by consolidation (48.4％)and mass (29.0％).And small nodule (16.1 ％) and bud-in-tree (12.9％) patterns were concurrent.For consolidation pattern,the proportion of bacterial pneumonia (69.1％) was the larger;For mass pattern,the proportion of pulmonary aspergillosis (29.0％) was the larger.For large nodule pattern,there was no difference.The detail sign of large nodule in two groups had no difference In detailed signs of consolidation pattern,air bronchogram sign was more often seen in bacterial pneumonia while cavitation was more frequently found in pulmonary aspergillosis.In detailed signs of mass pattern,pulmonary aspergillosis often has single lesion (66.7％),cavitation (83.3％)and air crescent sign (77.8％) is more common.The proportion of halo sign was 30.7％.Conclusions CT manifestations of pulmonary aspergillosis are diverse after organ transplantation.There is some difference and yet overlap with bacterial pneumonia.

Liver transplantation is an effective treatment for end-stage chronic liver diseases and acute liver failure. With the rapid development of surgical techniques, organ preservation technology, and pharmacotherapy, patients' survival rates are improved constantly. However, postoperative complications are still major influencing factors for postoperative incidence and mortality rates. Since clinical and laboratory examinations lack specificity and it is difficult to diagnose various postoperative complications, the application of imaging techniques effectively solves such problems. This article summarizes the imaging findings of common complications after liver transplantation, such as vascular complications, biliary complications, liver parenchyma lesions, and postoperative infection, and points out that imaging examinations have significant advantages and can be used for comprehensive evaluation of disease progression.

Objective To investigate the clinicopathologic characteristics, differential diagnosis and prognosis of pulmonary epithelioid hemangioendotheliomas (PEHs).Methods The clinical symptoms and imaging findings of 6 cases of PEHs were investigated and pathologic analyses including histomorphologic and immunohistochemical studies were performed.Results Clinical symptoms of the patients were nonspecific and insidious.The typical radiological manifestation was characterized by multiple small pulmonary nodules. The pathological findings were well-demarcated hypocellular hyalinized nodules with more cellularity at the periphery of the nodule. The neoplastic cells showed mild nuclear atypia and prominent eosinophilic cytoplasm with vacuoles, attempting to form primitive vasculature.Immunohistochemically, tumor cells were positive to CD31, CD34 and ERG.Follow-up data from 8 months to 5 years showed no tumor progression, except for the development of bone metastases in one case at 6 months.Conclusions PEHs are uncommon vascular tumors with low-intermediate malignancy. Using H&E and immunohistochemistry, the final pathological diagnosis can be made and misdiagnosed as a benign fibrotic nodule or other malignant tumors can be avoided. The most effective treatment is surgical resection, if necessary, combined with chemotherapy or radiotherapy.

OBJECTIVE: To investigate the diagnosis applying effects of ocular vestibular evoked myogenic potentials(oVEMP) in peripheral BPPV disease. METHOD: During September 2012 to January 2015, we selected 80 healthy people in our hospital medical center as the control group, choose the same period of primary benign paroxysmal positional vertigo as the observation group of 80 patients. Two groups were carried out fully functional auditory evoked potential analysis, determination of oVEMP and cervical vestibular evoked myogenic potentials (cVEMP) anomaly amplitude threshold, P1 latencies, N1 incubation period. RESULT: The cVEMP abnormal rate in the observation group was 28.8%, the oVEMP abnormal rate was 38.8%, while cVEMP and oVEMP abnormal rates in the control group was 1.3% and 2.5% respectively that compared to significant differences between the two groups (P < 0.05). The oVEMP test amplitude in the observation group was (5.98 ± 2.15) µv, the N1 incubation period was (10.03 ± 0.76)ms, while the control group were (4.09 ± 2.11)µv and (11.67 ± 0.78) ms that compared difference were statistically significant (P < 0.05). The cVEMP test amplitude in the observation group was (154.8 ± 43.9)2 µv, while the control group was (180.49 ± 45.34)µv, compared the difference was statistically significant (P < 0.05). CONCLUSION Paroxysmal positional vertigo patients ocular vestibular evoked myogenic potentials abnormal rate is relatively high, the utricle dysfunction for more severe than the balloon can be the subject of an objective function of the ear stone judgment, judgment in favor of the disease.
Benign Paroxysmal Positional Vertigo ; diagnosis ; Case-Control Studies ; Humans ; Saccule and Utricle ; physiopathology ; Vestibular Evoked Myogenic Potentials

