AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Age-related macular degeneration(AMD)is a critical ophthalmic condition characterized by substantial vis-ual impairment.Retinal neuroinflammation is one of the fundamental pathophysiological features of AMD.The NOD-like re-ceptor protein 3(NLRP3)inflammasome plays a crucial role in regulating neuroinflammation.It has been demonstrated that the activation of NLRP3 inflammasome is closely correlated with mitochondrial dysfunction,the increased production of reactive oxygen species(ROS),and the anomalous expulsion of mitochondrial DNA in the progression of AMD.There-fore,inhibitors targeting the NLRP3 inflammasome may become a new approach with great potential for AMD treatment.This article rigorously examines the role of mitochondrial impairment and NLRP3 inflammasome signaling in the pathogene-sis of AMD,highlighting current research advancements and prospective trajectories in this evolving field.

Myxedema coma is a rare condition, typically arising from long-standing, untreated hypothyroidism and triggered by factors such as infection, hypothermia, or severe illness. This report details a successfully treated case of myxedema coma with cardiac attest, accompanied by a literature review, to enhance clinical awareness and improve the diagnosis and management of this critical condition.

Objective:To compare the therapeutic efficacy of the dual anteromedial and anterolateral approaches versus that of the anterior midline approach in the treatment of Wahlquist type C medial tibial plateau fractures accompanied by posterior column collapse.Methods:A retrospective study was conducted to analyze the 21 patients who had been treated for Wahlquist type C medial tibial plateau fractures plus posterior column collapse at The Fourth Orthopedic Ward, The 72nd Group Army Hospital of PLA between January 2019 and August 2023. The cohort included 13 males and 8 females, with an age of (43.3±6.7) years. The left side was involved in 14 fractures and the right side in 7 ones. The patients were divided into 2 groups based on their surgical approaches: a dual-approach group ( n=13) undergoing fixation via the dual anteromedial and anterolateral approaches, and a single-approach group ( n=8) undergoing fixation via the anterior midline approach. Comparative parameters included operative time, intraoperative blood loss, fracture healing time, quality of fracture reduction, medial proximal tibial angle (MPTA), incision complications, postoperative bone mass reduction quality (evaluated according to the Rasmussen anatomical criteria for tibial condyle fracture reduction), lateral tibial plateau instability, incidence of genu varum, and post-traumatic arthritis. Functional recovery of the lower limb joints was assessed at the final follow-up using the Merchant criteria. Results:No statistically significant differences were observed in the baseline characteristics between the 2 groups preoperatively, indicating comparability ( P>0.05). All patients were followed up for a mean duration of (38.1±11.3) months. The postoperative MPTA in the dual-approach group (86.8°±0.8°) was significantly larger than that in the single-approach group (85.5°±0.9°) ( P<0.05). Genu varum occurred in 1 patient in the dual-approach group and in 4 patients in the single-approach group, while lateral tibial plateau instability was observed in 1 patient in the dual-approach group and in 4 patients in the single-approach group, showing statistically significant differences between the 2 groups ( P<0.05). No statistically significant differences were found between the 2 groups regarding operative time, intraoperative blood loss, fracture healing time, quality of fracture reduction, incidence of incision complications, or incidence of post-traumatic arthritis ( P>0.05). At the final follow-up, no statistically significant difference was observed in the functional recovery of the lower limb joints assessed by the Merchant criteria between the 2 groups ( P>0.05). Conclusion:In the treatment of Wahlquist type C medial tibial plateau fractures accompanied by posterior column collapse, compared with the single anterior midline approach, the dual anteromedial and anterolateral approaches can restore more effectively the MPTA, and reduce the incidences of genu varum and lateral tibial plateau instability.

Age-related macular degeneration(AMD)is a critical ophthalmic condition characterized by substantial vis-ual impairment.Retinal neuroinflammation is one of the fundamental pathophysiological features of AMD.The NOD-like re-ceptor protein 3(NLRP3)inflammasome plays a crucial role in regulating neuroinflammation.It has been demonstrated that the activation of NLRP3 inflammasome is closely correlated with mitochondrial dysfunction,the increased production of reactive oxygen species(ROS),and the anomalous expulsion of mitochondrial DNA in the progression of AMD.There-fore,inhibitors targeting the NLRP3 inflammasome may become a new approach with great potential for AMD treatment.This article rigorously examines the role of mitochondrial impairment and NLRP3 inflammasome signaling in the pathogene-sis of AMD,highlighting current research advancements and prospective trajectories in this evolving field.

