Circadian rhythm(CR)is an intrinsic biological clock mechanism within organisms that regulates physiological and biochemical processes, enabling synchronization with periodic fluctuations in the external environment. This rhythmicity not only influences the sleep-wake cycle but also encompasses various physiological functions, including metabolism, hormone secretion, cell proliferation, and immune responses. Age-related macular degeneration(ARMD), a prevalent retinal disease, has been significantly associated with disruptions in CR. ARMD is among the leading causes of vision loss in the elderly, with a complex pathogenesis involving multiple factors such as genetics, environmental influences, and lifestyle choices. This article will focus on the molecular mechanisms linking CR and ARMD, analyzing how disruptions in CR affect the physiological state and metabolic processes of retinal cells, ultimately contributing to the onset and progression of ARMD. Additionally, this article will elucidate the interactions effects of CR on ARMD in relation to oxidative stress, regulation of Aβ, inflammatory pathways, and mitochondrial homeostasis. By deepening our understanding of the relationship between CR and ARMD, we aim to provide new insights and directions for future clinical interventions and treatments.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

Chronic obstructive pulmonary disease （COPD）， as one of the three major causes of death， is a complex systemic disease with high prevalence， high mortality， high disability， frequent acute exacerbations， and a variety of pulmonary complications. The pathogenesis is complex. Western medicine has no effective specificity scheme for a complete cure. However， multiple-component and multiple-target characteristics of traditional Chinese medicine （TCM） demonstrate significant advantages in COPD treatment through multi-link， multi-pathway， and multi-mechanism intervention. Therefore， exploring the essence of COPD pathogenesis and discovering effective TCM treatment drugs through the application of TCM principles and prescriptions is a key focus of modern research. Animal models are of paramount importance in medical research. It is the first consideration to select appropriate animals， adopt reasonable modeling methods to replicate stable animal models that closely resemble the clinical manifestations and pathophysiological characteristics of COPD， and use appropriate evaluation methods to determine the success of COPD animal models in experimental research. The core of experimental research lies in observing the intervention effect of TCM on COPD animal models， exploring the specific pathways and regulatory mechanisms of TCM on COPD disease， and finding TCM monomers， single herbs， and TCM formulas with definite curative effects. At present， animal model research on COPD mainly involves model establishment， model evaluation， efficacy observation， mechanism exploration， and other aspects. In recent years， there has been no systematic organization， update， and reflection on the relevant research on TCM intervention in COPD animal models. This study reviewed the selection of animals for the COPD model， methods for establishing COPD animal models， model evaluation methods， and the intervention effects of TCM on COPD animal models. It aims to grasp the current research status and identify existing problems for further improvement， in order to provide evidence and support for scientific research and clinical treatment of COPD.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

Chronic obstructive pulmonary disease （COPD）， as one of the three major causes of death， is a complex systemic disease with high prevalence， high mortality， high disability， frequent acute exacerbations， and a variety of pulmonary complications. The pathogenesis is complex. Western medicine has no effective specificity scheme for a complete cure. However， multiple-component and multiple-target characteristics of traditional Chinese medicine （TCM） demonstrate significant advantages in COPD treatment through multi-link， multi-pathway， and multi-mechanism intervention. Therefore， exploring the essence of COPD pathogenesis and discovering effective TCM treatment drugs through the application of TCM principles and prescriptions is a key focus of modern research. Animal models are of paramount importance in medical research. It is the first consideration to select appropriate animals， adopt reasonable modeling methods to replicate stable animal models that closely resemble the clinical manifestations and pathophysiological characteristics of COPD， and use appropriate evaluation methods to determine the success of COPD animal models in experimental research. The core of experimental research lies in observing the intervention effect of TCM on COPD animal models， exploring the specific pathways and regulatory mechanisms of TCM on COPD disease， and finding TCM monomers， single herbs， and TCM formulas with definite curative effects. At present， animal model research on COPD mainly involves model establishment， model evaluation， efficacy observation， mechanism exploration， and other aspects. In recent years， there has been no systematic organization， update， and reflection on the relevant research on TCM intervention in COPD animal models. This study reviewed the selection of animals for the COPD model， methods for establishing COPD animal models， model evaluation methods， and the intervention effects of TCM on COPD animal models. It aims to grasp the current research status and identify existing problems for further improvement， in order to provide evidence and support for scientific research and clinical treatment of COPD.

