Turning to critical illness is a common stage of various diseases and injuries before death. Patients usually have complex health conditions, while the treatment process involves a wide range of content, along with high requirements for doctor′s professionalism and multi-specialty teamwork, as well as a great demand for time-sensitive treatments. However, this is not matched with critical care professionals and the current state of medical care in China. Telemedicine, which shortens the distance of medical professionals and the gap of disease diagnosis and treatments in various regions through electronic information, can effectively solve the current problem. Therefore, there is an urgent need to develop a standardized, high-quality visualization telemedicine round system .Therefore, experts have been organized to search domestic and foreign literature on telemedicine round for critically ill patients and to form this consensus based on clinical experiences so as to further improve the level of critical care treatments in regions.

To investigate the feasibility and advantages of "Axis Coordinate Localization Method" combined with total endoscopic technique for parotid surgery. A total of 31 patients with parotid gland tumors who were admitted to the First Affiliated Hospital of Zhengzhou University from January 2022 to August 2024 were included in this study. The cohort comprised 11 males and 20 females, with age of (38.9±13.9) years and a maximum tumor diameter of (19.34±6.89) mm. Among these cases, 93.5% (29/31) involved the superficial lobe and 6.5%(2/31) the deep lobe of the parotid gland. The "axial" localization method was utilized to plan the surgical approach: establishing a coordinate system with the earlobe as the origin, the surface projection of the parotid duct as the x-axis, and a perpendicular line through the origin as the y-axis. The incision type-pre-tragal, retroauricular groove, or postauricular hairline-was selected according to the position of the tumor′s surface projection center within this coordinate system. All operations were performed using a complete endoscopic technique for tumor and glandular tissue resection. Postoperative facial nerve function was assessed with the House-Brackmann grading scale, while patient incision satisfaction, impact on work and daily life, and facial symmetry were quantitatively evaluated using a Numerical Rating Scale (10-point system).　All 31 patients successfully underwent the procedure. Short-term postoperative complications included temporary facial paralysis in 1 case (3.2%), periauricular numbness in 1 case (3.2%), surgical site effusion in 1 case (3.2%), and subcutaneous hematoma in 1 case (3.2%). All complications resolved after appropriate management. During follow-up, there were no instances of sialocele, Frey syndrome, incision infection, or tumor recurrence. Patient ratings were as follows: incision satisfaction (9.42±0.78), impact of surgery on daily life (1.32±0.60), and facial symmetry (9.29±0.78). The one case of temporary facial paralysis recovered 3 months after surgery. The combination of the "Axial" localization method and fully endoscopic technique demonstrates clear clinical feasibility in parotid tumor resection. This approach enables rapid and personalized incision selection based on tumor location, while the endoscopic minimally invasive technique reduces tissue trauma, improves cosmetic outcomes, and enhances surgical safety. It provides a new minimally invasive treatment pathway for patients with benign parotid tumors.

To investigate the feasibility and advantages of "Axis Coordinate Localization Method" combined with total endoscopic technique for parotid surgery. A total of 31 patients with parotid gland tumors who were admitted to the First Affiliated Hospital of Zhengzhou University from January 2022 to August 2024 were included in this study. The cohort comprised 11 males and 20 females, with age of (38.9±13.9) years and a maximum tumor diameter of (19.34±6.89) mm. Among these cases, 93.5% (29/31) involved the superficial lobe and 6.5%(2/31) the deep lobe of the parotid gland. The "axial" localization method was utilized to plan the surgical approach: establishing a coordinate system with the earlobe as the origin, the surface projection of the parotid duct as the x-axis, and a perpendicular line through the origin as the y-axis. The incision type-pre-tragal, retroauricular groove, or postauricular hairline-was selected according to the position of the tumor′s surface projection center within this coordinate system. All operations were performed using a complete endoscopic technique for tumor and glandular tissue resection. Postoperative facial nerve function was assessed with the House-Brackmann grading scale, while patient incision satisfaction, impact on work and daily life, and facial symmetry were quantitatively evaluated using a Numerical Rating Scale (10-point system).　All 31 patients successfully underwent the procedure. Short-term postoperative complications included temporary facial paralysis in 1 case (3.2%), periauricular numbness in 1 case (3.2%), surgical site effusion in 1 case (3.2%), and subcutaneous hematoma in 1 case (3.2%). All complications resolved after appropriate management. During follow-up, there were no instances of sialocele, Frey syndrome, incision infection, or tumor recurrence. Patient ratings were as follows: incision satisfaction (9.42±0.78), impact of surgery on daily life (1.32±0.60), and facial symmetry (9.29±0.78). The one case of temporary facial paralysis recovered 3 months after surgery. The combination of the "Axial" localization method and fully endoscopic technique demonstrates clear clinical feasibility in parotid tumor resection. This approach enables rapid and personalized incision selection based on tumor location, while the endoscopic minimally invasive technique reduces tissue trauma, improves cosmetic outcomes, and enhances surgical safety. It provides a new minimally invasive treatment pathway for patients with benign parotid tumors.

