OBJECTIVE: To analyze the demographic and clinical characteristics of inpatients with osteoporotic vertebral compression fractures (OVCF) and provide a basis for clinical prevention and treatment. METHODS: A retrospective analysis was performed on the clinical data of 744 inpatients diagnosed with OVCF between January 2017 and December 2021 who met the inclusion criteria. Among them, 146 were male and 598 were female, with age ranging from 50 to 95 years (mean, 69.37 years). The demographic characteristics (gender, age, ethnicity, occupation, regional distribution, urban-rural distribution, and seasonal incidence) and clinical features [causes of injury, history of vertebral fractures, smoking and drinking history in males, comorbidities (hypertension, diabetes, coronary atherosclerotic heart disease, cerebral infarction), body mass index (BMI), blood lipid levels, menopausal age in females, vertebral bone mineral density T-value, number of vertebral fractures, and fracture segment distribution] of OVCF patients were analyzed. Multiple linear regression was used to analyze the independent risk factors of vertebral osteoporosis. RESULTS: The demographic analysis indicated that female patients with OVCF were significantly younger than male patients ( P<0.05). Significant differences were observed in the age distribution of OVCF between males and females ( P<0.05), with the highest proportion of male patients in the 70-79 years group (37.0%) and the highest proportion of female patients in the 60-69 years group (40.0%). From 2017 to 2021, the age of onset for OVCF gradually increased, with a similar trend observed for both genders. The distribution of occupations between genders also showed significant differences ( P<0.05); with the top three occupations for males being farmers (48.6%), retirees (24.7%), and workers (13.7%), while for females, the leading occupations were farmers (51.5%), retirees (19.4%), and service workers (10.0%). Female OVCF patients had higher BMI, vertebral bone mineral density T-value, history of vertebral fractures, hypertension prevalence, and blood lipid levels compared to male patients ( P<0.05). No significant difference between the males and the females was found in ethnicity, seasonal distribution, regional distribution, urban-rural distribution, causes of injury, number of vertebral fractures, or prevalence of comorbidities (except hypertension) ( P>0.05). Among the 744 OVCF patients, a total of 1 309 vertebrae were involved, with 628 thoracic vertebrae (48.0%) and 681 lumbar vertebrae (52.0%). The most common fracture segments were L ₁ (22.5%), T ₁₂ (21.2%), followed by L ₂ (12.2%) and T ₁₁ (10.2%). No significant gender difference was observed in the distribution of fracture segments ( P>0.05). Multiple linear regression analysis indicated that older age, female, and lower BMI were independent risk factors for vertebral osteoporosis ( P<0.05). CONCLUSION The age of onset of OVCF patients is increasing year by year. The number of fractured vertebral bodies, age distribution of morbidity, occupational distribution, BMI, history of vertebral fracture, hypertension, and blood lipid levels are related to gender. The occurrence of OVCF is mainly in the thoracolumbar segment. The female, older age, and lower BMI are independent risk factors of osteoporosis.
Humans ; Male ; Female ; Aged ; Middle Aged ; Retrospective Studies ; Spinal Fractures/etiology* ; Aged, 80 and over ; Osteoporotic Fractures/etiology* ; Fractures, Compression/etiology* ; Risk Factors ; Bone Density ; China/epidemiology* ; Osteoporosis/epidemiology* ; Comorbidity ; Inpatients ; Sex Factors ; Age Factors

Turning to critical illness is a common stage of various diseases and injuries before death. Patients usually have complex health conditions, while the treatment process involves a wide range of content, along with high requirements for doctor′s professionalism and multi-specialty teamwork, as well as a great demand for time-sensitive treatments. However, this is not matched with critical care professionals and the current state of medical care in China. Telemedicine, which shortens the distance of medical professionals and the gap of disease diagnosis and treatments in various regions through electronic information, can effectively solve the current problem. Therefore, there is an urgent need to develop a standardized, high-quality visualization telemedicine round system .Therefore, experts have been organized to search domestic and foreign literature on telemedicine round for critically ill patients and to form this consensus based on clinical experiences so as to further improve the level of critical care treatments in regions.