Objective To elucidate the molecular mechanism of sirtuin-3 (SIRT3) in regulating mitochondrial biogenesis in human renal tubular epithelial cells. Methods Cells were stimulated with different concentrations of H₂O₂ and divided into four groups: control (NC), 50 μmol/L H₂O₂, 110 μmol/L H₂O₂ and 150 μmol/L H₂O₂. SIRT3 protein expression was then measured. SIRT3 was knocked down with siRNA, and cells were further assigned to five groups: control (NC), negative-control siRNA (NCsi), SIRT3-siRNA (siSIRT3), NCsi+H₂O₂, and siSIRT3+H₂O₂. After 24 h, cellular adenosine triphosphate (ATP) and mitochondrial superoxide anion (O₂•⁻) levels were determined, together with mitochondrial expression of SIRT3, peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α), nuclear respiratory factor 1 (NRF1), mitochondrial transcription factor A (TFAM), superoxide dismutase 2 (SOD2), acetylated-SOD2 and adenosine monophosphate activated protein kinase α1 (AMPKα1). Results The 110 and 150 μmol/L H₂O₂ decreased SIRT3 protein (both P<0.05). ATP and mitochondrial O₂•⁻ did not differ between NC and NCsi groups (both P>0.05). Compared to the NCsi group, the siSIRT3 group exhibited elevated O₂•⁻ level, decreased SIRT3 protein and increased expression levels of SOD2 and acetylated SOD2 protein (all P<0.05). Compared to the NCsi group, the NCsi+H₂O₂ group exhibited decreased cellular ATP levels, elevated mitochondrial O₂•⁻ levels, and reduced protein expression levels of SIRT3, SOD2, TFAM, AMPKα1, PGC-1α and NRF1 (all P<0.05). Compared with the siSIRT3 group, the siSIRT3+H₂O₂ group showed a decrease in cellular ATP levels, an increase in mitochondrial O₂•⁻ levels, a decrease in SIRT3, SOD2, TFAM, AMPKα1, PGC-1α and NRF1 protein expression levels and a decrease in acetylated SOD2 protein expression levels (all P<0.05). Compared with the NCsi+H₂O₂ group, the siSIRT3+H₂O₂ group showed a decrease in cellular ATP levels, an increase in mitochondrial O₂•⁻ levels, a decrease in SIRT3, AMPKα1, PGC-1α and NRF1, TFAM protein expression levels, and an increase in SOD2 and acetylated SOD2 protein expression levels (all P<0.05). Conclusions SIRT3 promotes mitochondrial biogenesis in tubular epithelial cells via the AMPK/PGC-1α/NRF1/TFAM axis, representing a key mechanism through which SIRT3 ameliorates oxidative stress-induced mitochondrial dysfunction.

BACKGROUND:Apoptosis plays an important role in secondary brain injury.Therefore,to explore the pathophysiological mechanism of promoting nerve cell survival after traumatic brain injury provides a new direction and theoretical basis for the prevention and treatment of traumatic brain injury. OBJECTIVE:To explore the expression changes of Lnx1 molecule in mammalian cortical neurons after brain injury and the possible mechanism involved in secondary brain injury. METHODS:Eighty adult SD rats were divided into 20 male and 20 female mice in sham operation group and 20 male and 20 female mice in traumatic brain injury group.The traumatic brain injury rat model was established by heavy falling method.At 6,12,24,48,and 72 hours after brain injury,the expression of related molecules in damaged cortical neurons was analyzed by RT-qPCR,western blot assay,and immunofluorescence staining. RESULTS AND CONCLUSION:(1)The brain tissue of traumatic brain injury group was bleeding and obvious tissue injury could be observed.Water content of brain tissue increased after traumatic brain injury.(2)Compared with the sham operation group,the expression of Lnx1 in cortical neurons after traumatic brain injury increased significantly at 24 hours after injury.(3)After traumatic brain injury,the expression of PBK and BCR protein decreased,and the pro-survival factor ctgf increased.(4)These findings suggest that after traumatic brain injury,the expression of Lnx1 is up-regulated in neurons,which may be due to the decrease of the expression of its target molecules PBK and BCR,and further promote the expression of living factor ctgf,which has a protective effect on the damaged neurons.

