AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Functional constipation （FC） is a common functional disorder of the intestines， mainly characterized by reduced bowel movement frequency， difficulty in defecation， a sensation of incomplete evacuation， and hard stools， which severely affect patients’ quality of life. Research indicates that the pathogenesis of FC is closely related to gut microbiota dysbiosis and abnormal bile acid secretion. Bile acids， as endogenous natural laxatives， promote bowel movements by enhancing colonic secretion and regulating intestinal motility； meanwhile， gut microbiota influence colonic transit function by regulating the enteric nervous system， immune system， and their metabolic products. Based on an overview of the relationship between gut microbiota and bile acid metabolism， this article systematically reviews the current research status on the mechanisms of traditional Chinese medicine （TCM） in treating FC by regulating the balance of the gut microbiota-bile acid axis. It is found that single Chinese medicinal herbs （such as Atractylodes macrocephala）， isolated compounds （such as Platycodon grandiflorum polysaccharides）， herbal formulas （such as Shanger huang pill）， acupuncture， and moxibustion can up-regulate the abundance of beneficial bacteria， reshape the microbial structure， correct bile acid metabolism， and activate the Takeda G-protein receptor 5/farnesoid X receptor pathway to treat FC.

ObjectiveThis paper aims to investigate the effects of icariin on spermatogenesis in mice with exercise-induced fatigue and explore the underlying mechanisms. MethodsICR male mice were screened by swimming and randomly divided into normal group， model group， vitamin C group， icariin groups with low， medium， and high doses， and medium-dose icariin+N-nitro-L-arginine methyl ester （L-NAME） group， with 10 mice per group. Except for the normal group， all the other groups underwent weighted swimming training to establish an exercise-induced fatigue model. No gavage was administered during the first two weeks of the weighted training. From week three to four， the icariin groups with low， medium， and high doses received 0.03， 0.06， and 0.12 g·kg^-1 icariin via gavage， respectively. The vitamin C group received 0.2 g·kg^-1 vitamin C. The L-NAME group received 0.06 g·kg^-1 icariin and 0.01 g·kg^-1 L-NAME via intraperitoneal injection. The normal and model groups received equivalent physiological saline. After the experiment， body weight and the last exhaustive swimming time were recorded. Blood urea nitrogen （BUN）， lactate （LA）， lactate dehydrogenase （LDH）， malondialdehyde （MDA）， testicular testosterone （T）， testicular Ca²⁺/Mg²⁺-adenosine triphosphatase （ATPase） （micro-assay）， and the levels of testicular cyclic guanosine monophosphate （cGMP） were measured by using kits. Sperm CD46 levels were detected by flow cytometry. Testicular seminiferous tubules were observed via hematoxylin-eosin （HE） staining， and the testicular morphometric score （TMS） was used to evaluate the spermatogenic function. Protein expression of regucalcin （RGN， SMP30）， cGMP-dependent protein kinase 1 （PKG）， and cGMP-dependent protein kinase anchoring protein （GKAP1） was detected by Western blot. Testicular regucalcin expression was examined by immunofluorescence （IF）. The epididymal sperm quality of mice was observed under a microscope. Fluorescence-stained sections of stimulated by retinoic acid gene 8 （STRA8）， synaptonemal complex protein 3 （SCP3）， and transition protein 1（TNP1） in testicular seminiferous tubules were assessed by immunohistochemistry （IHC）. ResultsCompared with the normal group， the model group showed decreased body weight and exhaustive swimming time （P<0.01）， significantly increased fatigue markers （LA， LDH， and BUN） and lipid peroxidation product MDA （P<0.01）， reduced testicular RGN， PKG， GKAP1， testosterone， Ca²⁺/Mg²⁺-ATPase， and cGMP levels （P<0.01）， decreased sperm motility， sperm count， and TMS scores， and downregulated the expression of STRA8， SCP3， and TNP1. Compared with the model group， the icariin group with high dose exhibited increased exhaustive swimming time （P<0.01）， reduced LA， LDH， BUN， and MDA levels （P<0.01）， elevated superoxide dismutase （SOD） （P<0.01）， upregulated testicular RGN， PKG， GKAP1， testosterone， Ca²⁺/Mg²⁺-ATPase， and cGMP levels （P<0.01）， improved sperm motility， sperm count， and TMS scores， and enhanced STRA8， SCP3， and TNP1 expression. Compared with the L-NAME group， the icariin group with medium dose showed increased expression of STRA8， SCP3， and TNP1 in the testicular tissue （P<0.01） and elevated cGMP and GKAP1 levels （P<0.01）. ConclusionExercise-induced fatigue reduces the expression of RGN and cGMP/PKG/GKAP1 in mice， thereby causing abnormal spermatogenesis and impairing reproductive function in mice. Icariin ameliorates spermatogenic dysfunction in exercise-induced fatigue mice by promoting the expression of RGN and cGMP/PKG/GKAP1， thereby mitigating the damage of exercise-induced fatigue to the reproductive system.

