1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Research progress on the role of microglial glucose metabolism reprogramming in age-related macular degeneration
Chinese Journal of Ocular Fundus Diseases 2024;40(10):819-824
Age-related macular degeneration (AMD) involves dysregulation of the innate immune response of complement and mononuclear phagocytes and abnormalities of local microglia. When microglia transition from a resting state to an active state, their metabolic pathway also changes, known as "metabolic reprogramming", and their glucose metabolic reprogramming is a key factor in the pathogenesis of AMD, involving multiple signaling pathways. Including phosphatidylinositol 3-kinase-serine threonine kinase-rapamycin target, adenylate activated protein kinase and hypoxia-inducing factor 1 pathway. These metabolic changes regulate the inflammatory response, energy supply, and neuroprotective functions of microglia. Therapeutic strategies to regulate the reprogramming of glucose metabolism in microglia have achieved initial results. Future studies should further explore the mechanisms of microglia metabolic regulation to develop new targeted drugs and intervene in the treatment of AMD through anti-cellular aging pathways.
3.Effect of folic acid on the expression of Flotillin-1 and β-amyloid protein in the brain of mice with Alzheimer's disease inflammation
Zewei MA ; Li HUANG ; Yunqin ZHENG ; Meilin ZHANG ; Huan LIU
Chinese Journal of Comparative Medicine 2024;34(8):10-18
Objective To observe the effects of folic acid(FA)supplementation on the expression of Flotillin-1 and β-amyloid protein(Aβ)-metabolism-related proteins in the brains of inflammation-stimulated Alzheimer's disease(AD)mice.Methods Twenty-seven 6-month-old male APP/PS1 mice were randomly divided into AD,AD+LPS,and AD+LPS+FA groups,with nine mice in each group.Nine C57BL/6J male mice born within the same month were used as the Control group.The AD+LPS+FA group was given folic-acid-supplemented feed(8 mg/kg)for 3 months of intervention,while the other three groups were fed normal feed.Lipopolysaccharide solution(LPS,250 μg/(kg·d))was injected intraperitoneally into mice in the AD+LPS and AD+LPS+FA groups 1 week before the end of the experiment,and saline was injected into the remaining two groups.The serum inflammatory factors TNF-α and IL-6 levels and brain tissue Aβ1-40 and Aβ1-42 levels of mice in each group were detected by ELISA.Flotillin-1 protein expression in brain tissue was detected using Western blot,and the co-expression of Flotillin-1 and Aβ1-42/APP/PS1/BACE1 in the cortical region of the brain was detected via immunofluorescence double-labeling.Results After ANOVA analysis,we found mice in the AD group had elevated serum TNF-α and IL-6 levels(P<0.05),elevated levels of Aβ1-40 and Aβ1-42(P<0.05),increased expression of Flotillin-1 protein(P<0.05),and increased co-expression of Flotillin-1 and Aβ1-42/APP/PS1/BACE1 in the cortical brain tissue(P<0.05)compared with the Control group.Compared with mice in the AD group,those in the AD+LPS group had further increases in serum inflammatory factors and Aβ levels in the brain(P<0.05)and increased co-expression of Flotillin-1 and Aβ1-42/APP/BACE1 double-labeled proteins in their cortical brain tissue(P<0.05).Compared with mice in the AD+LPS group,those in the AD+LPS+FA group had lower in vivo inflammation levels and Aβ content in the brain(P<0.05),lower brain tissue Flotillin-1 protein expression(P<0.05),and lower Flotillin-1 and Aβ1-42/APP/PS1/BACE1 protein co-expression in cortical brain tissue(P<0.05).Conclusions Folic acid supplementation may reduce Flotillin-1 protein expression and Aβ deposition in the brain of AD inflammatory mice.