Turning to critical illness is a common stage of various diseases and injuries before death. Patients usually have complex health conditions, while the treatment process involves a wide range of content, along with high requirements for doctor′s professionalism and multi-specialty teamwork, as well as a great demand for time-sensitive treatments. However, this is not matched with critical care professionals and the current state of medical care in China. Telemedicine, which shortens the distance of medical professionals and the gap of disease diagnosis and treatments in various regions through electronic information, can effectively solve the current problem. Therefore, there is an urgent need to develop a standardized, high-quality visualization telemedicine round system .Therefore, experts have been organized to search domestic and foreign literature on telemedicine round for critically ill patients and to form this consensus based on clinical experiences so as to further improve the level of critical care treatments in regions.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.

Objective:To explore the potential of integrating virtual surgery with three-dimensional (3D) printed guides in the surgical management of mandibular benign tumors and subsequent reconstruction of bone defects.Methods:A retrospective analysis was conducted on the clinical data of patients who underwent computer-assisted resection and vascularized fibular flap reconstruction for benign mandibular tumors at the Department of Oral and Maxillofacial Surgery, First Affiliated Hospital of Zhengzhou University, from June 2013 to December 2020. According to the utilization of guide plates for mandibular and fibular osteotomy during surgical procedures or not, the patients were categorized into two cohorts: a guide plate cohort and a non-guide plate cohort. In the guide plate group, custom-designed gudie plates based on virtual surgical plans were fabricated using 3D printing technology and employed intraoperatively; In the non-guide plate group, surgery was exclusively performed based on virtual surgical plan and prebent titanium plate without any supplementary plating. The measured outcomes included fibular flap osteotomy, operation duration, and clinical flap survival. Computed tomography images obtained one week post-surgery were utilized to assess the intersegmental commissure degree between fibular segments as well as between fibular segments and mandible, commissure degree between fibular segments and prebent titanium plate, and condyle position. The satisfaction of patients with their facial appearance was evaluated 6 months after the surgery using a visual analogue scale. Statistical analysis was conducted using SPSS 21.0 software. Independent sample t-tests was utilized to compare the duration of operation and and postoperative evaluation of facial appearance, the Chi-square tests was utilized for condyle position, commissure degrees among interactions involving fibular segments, prebent titanium plates, bone segments( P<0.05 denoted statistical significance). Results:A total of 30 patients were enrolled, comprising 17 males and 13 females, with a median age of 24 years (16-64 years). The preparation process of fibular flaps proceeded smoothly. The required length of fibula was measured as (14.1 ± 1.9) cm (5.7-18.1 cm), while the number of fibular segments ranged from 2 to 4, averaging at approximately 2.9 ± 0.6. The mandibular defects were repaired using a single-layer fibula in 12 cases, a vascularized folded fibula in 7 cases and a combination of vascularized and non-vascularized fibula in 11 cases. The operation time for the guide plate group was recorded as ( 335.9 ± 64.0) min (240-433 min), while it was observed to be (470.7 ± 140.5 ) min (280-680 min) for the non-guide plate group.The postoperative follow-up duration ranged from 9 to 23 months, with an average period of 11 months. All fibular flaps demonstrated clinical survival. The number of patients with good commissure degree between fibular and mandibular segments, between prebent titanium plate and fibular and mandibular segments and the position of condyle were 15, 15 and 13 cases in guide plate group, 10, 13 and 11 cases in non-guide plate group respectively. The statistical analysis revealed a significant difference ( P<0.05) in the degree of commissure between the fibular and the mandibular segments (15/15 vs. 10/15) in the two groups. Both groups exhibited high levels of satisfaction regarding their postoperative facial appearance at the 6 months follow-up, observed to be 9.6±0.5 and 9.3±0.5 respectively, and the statisticla analysis revealed non-significant difference ( P>0.05). Conclusion:The integration of virtual surgery with 3D printed guide plates can effectively reduce operative time and improve precision in the repair and reconstruction of free-fibular flaps following resection of benign tumors of the mandible.