ObjectiveThis paper aims to investigate the effects of icariin on spermatogenesis in mice with exercise-induced fatigue and explore the underlying mechanisms. MethodsICR male mice were screened by swimming and randomly divided into normal group， model group， vitamin C group， icariin groups with low， medium， and high doses， and medium-dose icariin+N-nitro-L-arginine methyl ester （L-NAME） group， with 10 mice per group. Except for the normal group， all the other groups underwent weighted swimming training to establish an exercise-induced fatigue model. No gavage was administered during the first two weeks of the weighted training. From week three to four， the icariin groups with low， medium， and high doses received 0.03， 0.06， and 0.12 g·kg^-1 icariin via gavage， respectively. The vitamin C group received 0.2 g·kg^-1 vitamin C. The L-NAME group received 0.06 g·kg^-1 icariin and 0.01 g·kg^-1 L-NAME via intraperitoneal injection. The normal and model groups received equivalent physiological saline. After the experiment， body weight and the last exhaustive swimming time were recorded. Blood urea nitrogen （BUN）， lactate （LA）， lactate dehydrogenase （LDH）， malondialdehyde （MDA）， testicular testosterone （T）， testicular Ca²⁺/Mg²⁺-adenosine triphosphatase （ATPase） （micro-assay）， and the levels of testicular cyclic guanosine monophosphate （cGMP） were measured by using kits. Sperm CD46 levels were detected by flow cytometry. Testicular seminiferous tubules were observed via hematoxylin-eosin （HE） staining， and the testicular morphometric score （TMS） was used to evaluate the spermatogenic function. Protein expression of regucalcin （RGN， SMP30）， cGMP-dependent protein kinase 1 （PKG）， and cGMP-dependent protein kinase anchoring protein （GKAP1） was detected by Western blot. Testicular regucalcin expression was examined by immunofluorescence （IF）. The epididymal sperm quality of mice was observed under a microscope. Fluorescence-stained sections of stimulated by retinoic acid gene 8 （STRA8）， synaptonemal complex protein 3 （SCP3）， and transition protein 1（TNP1） in testicular seminiferous tubules were assessed by immunohistochemistry （IHC）. ResultsCompared with the normal group， the model group showed decreased body weight and exhaustive swimming time （P<0.01）， significantly increased fatigue markers （LA， LDH， and BUN） and lipid peroxidation product MDA （P<0.01）， reduced testicular RGN， PKG， GKAP1， testosterone， Ca²⁺/Mg²⁺-ATPase， and cGMP levels （P<0.01）， decreased sperm motility， sperm count， and TMS scores， and downregulated the expression of STRA8， SCP3， and TNP1. Compared with the model group， the icariin group with high dose exhibited increased exhaustive swimming time （P<0.01）， reduced LA， LDH， BUN， and MDA levels （P<0.01）， elevated superoxide dismutase （SOD） （P<0.01）， upregulated testicular RGN， PKG， GKAP1， testosterone， Ca²⁺/Mg²⁺-ATPase， and cGMP levels （P<0.01）， improved sperm motility， sperm count， and TMS scores， and enhanced STRA8， SCP3， and TNP1 expression. Compared with the L-NAME group， the icariin group with medium dose showed increased expression of STRA8， SCP3， and TNP1 in the testicular tissue （P<0.01） and elevated cGMP and GKAP1 levels （P<0.01）. ConclusionExercise-induced fatigue reduces the expression of RGN and cGMP/PKG/GKAP1 in mice， thereby causing abnormal spermatogenesis and impairing reproductive function in mice. Icariin ameliorates spermatogenic dysfunction in exercise-induced fatigue mice by promoting the expression of RGN and cGMP/PKG/GKAP1， thereby mitigating the damage of exercise-induced fatigue to the reproductive system.