4.Neonatal ureaplasma meningitis: a report of 2 cases and literature review
Jingjing XIE ; Yan ZHUANG ; Yunqin WU ; Mengyu CHEN ; Qiang LI ; Jun LI ; Mi ZHANG ; Xirong GAO
Chinese Journal of Neonatology 2023;38(2):86-91
Objective:To study the clinical features and treatment strategy of neonatal ureaplasma meningitis.Methods:During 2021, the clinical data of 2 neonates with ureaplasma meningitis treated in Children's Hospital of Hunan Province were retrospectively analyzed. Literature on this subject were searched in the following databases: CNKI, Wanfang Database, Chinese Medical Journal Full-Text Database, CQVIP database, SinoMed, PubMed, Embase and Web of Science (up to March 2022). The key words included “infant”, “neonate”, “newborn”, “ureaplasma”, “mycoplasma urealytium”, “meningitis”, “central nervous system infection”, “brain”. The clinical data, treatment and prognosis of patients from the literature were summarized.Results:Case 1, female, gestational age(GA) 33 +3 weeks, intracranial hemorrhage (ICH) and ventricular dilatation were found on 2 d after birth. The cerebrospinal fluid (CSF) routine and biochemistry tests indicated meningitis, but the CSF culture was negative. No improvement after antibiotic treatment. CSF metagenomic next-generation sequencing (mNGS) and 23S rRNA showed Ureaplasma urealyticum on 30 d after birth. The patient was treated with doxycycline (DOX) for 21 d until mNGS turned negative and DOX was discontinued. However, the disease recurred 23 d later and erythromycin was added with DOX as combined therapy. The patient was followed up until 6 months without neurodevelopmental disabilities. Case 2, male, GA 26 weeks, ICH and ventricular dilatation were found on 10 d after birth. The CSF routine and biochemistry tests indicated meningitis, but the CSF culture was negative. No improvement after antibiotic treatment. CSF mNGS and 23S rRNA showed Ureaplasma parvum. The patient received erythromycin therapy for 32 d and had normal neurodevelopment at 5 months. According to the literature, 43 cases were reported including the 2 cases descirbed above, 17 cases were full-term infants and 26 cases were preterm infants. The median CSF leukocytes, glucose and proteins were 566 cells/mm 3, 0.2 mmol/L and 2.2 g/L. 27 cases were diagnosed based on CSF culture, 6 cases using mNGS, 4 cases with both CSF culture and PCR method and 6 cases with other methods. Macrolides alone were used in 14 cases, macrolides combined with another antibiotic were used in 8 cases, non-macrolide antibiotics were used in 9 cases and 12 cases didn't receive any anti-ureaplasma therapy. All 17 term infants survived, however, 8 cases with hydrocephalus. Among the 26 preterm infants, 8 patients died, 18 patients had periventricular-intraventricular hemorrhage and 15 patients had hydrocephalus. Conclusions:Neonatal ureaplasma meningitis has significantly lower CSF glucose level with hydrocephalus as the common complication. For intracranial infections of unknown etiology and no response to treatment, mNGS is helpful in determining the pathogen.Neonatal ureaplasma meningitis should be treated with macrolides alone or as add-on therapy.
5.Study on Improvement Effects of Icariin on Cognitive Function in Schizophrenia Model Rats and Its Mechanism
Yunqin LIU ; Yanqin LIU ; Hanbin JI ; Wenhao XIAO ; Li LIN
China Pharmacy 2021;32(7):812-818
OBJECTIVE:To study the improvement effects of ica riin(ICA)on cognitive function in schizophrenia model rats and its mechanism. METHODS :SD rats were divided into blank control group ,model group ,ICA low-dose ,medium-dose and high-dose groups (15,30,60 mg/kg). Except for blank control group ,other groups were given N-methyl-D-aspartate receptor antagonist MK- 801(0.2 mg/kg)intraperitoneally to induce schizophrenia rats models ,once a day ,for consecutive 14 days. After modeling,ICA groups were intragastrically administered with the corresponding drugs ,while blank control group and model group were intragastrically administered with the same volume of water ,once a day ,for consecutive 7 days. The behavioral com changes of rats were detected by Morris water maze test ,open field test , forced swimming test and Y maze test pathological changes of hippocampus