BACKGROUND:Neuregulin 1 has been shown to be characterized in cell proliferation,differentiation,and vascular growth.Human amniotic mesenchymal stem cells are important seed cells in the field of tissue engineering,and have been shown to be involved in tissue repair and regeneration. OBJECTIVE:To construct human amniotic mesenchymal stem cells overexpressing neuregulin 1 and investigate their proliferation and migration abilities,as well as their effects on wound healing. METHODS:(1)Human amniotic mesenchymal stem cells were in vitro isolated and cultured and identified.(2)A lentivirus overexpressing neuregulin 1 was constructed.Human amniotic mesenchymal stem cells were divided into empty group,neuregulin 1 group,and control group,and transfected with empty lentivirus and lentivirus overexpressing neuregulin 1,or not transfected,respectively.(3)Edu assay was used to detect the proliferation ability of the cells of each group,and Transwell assay was used to detect the migration ability of the cells.(4)The C57 BL/6 mouse trauma models were constructed and randomly divided into control group,empty group,neuregulin 1 group,with 8 mice in each group.Human amniotic mesenchymal stem cells transfected with empty lentivirus or lentivirus overexpressing neuregulin-1 were uniformly injected with 1 mL at multiple local wound sites.The control group was injected with an equal amount of saline.(5)The healing of the trauma was observed at 1,7,and 14 days after model establishment.Histological changes of the healing of the trauma were observed by hematoxylin-eosin staining.The expression of CD31 on the trauma was observed by immunohistochemistry. RESULTS AND CONCLUSION:(1)Human amniotic mesenchymal stem cells overexpressing neuregulin-1 were successfully constructed.The mRNA and protein expression of intracellular neuregulin 1 was significantly up-regulated compared with the empty group(P<0.05).(2)The overexpression of neuregulin 1 promoted the migratory ability(P<0.01)and proliferative ability of human amniotic mesenchymal stem cells(P<0.05).(3)Human amniotic mesenchymal stem cells overexpressing neuregulin 1 promoted wound healing in mice(P<0.05)and wound angiogenesis(P<0.05).The results showed that overexpression of neuregulin 1 resulted in an increase in the proliferative and migratory capacities of human amniotic mesenchymal stem cells,significantly promoting wound healing and angiogenesis.

BACKGROUND:Currently,exercise therapy is an effective non-pharmacological treatment for low back pain,and exercise therapy can maintain lumbar spine stabilization through mechanical-chemical coupling between bones and muscles,but there is no clear description of the research progress and optimal treatment protocols for exercise therapy to relieve chronic non-specific lower back pain through mechanical-chemical coupling. OBJECTIVE:To review the research progress related to the influence of paravertebral muscles on lumbar spine stabilization during exercise therapy through mechanical-chemical coupling,which in turn relieves chronic non-specific lower back pain,as well as the current optimal treatment protocols of exercise therapy for chronic non-specific lower back pain. METHODS:Literature searches were performed in WanFang database,CNKI,VIP,Web of Science,and PubMed database,with search terms of"chronic non-specific low back pain,lumbar spine stabilization,paravertebral muscles,exercise therapy"in Chinese and English.Relevant literature published from database inception to January 2024 was searched and 93 articles were included for final summarization. RESULTS AND CONCLUSION:Exercise therapy can act on the paravertebral muscles and bones through appropriate mechanical stimulation and produce corresponding changes.Exercise therapy is an important intervention for chronic non-specific lower back pain as it improves the quality of the paravertebral muscles,primarily through mechanical-chemical coupling,and thus maintains lumbar spine stabilization for better relief of chronic non-specific lower back pain.However,there are no clear reports on the exact effective protocols for exercise therapy to treat chronic non-specific lower back pain through lumbar spine stabilization.The development of an individualized exercise program is particularly important for the treatment and prognosis of chronic non-specific low back pain.Muscle mass and bone mass of the same individual are closely related,and imaging assessment of paravertebral muscle mass and quantity is important for disease detection and intervention.