Myxedema coma is a rare condition, typically arising from long-standing, untreated hypothyroidism and triggered by factors such as infection, hypothermia, or severe illness. This report details a successfully treated case of myxedema coma with cardiac attest, accompanied by a literature review, to enhance clinical awareness and improve the diagnosis and management of this critical condition.

Objective:To compare the therapeutic efficacy of the dual anteromedial and anterolateral approaches versus that of the anterior midline approach in the treatment of Wahlquist type C medial tibial plateau fractures accompanied by posterior column collapse.Methods:A retrospective study was conducted to analyze the 21 patients who had been treated for Wahlquist type C medial tibial plateau fractures plus posterior column collapse at The Fourth Orthopedic Ward, The 72nd Group Army Hospital of PLA between January 2019 and August 2023. The cohort included 13 males and 8 females, with an age of (43.3±6.7) years. The left side was involved in 14 fractures and the right side in 7 ones. The patients were divided into 2 groups based on their surgical approaches: a dual-approach group ( n=13) undergoing fixation via the dual anteromedial and anterolateral approaches, and a single-approach group ( n=8) undergoing fixation via the anterior midline approach. Comparative parameters included operative time, intraoperative blood loss, fracture healing time, quality of fracture reduction, medial proximal tibial angle (MPTA), incision complications, postoperative bone mass reduction quality (evaluated according to the Rasmussen anatomical criteria for tibial condyle fracture reduction), lateral tibial plateau instability, incidence of genu varum, and post-traumatic arthritis. Functional recovery of the lower limb joints was assessed at the final follow-up using the Merchant criteria. Results:No statistically significant differences were observed in the baseline characteristics between the 2 groups preoperatively, indicating comparability ( P>0.05). All patients were followed up for a mean duration of (38.1±11.3) months. The postoperative MPTA in the dual-approach group (86.8°±0.8°) was significantly larger than that in the single-approach group (85.5°±0.9°) ( P<0.05). Genu varum occurred in 1 patient in the dual-approach group and in 4 patients in the single-approach group, while lateral tibial plateau instability was observed in 1 patient in the dual-approach group and in 4 patients in the single-approach group, showing statistically significant differences between the 2 groups ( P<0.05). No statistically significant differences were found between the 2 groups regarding operative time, intraoperative blood loss, fracture healing time, quality of fracture reduction, incidence of incision complications, or incidence of post-traumatic arthritis ( P>0.05). At the final follow-up, no statistically significant difference was observed in the functional recovery of the lower limb joints assessed by the Merchant criteria between the 2 groups ( P>0.05). Conclusion:In the treatment of Wahlquist type C medial tibial plateau fractures accompanied by posterior column collapse, compared with the single anterior midline approach, the dual anteromedial and anterolateral approaches can restore more effectively the MPTA, and reduce the incidences of genu varum and lateral tibial plateau instability.

Age-related macular degeneration (AMD) involves dysregulation of the innate immune response of complement and mononuclear phagocytes and abnormalities of local microglia. When microglia transition from a resting state to an active state, their metabolic pathway also changes, known as "metabolic reprogramming", and their glucose metabolic reprogramming is a key factor in the pathogenesis of AMD, involving multiple signaling pathways. Including phosphatidylinositol 3-kinase-serine threonine kinase-rapamycin target, adenylate activated protein kinase and hypoxia-inducing factor 1 pathway. These metabolic changes regulate the inflammatory response, energy supply, and neuroprotective functions of microglia. Therapeutic strategies to regulate the reprogramming of glucose metabolism in microglia have achieved initial results. Future studies should further explore the mechanisms of microglia metabolic regulation to develop new targeted drugs and intervene in the treatment of AMD through anti-cellular aging pathways.