Objective:To explore the potential of integrating virtual surgery with three-dimensional (3D) printed guides in the surgical management of mandibular benign tumors and subsequent reconstruction of bone defects.Methods:A retrospective analysis was conducted on the clinical data of patients who underwent computer-assisted resection and vascularized fibular flap reconstruction for benign mandibular tumors at the Department of Oral and Maxillofacial Surgery, First Affiliated Hospital of Zhengzhou University, from June 2013 to December 2020. According to the utilization of guide plates for mandibular and fibular osteotomy during surgical procedures or not, the patients were categorized into two cohorts: a guide plate cohort and a non-guide plate cohort. In the guide plate group, custom-designed gudie plates based on virtual surgical plans were fabricated using 3D printing technology and employed intraoperatively; In the non-guide plate group, surgery was exclusively performed based on virtual surgical plan and prebent titanium plate without any supplementary plating. The measured outcomes included fibular flap osteotomy, operation duration, and clinical flap survival. Computed tomography images obtained one week post-surgery were utilized to assess the intersegmental commissure degree between fibular segments as well as between fibular segments and mandible, commissure degree between fibular segments and prebent titanium plate, and condyle position. The satisfaction of patients with their facial appearance was evaluated 6 months after the surgery using a visual analogue scale. Statistical analysis was conducted using SPSS 21.0 software. Independent sample t-tests was utilized to compare the duration of operation and and postoperative evaluation of facial appearance, the Chi-square tests was utilized for condyle position, commissure degrees among interactions involving fibular segments, prebent titanium plates, bone segments( P<0.05 denoted statistical significance). Results:A total of 30 patients were enrolled, comprising 17 males and 13 females, with a median age of 24 years (16-64 years). The preparation process of fibular flaps proceeded smoothly. The required length of fibula was measured as (14.1 ± 1.9) cm (5.7-18.1 cm), while the number of fibular segments ranged from 2 to 4, averaging at approximately 2.9 ± 0.6. The mandibular defects were repaired using a single-layer fibula in 12 cases, a vascularized folded fibula in 7 cases and a combination of vascularized and non-vascularized fibula in 11 cases. The operation time for the guide plate group was recorded as ( 335.9 ± 64.0) min (240-433 min), while it was observed to be (470.7 ± 140.5 ) min (280-680 min) for the non-guide plate group.The postoperative follow-up duration ranged from 9 to 23 months, with an average period of 11 months. All fibular flaps demonstrated clinical survival. The number of patients with good commissure degree between fibular and mandibular segments, between prebent titanium plate and fibular and mandibular segments and the position of condyle were 15, 15 and 13 cases in guide plate group, 10, 13 and 11 cases in non-guide plate group respectively. The statistical analysis revealed a significant difference ( P<0.05) in the degree of commissure between the fibular and the mandibular segments (15/15 vs. 10/15) in the two groups. Both groups exhibited high levels of satisfaction regarding their postoperative facial appearance at the 6 months follow-up, observed to be 9.6±0.5 and 9.3±0.5 respectively, and the statisticla analysis revealed non-significant difference ( P>0.05). Conclusion:The integration of virtual surgery with 3D printed guide plates can effectively reduce operative time and improve precision in the repair and reconstruction of free-fibular flaps following resection of benign tumors of the mandible.