Objective This study aimed to investigate the antimicrobial resistance profiles of bacterial strains isolated from pediatric intensive care units(PICU)in China for better antimicrobial therapy.Methods Clinical isolates were collected from 17 institutions,including tertiary care children's hospitals and pediatric department of tertiary general hospitals in China from January 1,2020 to December 31,2022.Antimicrobial susceptibility testing was carried out according to a unified protocol using Kirby-Bauer method or automated systems.Results were interpreted according to the breakpoints released by the Clinical and Laboratory Standards Institute(CLSI)in 2020.Results A total of 10 688 isolates were collected,including gram-positive organisms(39.2％)and gram-negative organisms(60.8％).The top three organisms were S.aureus(13.6％,1 453/10 688),A.baumannii(10.0％,1 067/10 688),and coagulase-negative Staphylococcus(9.9％,1 058/10 688).Multi-drug resistant organisms(MDROs)were very common in children.The prevalence of methicillin-resistant Staphylococcus aureus(MRSA),carbapenem-resistant Enterobacterales(CRE),carbapenem-resistant E.coli,carbapenem-resistant K.pneumoniae(CRKP),carbapenem-resistant A.baumannii(CRAB),and carbapenem-resistant P.aeruginosa(CRPA)was 41.1％,19.4％,8.8％,30.9％,67.4％,and 28.8％,respectively.Overall,more than 50％of Enterobacteriales isolates were resistant to cephalosporins,while nearly 25％of Enterobacteriales isolates were resistant to carbapenems.MDROs were highly resistant to commonly used antibiotics.More than 80％of CRE and CRAB strains were resistant to all beta-lactam antibiotics.CRE and CRAB showed low resistance rates to tigecycline and polymyxin.CRPA showed lower resistance rates to piperacillin,beta-lactamase inhibitor combinations than the resistance rates to third and fourth generation cephalosporins.All of the Staphylococcus and Enterococcus isolates were susceptible to vancomycin and tigecycline.None of PRSP strains isolated from meningitis and nonmeningitis samples were resistant to rifampicin,vancomycin,or linezolid.The prevalence of β-lactamase-negative ampicillin-resistant(BLNAR)strains was 43.3％in Haemophilus influenzae.Conclusions MDROs were prevalent in PICU.It is necessary to establish an effective multidisciplinary team(MDT)to control the antimicrobial resistance.

Objective This study aimed to investigate the antimicrobial resistance profiles of bacterial strains isolated from pediatric intensive care units(PICU)in China for better antimicrobial therapy.Methods Clinical isolates were collected from 17 institutions,including tertiary care children's hospitals and pediatric department of tertiary general hospitals in China from January 1,2020 to December 31,2022.Antimicrobial susceptibility testing was carried out according to a unified protocol using Kirby-Bauer method or automated systems.Results were interpreted according to the breakpoints released by the Clinical and Laboratory Standards Institute(CLSI)in 2020.Results A total of 10 688 isolates were collected,including gram-positive organisms(39.2％)and gram-negative organisms(60.8％).The top three organisms were S.aureus(13.6％,1 453/10 688),A.baumannii(10.0％,1 067/10 688),and coagulase-negative Staphylococcus(9.9％,1 058/10 688).Multi-drug resistant organisms(MDROs)were very common in children.The prevalence of methicillin-resistant Staphylococcus aureus(MRSA),carbapenem-resistant Enterobacterales(CRE),carbapenem-resistant E.coli,carbapenem-resistant K.pneumoniae(CRKP),carbapenem-resistant A.baumannii(CRAB),and carbapenem-resistant P.aeruginosa(CRPA)was 41.1％,19.4％,8.8％,30.9％,67.4％,and 28.8％,respectively.Overall,more than 50％of Enterobacteriales isolates were resistant to cephalosporins,while nearly 25％of Enterobacteriales isolates were resistant to carbapenems.MDROs were highly resistant to commonly used antibiotics.More than 80％of CRE and CRAB strains were resistant to all beta-lactam antibiotics.CRE and CRAB showed low resistance rates to tigecycline and polymyxin.CRPA showed lower resistance rates to piperacillin,beta-lactamase inhibitor combinations than the resistance rates to third and fourth generation cephalosporins.All of the Staphylococcus and Enterococcus isolates were susceptible to vancomycin and tigecycline.None of PRSP strains isolated from meningitis and nonmeningitis samples were resistant to rifampicin,vancomycin,or linezolid.The prevalence of β-lactamase-negative ampicillin-resistant(BLNAR)strains was 43.3％in Haemophilus influenzae.Conclusions MDROs were prevalent in PICU.It is necessary to establish an effective multidisciplinary team(MDT)to control the antimicrobial resistance.