Objective To observe the effects of folic acid(FA)supplementation on the expression of Flotillin-1 and β-amyloid protein(Aβ)-metabolism-related proteins in the brains of inflammation-stimulated Alzheimer's disease(AD)mice.Methods Twenty-seven 6-month-old male APP/PS1 mice were randomly divided into AD,AD+LPS,and AD+LPS+FA groups,with nine mice in each group.Nine C57BL/6J male mice born within the same month were used as the Control group.The AD+LPS+FA group was given folic-acid-supplemented feed(8 mg/kg)for 3 months of intervention,while the other three groups were fed normal feed.Lipopolysaccharide solution(LPS,250 μg/(kg·d))was injected intraperitoneally into mice in the AD+LPS and AD+LPS+FA groups 1 week before the end of the experiment,and saline was injected into the remaining two groups.The serum inflammatory factors TNF-α and IL-6 levels and brain tissue Aβ1-40 and Aβ1-42 levels of mice in each group were detected by ELISA.Flotillin-1 protein expression in brain tissue was detected using Western blot,and the co-expression of Flotillin-1 and Aβ1-42/APP/PS1/BACE1 in the cortical region of the brain was detected via immunofluorescence double-labeling.Results After ANOVA analysis,we found mice in the AD group had elevated serum TNF-α and IL-6 levels(P＜0.05),elevated levels of Aβ1-40 and Aβ1-42(P＜0.05),increased expression of Flotillin-1 protein(P＜0.05),and increased co-expression of Flotillin-1 and Aβ1-42/APP/PS1/BACE1 in the cortical brain tissue(P＜0.05)compared with the Control group.Compared with mice in the AD group,those in the AD+LPS group had further increases in serum inflammatory factors and Aβ levels in the brain(P＜0.05)and increased co-expression of Flotillin-1 and Aβ1-42/APP/BACE1 double-labeled proteins in their cortical brain tissue(P＜0.05).Compared with mice in the AD+LPS group,those in the AD+LPS+FA group had lower in vivo inflammation levels and Aβ content in the brain(P＜0.05),lower brain tissue Flotillin-1 protein expression(P＜0.05),and lower Flotillin-1 and Aβ1-42/APP/PS1/BACE1 protein co-expression in cortical brain tissue(P＜0.05).Conclusions Folic acid supplementation may reduce Flotillin-1 protein expression and Aβ deposition in the brain of AD inflammatory mice.

Objective:To study the clinical features and treatment strategy of neonatal ureaplasma meningitis.Methods:During 2021, the clinical data of 2 neonates with ureaplasma meningitis treated in Children's Hospital of Hunan Province were retrospectively analyzed. Literature on this subject were searched in the following databases: CNKI, Wanfang Database, Chinese Medical Journal Full-Text Database, CQVIP database, SinoMed, PubMed, Embase and Web of Science (up to March 2022). The key words included “infant”, “neonate”, “newborn”, “ureaplasma”, “mycoplasma urealytium”, “meningitis”, “central nervous system infection”, “brain”. The clinical data, treatment and prognosis of patients from the literature were summarized.Results:Case 1, female, gestational age(GA) 33 +3 weeks, intracranial hemorrhage (ICH) and ventricular dilatation were found on 2 d after birth. The cerebrospinal fluid (CSF) routine and biochemistry tests indicated meningitis, but the CSF culture was negative. No improvement after antibiotic treatment. CSF metagenomic next-generation sequencing (mNGS) and 23S rRNA showed Ureaplasma urealyticum on 30 d after birth. The patient was treated with doxycycline (DOX) for 21 d until mNGS turned negative and DOX was discontinued. However, the disease recurred 23 d later and erythromycin was added with DOX as combined therapy. The patient was followed up until 6 months without neurodevelopmental disabilities. Case 2, male, GA 26 weeks, ICH and ventricular dilatation were found on 10 d after birth. The CSF routine and biochemistry tests indicated meningitis, but the CSF culture was negative. No improvement after antibiotic treatment. CSF mNGS and 23S rRNA showed Ureaplasma parvum. The patient received erythromycin therapy for 32 d and had normal neurodevelopment at 5 months. According to the literature, 43 cases were reported including the 2 cases descirbed above, 17 cases were full-term infants and 26 cases were preterm infants. The median CSF leukocytes, glucose and proteins were 566 cells/mm 3, 0.2 mmol/L and 2.2 g/L. 27 cases were diagnosed based on CSF culture, 6 cases using mNGS, 4 cases with both CSF culture and PCR method and 6 cases with other methods. Macrolides alone were used in 14 cases, macrolides combined with another antibiotic were used in 8 cases, non-macrolide antibiotics were used in 9 cases and 12 cases didn't receive any anti-ureaplasma therapy. All 17 term infants survived, however, 8 cases with hydrocephalus. Among the 26 preterm infants, 8 patients died, 18 patients had periventricular-intraventricular hemorrhage and 15 patients had hydrocephalus. Conclusions:Neonatal ureaplasma meningitis has significantly lower CSF glucose level with hydrocephalus as the common complication. For intracranial infections of unknown etiology and no response to treatment, mNGS is helpful in determining the pathogen.Neonatal ureaplasma meningitis should be treated with macrolides alone or as add-on therapy.