were observed by Nissl staining;the levels of cholinergic indexes [acetylcholine (Ach),choline acetyltransferase (ChAT) and acetylcholinesterase (AchE)] in cerebral tissues were detected by ELISA. The expression of BDNF ,ERK and CREB mRNA in cerebral tissue were detected by RT-PCR ;expression or phosphorylation level of BDNF ,ERK,CREB protein ,apoptosis related proteins (Bcl-2,Bax and Caspase- 3)were detected by Western blot. RESULTS :Compared with blank control group ,escape latency ,distance at T 1-T3, cumulative immobility time and the expression of Caspase- 3 protein in cerebral tissues were significantly increased in model group (P<0.05);the times of crossing platform ,alternation rate ,the number of Nissl staining positive neurons in hippocampus tissues , the levels of Ach and ChAT in cerebral tissues ,Bcl-2/Bax ratio ,mRNA and protein expression of BDNF ,mRNA expression of ERK and CREB ,the phosphorylation of ERK 1/2 and CREB were significantly decreased (P<0.05).Compared with model group , escape latency ,distance at T 1-T3,cumulative immobility time ,the number of Nissl staining positive neurons ,AchE level in cerebral tissues and relative expression of Caspase- 3 protein were significantly decreased in ICA high-dose group (P<0.05);the times of crossing platform ,alternation rate ,levels of Ach and ChAT in cerebral tissues ,Bcl-2/Bax ratio ,mRNA and protein expression of BDNF ,mRNA expression of ERK and CREB ,the phosphorylation of ERK 1/2 and CREB were increased significantly(P<0.05). Above indexes in ICA low-dose and medium-dose groups were partially improved significantly than model group(P<0.05). CONCLUSIONS :ICA can improve cognitive function in schizophrenia model rats.Its mechanism may be related to regulating cholinergic system ,inhibiting neuronal apoptosis ,and promoting the expression of BDNF/ERK/CREB signaling pathway.
6.Predictive value of IVIM-DWI and DCE-MRI quantitative parameters on the early efficacy of concurrent chemoradiotherapy for cervical squamous cell carcinoma
Xiaomin ZHENG ; Liting QIAN ; Jiangning DONG ; Yunqin LIU ; Xin FANG ; Cuiping LI
Chinese Journal of Radiation Oncology 2020;29(8):654-660
Objective:To evaluate the application value of intravoxel incoherent motion diffusion weighted imaging (IVIM-DWI) and dynamic contrast enhancement MRI (DCE-MRI) in the prediction of the early efficacy of concurrent chemoradiotherapy (CCRT) for cervical squamous cell carcinoma.Methods:Fifty patients with cervical squamous cell carcinoma confirmed by pathology were included. Before CCRT, IVIM-DWI and DCE-MRI were scanned, and the values of quantitative parameters including ADC, D, D * and f of IVIM-DWI and K trans, K ep, V e and V p of DCE-MRI before treatment were measured for all patients. MRI reexamination was performed 1 month after the end of CCRT, and all patients were divided into the cure group and the residual group according to the tumor remission. The parameters of IVIM-DWI and DCE-MRI before treatment were statistically compared between two groups. The optimal predictive parameters and predictive thresholds were determined by drawing the receiver operating characteristic (ROC) curve. Results:Twenty-four patients were assigned into the cure group and twenty-six patients in the residual group. The ADC, D and V e values before treatment in the cure group were significantly lower than those in the residual group (all P<0.05), whereas the f and K trans values were significantly higher than those in the residual group (both P<0.05). The other parameters did not significantly differ between two groups (all P>0.05). The area under ROC curve (AUC=0.823) of D value was the largest, followed by K transvalue (AUC=0.754). The combined prediction efficacy of D and K trans (AUC=0.867) was higher than that of either D or K trans alone. The sensitivity was 88.5%, 85.8% and 88.8%, and the specificity was 70.8%, 66.7% and 79.2%, respectively. Conclusions:Quantitative parameters of IVIM-DWI and DCE-MRI before treatment have certain predictive value for the early efficacy of CCRT in cervical squamous cell carcinoma, among which the predictive efficacy of D value is the highest, and the combined application of D and K trans can improve the predictive efficacy.