Turning to critical illness is a common stage of various diseases and injuries before death. Patients usually have complex health conditions, while the treatment process involves a wide range of content, along with high requirements for doctor′s professionalism and multi-specialty teamwork, as well as a great demand for time-sensitive treatments. However, this is not matched with critical care professionals and the current state of medical care in China. Telemedicine, which shortens the distance of medical professionals and the gap of disease diagnosis and treatments in various regions through electronic information, can effectively solve the current problem. Therefore, there is an urgent need to develop a standardized, high-quality visualization telemedicine round system .Therefore, experts have been organized to search domestic and foreign literature on telemedicine round for critically ill patients and to form this consensus based on clinical experiences so as to further improve the level of critical care treatments in regions.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.

[Objective]To explore innovative approaches for integrating ethical culture education in traditional Chinese medicine(TCM)colleges and universities,which involves extracting elements of integrity from TCM culture to develop an ethical education program tailored for these institutions.[Methods]Applying literature research methods,this study extracts similarities between TCM culture and ethical culture.It utilizes key TCM concepts like"four diagnoses integration""differential diagnosis and treatment""good prescription""treating both the symptoms and root causes"as a framework for ethical culture education in TCM colleges and universities.[Results]TCM culture is found to contain a wealth of ethical and methodological content,showing high compatibility with ethical culture.Ethical culture education in TCM colleges and universities currently faces challenges,including a lack of comprehensive integration of the"four diagnoses",insufficient"differential diagnosis and treatment",limited use of"good prescriptions"and a weak foundation in"treating both the symptoms and root causes".It is necessary to further improve the achievements of clean culture education in TCM colleges and universities by using measures such as finding out the reality of clean ideology education,improving the clean culture education system,skillfully carrying out clean culture education,and building a solid line of clean culture education.[Conclusion]Through case study of Zhejiang Chinese Medical University provides insights into the current state of ethical education.It emphasizes the need to improve the ethical culture education system,execute ethical culture education strategically and strengthen the ethical education defense line.These findings could serve as a model for ethical culture education in universities.

In order to study the biological characteristics and whole-genome sequence of Streptococ-cus equi,a sheep-derived Streptococcus equi preserved in our laboratory was subjected to recovery,biochemical experiments,drug susceptibility tests and animal experiments,and followed by whole genome sequencing and annotation of the gene functions of the genome by using the biogenetic da-tabase.The biochemical identification results showed that this strain could ferment sugars,but the results of nitrate,catalase,V-P test,and M-R test were negative;the drug susceptibility test results showed that this strain was highly sensitive to most antibiotics and was resistant to kanaphylaxis.It was resistant to amikacin and amikacin;animal experiments showed that the lethality rate of this strain to mice was 100％,and the median lethal dose of this strain was measured to be 4.86X 106 CFU/kg.According to the pathological section results of mice,it showed that the lungs,liver,kidneys,and spleen all had varying degrees of lesions.The whole genome sequencing results showed that the total genome length of this strain is 2 272 497 bp,the G+C content was 41.1％,and it was predicted to contain 2 124 CDS regions.The RNA prediction results showed that the number of rRNA and tRNA was 15,and the number of tRNA was 57.There were four prophages and gene islands,and there were 362 pathogenicity-related genes in the VFDB database without CRISPR sequences.This study analyzed the complete genome of Streptococcus equi derived from sheep,and also provided a theoretical basis for the treatment,prevention and control of the disease.