Objective To investigate the predictive value of a nomogram model constructed based on imaging combined with prostate-specific antigen(PSA)and its related parameters for biopsy in patients with PSA levels of 4-10 ng/mL.Methods The serological and imaging data of 191 patients who were detected for PSA and related indicators and underwent the first biopsy of prostate by transrectal ultrasound at Zhongshan City People's Hospital and/or Yunfu Hospital of TCM from January 2018 to December 2023 were analyzed retrospectively.Multivariate Logistic regression identified independent risk factors for prostate cancer,and a nomogram model was developed for patients with PSA levels of 4-10 ng/mL.The predictive performance of the model was evaluated using receiver operating characteristic(ROC)curves,calibration curves,and decision curves.Results The multivariate Logistic regression analysis showed that free PSA,prostate volume,transition zone volume,PSA density,and the prostate imaging-reporting and data system(PI-RADS v2.1)score were independent risk factors for prostate cancer.The model incorporating these significant variables demonstrated the best performance,with an area under the curve(AUC)of 0.750(95%CI:0.678-0.821),sensitivity of 72.7%,specificity of 77.2%,and accuracy of 74.9%.The calibration curve indicated good agreement between the predicted probability and the actual probability of prostate cancer;and the decision curve analysis further confirmed that the model had high clinical utility.Conclusion The constructed nomogram prediction model can effectively estimate the preoperative risk of prostate cancer in patients with PSA levels of 4-10 ng/mL,providing clinicians with an intuitive tool to adjust treatment plans based on the assessed risk,thereby optimizing patient outcomes.

Objective To investigate the predictive value of a nomogram model constructed based on imaging combined with prostate-specific antigen(PSA)and its related parameters for biopsy in patients with PSA levels of 4-10 ng/mL.Methods The serological and imaging data of 191 patients who were detected for PSA and related indicators and underwent the first biopsy of prostate by transrectal ultrasound at Zhongshan City People's Hospital and/or Yunfu Hospital of TCM from January 2018 to December 2023 were analyzed retrospectively.Multivariate Logistic regression identified independent risk factors for prostate cancer,and a nomogram model was developed for patients with PSA levels of 4-10 ng/mL.The predictive performance of the model was evaluated using receiver operating characteristic(ROC)curves,calibration curves,and decision curves.Results The multivariate Logistic regression analysis showed that free PSA,prostate volume,transition zone volume,PSA density,and the prostate imaging-reporting and data system(PI-RADS v2.1)score were independent risk factors for prostate cancer.The model incorporating these significant variables demonstrated the best performance,with an area under the curve(AUC)of 0.750(95%CI:0.678-0.821),sensitivity of 72.7%,specificity of 77.2%,and accuracy of 74.9%.The calibration curve indicated good agreement between the predicted probability and the actual probability of prostate cancer;and the decision curve analysis further confirmed that the model had high clinical utility.Conclusion The constructed nomogram prediction model can effectively estimate the preoperative risk of prostate cancer in patients with PSA levels of 4-10 ng/mL,providing clinicians with an intuitive tool to adjust treatment plans based on the assessed risk,thereby optimizing patient outcomes.

Objective:As the amount of scientific reagents/consumables procurement in tertiary medical institutions increases year by year, it is necessary to seek for a more optimized operation mode for the current management needs to improve the procurement service and management of scientific reagents/consumables.Methods:Focused on the bottleneck problem of scientific research reagents/consumables procurement management, combined with the investigation of management mode in the same field and the review of relevant literature, a scientific research reagents/consumables procurement platform suitable for hospital was established, which was operated in the whole hospital for 2 years and continuingly improved.Results:The application of the scientific reagents/consumables procurement platform is expected to save 7%~8% of the scientific reagents/consumables related expenditure, which can make the scientific research procurement work standardized and simple, the procurement management precise and fast, and also provide favorable support for the prevention and control of epidemic diseases in hospitals.Conclusions:This platform is conducive to improving the service and management level of scientific reagents/consumables procurement in our hospital, and has conditions to expand the scope and increase the depth of management and service.