7.The study of extremely low and very low birth weight infant transport risk assessment and factors that influenced deaths
Mengyu CHEN ; Yunqin WU ; Yan ZHUANG ; Qiang LI ; Xinhui LIU ; Jinxia MA ; Shuting CHANG ; Xirong GAO
Chinese Journal of Neonatology 2018;33(5):344-349
Objective To study the transport risk and factors that influence deaths of very low birth weight (VLBW) and extremely low birth weight (ELBW) infants.Method All infants transferred to our neonatal intensive care unit (NICU) by our hospital transport team or local hospital transport team from January 2014 to December 2015 were included in our study.Their clinical data were retrospectively studied.The risks of transport between hospitals were analyzed.The risk factors of deaths within and after 7 days of admission were further analyzed by multivariate Logistic regression analysis.The receiver operation characteristic (ROC) curve was used to assess the sensitivity and specificity of mortality index for neonatal transportation (MINT),transport related mortality score (TREMS),transport risk index of physiologic stability (TRIPS) for predicting mortality of preterm infants.Result (1) A total of 527 cases of ELBW/VLBW infants were included in our study.There were no deaths during transport.There were 10.2% (54/527) died within and 8.9% (42/473) died after 7 days of hospitalization.(2) Multivariate Logistic regression analysis showed that scleredema of newborn,secondary transport,gastrointestinal malformations,metabolic acidosis,high TREMS score,and high MINT score were risk factors of mortality within 7 days of admission for ELBW/VLBW infants;necrotizing enterocolitis,intraventricular hemorrhage ≥ three degree,high MINT score and low admission weight were risk factors of mortality after 7 days of admission.(3) The area under the ROC curve for MINT,TREMS,and TRIPS score were 0.672,0.655 and 0.665,respectively.The cut-off values for MINT score (cut-off 8,sensitivity 0.444,specificity 0.829),for TREMS score (cut-off 2,sensitivity 0.500,specificity 0.757,for TRIPS score (cut-off 20,sensitivity 0.444,specificity O.829) were selected to predict mortality within 7 days of admission.Conclusion (1) Secondary transport is the transport-related risk factor of mortality within 7 days of admission for ELBW/VLBW infants.(2) High MINT score is the risk factor of mortality within and after 7 days of admission.(3) If MINT ≥ 8,TREMS ≥2,or TRIPS ≥20,it might significantly increase the risk of mortality of ELBW/ VLBW infants within 7 days of admission after transport.
8.Risk factors of severe bronchopulmonary dysplasia in extremely low birth weight infants
Yunqin WU ; Jingjing XIE ; Xirong GAO ; Qiang LI ; Xinhui LIU ; Yan ZHUANG ; Jinxia MA ; Shuting CHANG
Chinese Journal of Neonatology 2018;33(6):419-422
Objective To study the occurrence of bronchopulmonary dysplasia (BPD) in extremely low birth weight (ELBW) infants and to determine the risk factors of severe BPD.Method From January 2007 to January 2017,ELBW infants admitted to neonatal intensive care unit (NICU) in Hunan Children's Hospital were retrospectively analyzed.They were assigned into severe and mild/moderate groups based on the severity of BPD.The general condition,maternal status,prenatal and delivery room treatment,transportation,clinical courses,therapy and outcome in NICU of the two groups were compared,and the risk factors of severe BPD were analyzed.Result A total of 367 cases were hospitalized during the 10 years.281 ELBW infants with complete medical records survived longer than 28 days were enrolled in this study.Among them,233 had BPD.Among BPD infants,116 cases were in the severe BPD group,47 cases (40.5%) died.117 cases were in the mild/moderate BPD group and 1 case (0.9%) died.The difference between the two groups was statistically significant (P < 0.05).Multivariate Logistic regression analysis showed that the risk factors of severe BPD were duration of mechanical ventilation ≥ 7 days (OR =7.518,95 % CI 3.197 ~ 17.676),ventilator-associated pneumonia (OR =3.047,95 % CI 1.436 ~ 6.464),1 min Apgar score ≤7 (OR =2.341,95 % CI 1.142 ~ 4.796) and patent ductus arteriosus (OR =2.223,95 % CI 1.079 ~4.582).Conclusion The incidence and mortality of BPD,especially severe BPD,are high in ELBW infants.Avoiding asphyxia,shortening the time of mechanical ventilation,preventing infection and closing ductus arteriosus are important measures to reduce the severity of BPD.