Cancer remains a leading cause of global mortality, necessitating the development of advanced therapeutic strategies with enhanced efficacy and reduced systemic toxicity. Among promising bioactive agents, lactoferrin (LF)—a multifunctional iron-binding glycoprotein abundantly found in mammalian milk and exocrine secretions—has garnered significant interest for its potent and multifaceted anti-cancer properties. This review provides a comprehensive analysis of the current understanding of LF’s role in oncology, encompassing its structural biology, diverse mechanisms of action, and groundbreaking advancements in its application through nano-engineering. LF exerts anti-tumor effects through multiple pathways, including extracellular action, intracellular action, and immune regulation. It demonstrates a remarkable affinity for cancer cell membranes, binding to overexpressed anionic components such as glycosaminoglycans and sialic acids, as well as to specific receptors including the low-density lipoprotein receptor-related protein-1 (LRP-1). This selective binding facilitates targeted uptake. Upon internalization, LF orchestrates a direct assault by inducing cell-cycle arrest in phases such as G0/G1 or S phase through the modulation of key regulators including cyclins, CDKs, and p53. Furthermore, it promotes programmed cell death via apoptotic pathways, involving caspase activation and downregulation of anti-apoptotic proteins such as survivin. A more recently elucidated mechanism is the induction of ferroptosis, an iron-dependent form of cell death characterized by overwhelming lipid peroxidation. Beyond direct cytotoxicity, LF acts as a potent immunomodulator. It enhances natural killer (NK) cell activity, modulates T-lymphocyte populations, and crucially reprograms tumor-associated macrophages (TAMs) from a pro-tumor M2 state to an anti-tumor M1 state, thereby reversing the immunosuppressive tumor microenvironment (TME). The translation of LF’s potential has been significantly accelerated by nanotechnology. The inherent biocompatibility and natural tumor-targeting capabilities of LF make it an ideal platform for sophisticated drug-delivery systems. This review details various fabrication strategies for LF-based nanoparticles (NPs), including self-assembly, sol-in-oil emulsion, and electrostatic nanocomplexes, among others. Research demonstrates that nano-formulations not only protect LF from degradation but also enhance its bioactivity and anti-cancer potency. More importantly, LF NPs serve as versatile carriers for a wide array of therapeutic agents, including conventional chemotherapeutics, natural compounds, and imaging agents. These engineered systems enable synergistic therapy and facilitate site-specific delivery. Notably, the ability of LF to bind to receptors on the blood-brain barrier (BBB) has been leveraged to develop nano-systems for glioblastoma treatment. Other innovative designs utilize LF to modulate the TME—for instance, by alleviating tumor hypoxia to sensitize cells to radiotherapy and chemotherapy. Despite compelling pre-clinical evidence, the clinical translation of LF and its nano-formulations remains nascent. While early-phase trials have established a favorable safety profile for recombinant human LF, larger Phase III studies have yielded mixed results, underscoring the complexity of its action in humans. Key challenges include enhancing drug targeting, optimizing loading efficiency, ensuring batch-to-batch reproducibility, and achieving deep tumor penetration. Future research must focus on the rational design of next-generation LF-NPs. This entails developing standardized manufacturing protocols, engineering “smart” stimuli-responsive systems for targeted drug release in the TME, and constructing multi-targeting platforms. A concerted interdisciplinary effort is paramount to bridge the gap between bench and bedside. In conclusion, LF, particularly in its nano-engineered forms, represents a highly promising and versatile agent in the oncological arsenal, holding immense potential for precise and effective cancer therapy.