Objective The purpose of this study was to investigate the differences of cognitive impairment and neuropsychiatric behavior disturbances between Alzheimer's disease (AD) and frontotemporal dementia (FTD) patients,as well as their relationships with dementia severity.Methods A total of 38 FTD patients and 46 AD patients were recruited in this study.The Montreal Cognitive Assessment (MoCA) and Mini-Mental State Examination (MMSE) were used to evaluate the degree of cognitive impairments.The Neuropsychiatric Inventory Brief Questionnaire Form (NPI) and Frontal Behavioral Inventory (FBI) were used to measure behavioral disturbances.The 21-items Hamilton Depression Rating Scale (HAMD-21) was used to evaluate the mental or emotional state of patients.Clinical dementia rating scale (CDR) was used to divide the dementia severity.Results FTD patients were younger ((70.13 ± 8.36) years vs (66.46 ± 7.04) years,t =2.124,P =0.037),earlier at age of onset ((68.58 ± 8.51) years vs (64.43 ± 6.82) years,t =2.396,P =0.019),with lower MoCA scores (12.50 (8.00,16.25) vs 17.00(10.75,21.00),Z=-2.428,P=0.015),higher NPI (15.00(7.00,25.50)vs 9.50(4.00,17.75),Z=-2.251,P=0.024),FBI (21.00(13.00,27.00)vs 16.00(10.75,23.00),Z=-2.159,P=0.031),FBI-A (13.00 (8.00,16.00)vs 9.00(6.00,12.00) Z=-2.159,P=0.041),FBI-B (9.00(7.00,14.00) vs 7.00(3.00,11.00),Z=-2.051,P=0.040) and HAMD-21 scores (7.00(2.75,14.00) vs 5.00 (3.00,8.00),Z =-2.061,P =0.039).A detail analysis of different cognitive domains showed the executive functions (Z =-2.140,P =0.032),language (Z =-3.357,P =0.001),abstraction (Z =-2.498,P =0.012) and delayed recall (Z =-4.317,P =0.000) of the MoCA scale were lower in FTD patients than that in AD patients,while AD patients had lower scores in memory (Z =-1.999,P =0.046) and orientation (Z =-2.941,P =0.003) of the MMSE scale.Within the subscale scores of the NPI,the agitation (Z =-3.255,P =0.001),disinhibition (Z =-3.093,P =0.002) and irritability (Z =-2.214,P =0.027) scores were higher in FTD patients than in AD patients.The total scores of NPI (r=0.279,P=0.010),FBI (r =0.353,P=0.001),FBI-A (r=0.386,P=0.000) and FBI-B (r =0.273,P =0.012) were positively correlated with the CDR scores,whereas MoCA scores were negatively correlated with the CDR scores (r =-0.760,P =0.000).The subscale scores on MoCA and NPI areas changed corresponding with dementia severity in both groups.Conclusions The cognitive function,behavioral and psychological symptoms between FTD and AD patients are different.FTD patients have poorer executive function,language,abstraction and delayed recall ability,whereas AD patients perform worse in memory and orientation.With the progression of the disease,FTD patients gradually emerged disorientation,while the cognitive impairment in AD patients almost affected all the areas.FTD patients are more likely to have agitation,disinhibition and irritability behavior,and AD patients are more likely to have depression in the late stage.Dynamic evaluation of the cognitive function,behavioral and psychological symptoms in clinical practice can help to distinguish FTD and AD.