9.Ultrasonographic features of fetal gastric duplication
Yunqin WANG ; Yan ZHAO ; Chuanhong LI
Chinese Journal of Ultrasonography 2018;27(5):431-433
Objective To analyze the ultrasonic and clinical features of fetal gastric duplication. Methods Ultrasonographic apperance of 12 fetal stomach duplication cases were reviewed and followed up. Results The age of 12 fetal gestational duplication cases ranged from 19 weeks to 36 weeks. All cases were cystic-type,and 11 cases of gastric duplication were diagnosed by antenatal ultrasonography. Eleven cases were normal labored,2 patients were cured after surgical management. One case was misdiagnosed to be bile duct cyst, and was induced in 1 week after diagnosis because of simultaneous combination of hydrocephalus in bilateral ventricle. Stomach duplication prenatal sonographic findings were cysts near the stomach with thickened wall in local enlarged images. The cystic wall included 3 layers of strong-weak-strong hierarchical structure as normal stomach wall. Conclusions Fetal stomach duplication has characteristic ultrasound features,and can be definitively diagnosed prenatally. Early diagnosis is of great importance for prenatal consultation and timely treatment after birth.
10.Changes and clinical significances of mitochondrial coupling factor 6 and cytochrome C in neonatal sepsis
Yu LIU ; Yunqin WU ; Yan ZHUANG ; Xirong GAO ; Shuangjie LI
Chinese Pediatric Emergency Medicine 2017;24(7):536-540
Objective To evaluate the levels of plasma coupling factor 6(CF6) and cytochrome C(Cyt-c) in neonatal sepsis,and to explore the clinical significance in neonatal sepsis.Methods A total of 88 neonates admitted to Hunan Children's Hospital from January 2015 to April 2015 were collected.Neonates were divided into non-sepsis group(n=42) and sepsis group(n=46).According to the severity of infection,the non-sepsis group was further divided into non-infection group(n=20) and common infection group(n=22);the sepsis group was further divided into general sepsis group (31 cases,no organ failure) and severe sepsis group (15 cases,combined with multiple organ failure).Femoral venous blood was collected in all patients before the use of antibiotics after admission.The levels of Cyt-c and CF6 in plasma were measured by ELISA,and the levels of C-reactive protein(CRP),procalcitonin (PCT) were measured.The changes of CF6 and Cyt-c between these groups were compared,and the sensitivity and specificity with the traditional sepsis index (CRP,PCT) were analyzed.The correlation between the levels of CF6,Cyt-c and neonatal critical illness score was analyzed.Results (1)In sepsis group,the levels of CF6 and Cyt-c[(109.7±8.9)pg/ml and (44.5±4.9)ng/ml] were significantly higher than those in the non-sepsis group[(46.3±6.0)pg/ml,(31.8±6.7)ng/ml,P<0.01,respectively].(2) In the non-infection group,common infection group,general sepsis group and severe sepsis group,the levels of CF6 were (32.1±8.9)pg/ml,(59.3±7.2)pg/ml,(79.3±5.9)pg/ml,and (172.6±6.1)pg/ml,respectively;the levels of Cyt-c were (29.3±8.6)ng/ml,(35.4±4.1) ng/ml,(43.1±5.9) ng/ml,and (44.5±5.9)ng/ml,respectively.The differences between these groups were significant(P<0.01).(3)The receiver operating characteristic curve showed that the sensitivity and specificity of CF6 were 0.761,0.732,and the Cyt-c were 0.739,0.714.(4)Cyt-C and CF6 were negatively correlated with the neonatal critical illness score(r=-0.599,P<0.001;r=-0.337,P<0.01).Conclusion The levels of CF6 and Cyt-c increase in neonatal sepsis.The damage of mitochondria may be one of the pathological mechanisms in neonatal sepsis.The levels of CF6 and Cyt-c were closely related to the severity of neonatal sepsis.

Result Analysis
Print
Save
E-mail