Cancer remains a leading cause of global mortality, necessitating the development of advanced therapeutic strategies with enhanced efficacy and reduced systemic toxicity. Among promising bioactive agents, lactoferrin (LF)—a multifunctional iron-binding glycoprotein abundantly found in mammalian milk and exocrine secretions—has garnered significant interest for its potent and multifaceted anti-cancer properties. This review provides a comprehensive analysis of the current understanding of LF’s role in oncology, encompassing its structural biology, diverse mechanisms of action, and groundbreaking advancements in its application through nano-engineering. LF exerts anti-tumor effects through multiple pathways, including extracellular action, intracellular action, and immune regulation. It demonstrates a remarkable affinity for cancer cell membranes, binding to overexpressed anionic components such as glycosaminoglycans and sialic acids, as well as to specific receptors including the low-density lipoprotein receptor-related protein-1 (LRP-1). This selective binding facilitates targeted uptake. Upon internalization, LF orchestrates a direct assault by inducing cell-cycle arrest in phases such as G0/G1 or S phase through the modulation of key regulators including cyclins, CDKs, and p53. Furthermore, it promotes programmed cell death via apoptotic pathways, involving caspase activation and downregulation of anti-apoptotic proteins such as survivin. A more recently elucidated mechanism is the induction of ferroptosis, an iron-dependent form of cell death characterized by overwhelming lipid peroxidation. Beyond direct cytotoxicity, LF acts as a potent immunomodulator. It enhances natural killer (NK) cell activity, modulates T-lymphocyte populations, and crucially reprograms tumor-associated macrophages (TAMs) from a pro-tumor M2 state to an anti-tumor M1 state, thereby reversing the immunosuppressive tumor microenvironment (TME). The translation of LF’s potential has been significantly accelerated by nanotechnology. The inherent biocompatibility and natural tumor-targeting capabilities of LF make it an ideal platform for sophisticated drug-delivery systems. This review details various fabrication strategies for LF-based nanoparticles (NPs), including self-assembly, sol-in-oil emulsion, and electrostatic nanocomplexes, among others. Research demonstrates that nano-formulations not only protect LF from degradation but also enhance its bioactivity and anti-cancer potency. More importantly, LF NPs serve as versatile carriers for a wide array of therapeutic agents, including conventional chemotherapeutics, natural compounds, and imaging agents. These engineered systems enable synergistic therapy and facilitate site-specific delivery. Notably, the ability of LF to bind to receptors on the blood-brain barrier (BBB) has been leveraged to develop nano-systems for glioblastoma treatment. Other innovative designs utilize LF to modulate the TME—for instance, by alleviating tumor hypoxia to sensitize cells to radiotherapy and chemotherapy. Despite compelling pre-clinical evidence, the clinical translation of LF and its nano-formulations remains nascent. While early-phase trials have established a favorable safety profile for recombinant human LF, larger Phase III studies have yielded mixed results, underscoring the complexity of its action in humans. Key challenges include enhancing drug targeting, optimizing loading efficiency, ensuring batch-to-batch reproducibility, and achieving deep tumor penetration. Future research must focus on the rational design of next-generation LF-NPs. This entails developing standardized manufacturing protocols, engineering “smart” stimuli-responsive systems for targeted drug release in the TME, and constructing multi-targeting platforms. A concerted interdisciplinary effort is paramount to bridge the gap between bench and bedside. In conclusion, LF, particularly in its nano-engineered forms, represents a highly promising and versatile agent in the oncological arsenal, holding immense potential for precise and effective cancer therapy.