Objective:The surgical method and clinical efficacy was studied on the anterior lateral malleolar venous network grafting in repair of the defects of superficial palmar arch.Methods:From February 2015 to July 2021, 8 cases (6 males and 2 females; aged 32-44 years old, mean age at 39 years old) were treated in the Department of Hand Surgery of Yantaishan Hospital. Anterior lateral malleolar venous network was grafted to repair the defects of superficial palmar arch of the patients. The patients had different degrees of tendon damage, and injuries of nerve, deep palmar arch, common palmar digital artery or proper palmar digital artery. The length of the vessel defect was 6.0-10.0 cm. Blood supply insufficiency occurred in 1st-5th digits in 1 case, 2nd-4th fingers in 5 cases, and 2nd-5th fingers in 2 cases. The anterior lateral malleolar venous network was transferred to repair 3 broken ends of vessels in 5 cases, 4 broken ends in 1 case and 5 broken ends in 2 cases. The wound of hand was sutured directly in 2 cases. The emergency surgical repair of the wound of hand by transfer of ALTPF was performed in 2 patients, and elective ALTPF transfer in 3 cases. Forearm dorsi-ulnar flap transfer was performed in 1 case. The follow-up reviews were carried out via the outpatient clinic visit, telephone, WeChat interviews or home visits. The blood supply of the distal digit, skin sensation, TPD, the range of motion of the phalangeal joints were observed.Results:The results showed that all the digits and the grafted flaps survived. The follow-up was carried out for 10-53 months, with an average of 17.9 months. The functions of digit extension and flexion, finger opposition and thumb opposition were restored in 5 cases, and the patients returned back to former jobs. The finger flexion and thumb opposition were limited in 3 cases, and these cases participated in light physical work. The proprioception of the digits were recovered, and the TPD was 5-7 mm. Functional recovery was evaluated according to the Evaluation Standard of Upper Limb Partial Functional of Hand Surgery of Chinese Medical Association and rated as excellent in 5 cases and good in 3 cases. The donor sites of the foot showed a linear scar. There was no effect on the function and the shape of the donor site.Conclusion:The anterior lateral malleolar venous network grafting is an ideal method in repair of the defects of superficial palmar arch.

Nonpharmaceutical interventions (NPIs) have been commonly deployed to prevent and control the spread of the coronavirus disease 2019 (COVID-19), resulting in a worldwide decline in influenza prevalence. However, the influenza risk in China warrants cautious assessment. We conducted a cross-sectional, seroepidemiological study in Shandong Province, Northern China in mid-2021. Hemagglutination inhibition was performed to test antibodies against four influenza vaccine strains. A combination of descriptive and meta-analyses was adopted to compare the seroprevalence of influenza antibodies before and during the COVID-19 pandemic. The overall seroprevalence values against A/H1N1pdm09, A/H3N2, B/Victoria, and B/Yamagata were 17.8% (95% CI 16.2%-19.5%), 23.5% (95% CI 21.7%-25.4%), 7.6% (95% CI 6.6%-8.7%), and 15.0 (95% CI 13.5%-16.5%), respectively, in the study period. The overall vaccination rate was extremely low (2.6%). Our results revealed that antibody titers in vaccinated participants were significantly higher than those in unvaccinated individuals (P < 0.001). Notably, the meta-analysis showed that antibodies against A/H1N1pdm09 and A/H3N2 were significantly low in adults after the COVID-19 pandemic (P < 0.01). Increasing vaccination rates and maintaining NPIs are recommended to prevent an elevated influenza risk in China.