low transit constipation （STC） is a common functional intestinal disorder caused by impaired colonic transit function， characterized by reduced bowel movement frequency， hard stools， and difficulty in defecation. The mitogen-activated protein kinase （MAPK） signaling pathway， which mainly includes extracellular signal-regulated kinase （ERK）， c-Jun N-terminal kinase （JNK）， and p38 subtypes， plays a critical regulatory role in the occurrence and development of STC. This paper systematically reviews the multiple pathogenic mechanisms of the MAPK signaling pathway in STC and the research progress of traditional Chinese medicine （TCM） intervention.At the mechanistic level， the MAPK signaling pathway promotes the progression of STC through the following links：（1） Activation of p38 upregulates the expression of aquaporin 3 （AQP3）/AQP4 in the colon， leading to excessive reabsorption of water in the intestinal lumen； （2） It forms a positive feedback loop with nuclear factor-κB （NF-κB） to maintain low-grade intestinal inflammation， releases inflammatory factors such as tumor necrosis factor-α （TNF-α） and interleukin-1β （IL-1β）， and inhibits smooth muscle contraction； （3） Overactivation of p38 downregulates the expression of occludin and mucin 2 while upregulates the expression of claudin-2， thereby disrupting the mucosal barrier； （4） The JNK/p38 signaling pathway activates the caspase cascade to induce apoptosis of intestinal epithelial cells， neurons， and interstitial cells of Cajal； （5） Abnormal ERK signaling and excessive activation of p38/JNK inhibit intestinal smooth muscle contraction and reduce 5-hydroxytryptamine secretion， ultimately resulting in impaired colonic transit function.At the intervention level， TCM compound formulas and single herbs have been proven to improve STC by regulating the MAPK signaling pathway. Their effects are syndrome type-dependent：yin-nourishing formulas （Zengye Chengqi Tang， Tongbian Tang） mainly regulate the ERK/AQP axis； yang-warming formulas （Jichuan Jian） target both ERK/JNK and anti-apoptosis； heat-clearing formulas （Sanren Tang） focus on p38/NF-κB anti-inflammation. A single drug can simultaneously cover multiple aspects including water metabolism， inflammation， barrier function， apoptosis， and intestinal motility.Current relevant studies still have limitations such as mechanisms mostly remaining at the correlational level and a lack of disease-syndrome integrated research models. Future studies should combine specific inhibitors or gene knockout to identify core targets， establish disease-syndrome integrated STC models， and use network pharmacology and molecular docking techniques to deeply analyze the fine mechanism of “component-target-phenotype”， so as to provide high-quality evidence for the precise regulation of the MAPK signaling pathway by TCM in the intervention of STC.

Objective To investigate the distribution and antimicrobial resistance profiles of common pathogens isolated from cerebrospinal fluid(CSF)in CHINET program from 2015 to 2021.Methods The bacterial strains isolated from CSF were identified in accordance with clinical microbiology practice standards.Antimicrobial susceptibility test was conducted using Kirby-Bauer method and automated systems per the unified CHINET protocol.Results A total of 14 014 bacterial strains were isolated from CSF samples from 2015 to 2021,including the strains isolated from inpatients(95.3％)and from outpatient and emergency care patients(4.7％).Overall,19.6％of the isolates were from children and 80.4％were from adults.Gram-positive and Gram-negative bacteria accounted for 68.0％and 32.0％,respectively.Coagulase negative Staphylococcus accounted for 73.0％of the total Gram-positive bacterial isolates.The prevalence of MRSA was 38.2％in children and 45.6％in adults.The prevalence of MRCNS was 67.6％in adults and 69.5％in children.A small number of vancomycin-resistant Enterococcus faecium(2.2％)and linezolid-resistant Enterococcus faecalis(3.1％)were isolated from adult patients.The resistance rates of Escherichia coli and Klebsiella pneumoniae to ceftriaxone were 52.2％and 76.4％in children,70.5％and 63.5％in adults.The prevalence of carbapenem-resistant E.coli and K.pneumoniae(CRKP)was 1.3％and 47.7％in children,6.4％and 47.9％in adults.The prevalence of carbapenem-resistant Acinetobacter baumannii(CRAB)and Pseudomonas aeruginosa(CRPA)was 74.0％and 37.1％in children,81.7％and 39.9％in adults.Conclusions The data derived from antimicrobial resistance surveillance are crucial for clinicians to make evidence-based decisions regarding antibiotic therapy.Attention should be paid to the Gram-negative bacteria,especially CRKP and CRAB in central nervous system(CNS)infections.Ongoing antimicrobial resistance surveillance is helpful for optimizing antibiotic use in CNS infections.

Objective To investigate the antimicrobial resistance of clinical isolates from elderly patients(≥65 years)in major medical institutions across China.Methods Bacterial strains were isolated from elderly patients in 52 hospitals participating in the CHINET Antimicrobial Resistance Surveillance Program during the period from 2015 to 2021.Antimicrobial susceptibility test was carried out by disk diffusion method and automated systems according to the same CHINET protocol.The data were interpreted in accordance with the breakpoints recommended by the Clinical and Laboratory Standards Institute(CLSI)in 2021.Results A total of 514 715 nonduplicate clinical isolates were collected from elderly patients in 52 hospitals from January 1,2015 to December 31,2021.The number of isolates accounted for 34.3％of the total number of clinical isolates from all patients.Overall,21.8％of the 514 715 strains were gram-positive bacteria,and 78.2％were gram-negative bacteria.Majority(90.9％)of the strains were isolated from inpatients.About 42.9％of the strains were isolated from respiratory specimens,and 22.9％were isolated from urine.More than half(60.7％)of the strains were isolated from male patients,and 39.3％isolated from females.About 51.1％of the strains were isolated from patients aged 65-＜75 years.The prevalence of methicillin-resistant strains(MRSA)was 38.8％in 32 190 strains of Staphylococcus aureus.No vancomycin-or linezolid-resistant strains were found.The resistance rate of E.faecalis to most antibiotics was significantly lower than that of Enterococcus faecium,but a few vancomycin-resistant strains(0.2％,1.5％)and linezolid-resistant strains(3.4％,0.3％)were found in E.faecalis and E.faecium.The prevalence of penicillin-susceptible S.pneumoniae(PSSP),penicillin-intermediate S.pneumoniae(PISP),and penicillin-resistant S.pneumoniae(PRSP)was 94.3％,4.0％,and 1.7％in nonmeningitis S.pneumoniae isolates.The resistance rates of Klebsiella spp.(Klebsiella pneumoniae 93.2％)to imipenem and meropenem were 20.9％and 22.3％,respectively.Other Enterobacterales species were highly sensitive to carbapenem antibiotics.Only 1.7％-7.8％of other Enterobacterales strains were resistant to carbapenems.The resistance rates of Acinetobacter spp.(Acinetobacter baumannii 90.6％)to imipenem and meropenem were 68.4％and 70.6％respectively,while 28.5％and 24.3％of P.aeruginosa strains were resistant to imipenem and meropenem,respectively.Conclusions The number of clinical isolates from elderly patients is increasing year by year,especially in the 65-＜75 age group.Respiratory tract isolates were more prevalent in male elderly patients,and urinary tract isolates were more prevalent in female elderly patients.Klebsiella isolates were increasingly resistant to multiple antimicrobial agents,especially carbapenems.Antimicrobial resistance surveillance is helpful for accurate empirical antimicrobial therapy in elderly patients.

Objective To compare the blood flow perfusion area in different retinal vascular plexuses between adults and children using swept-source optical coherence tomography angiography(SS-OCTA)and explore the correlation of the retinal blood flow perfusion area with spherical equivalent(SE)and axial length(AL).Methods A total of 112 partici-pants,including 58 children(116 eyes,aged 8-13 years)and 54 adults(108 eyes,aged 18-30 years),were recruited from Eye Hospital,Wenzhou Medical University from December 2020 to December 2024.Based on SE,these children and adults were further divided into the emmetropia(-0.50＜SE ≤+0.50 D),low myopia(-3.00＜SE≤-0.50 D),and moderate myopia(-6.00＜SE≤-3.00 D)groups.SS-OCTA was used to acquire the perfusion area data across retinal vascular layers.The inner vascular network of the retina was subdivided into the peripapillary radial vascular network,su-perficial vascular plexus(SVP),middle vascular plexus(MVP),and deep vascular plexus(DVP).The blood flow perfu-sion areas across retinal vascular layers were compared between adults and children.Pearson correlation analysis was per-formed to assess the correlation of the blood flow perfusion areas across retinal vascular layers with AL and SE in adults and children,respectively.Results SE was negatively correlated with AL in both adults and children(r=-0.781 and-0.667,respectively;both P＜0.001).The total inner retinal perfusion area was negatively correlated with AL in both adults and children(r=-0.239 and-0.299,respectively;both P＜0.05).In children,the perfusion area in the peripapil-lary radial vascular network,SVP,and DVP was negatively correlated with AL(r=-0.443,-0.315,and-0.220,respec-tively;all P＜0.05).In adults,the perfusion area in SVP,MVP,and DVP was negatively correlated with AL(r=-0.243,-0.230,and-0.364,respectively;all P＜0.05).Adults with low/moderate myopia exhibited a significantly larger perfu-sion area in the peripapillary radial vascular network compared with children with corresponding myopia levels,and the differences were statistically significant(both P＜0.001).Conclusion There were significant differences in the perfu-sion area of the peripapillary radial vascular network between adult and pediatric myopic patients.AL showed the strongest correlations with the perfusion area of the peripapillary radial vascular network in adults and the perfusion area of DVP in children,respectively,suggesting distinct effects of retinal vascular layers at different stages of ocular growth.