AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective To explore the protective effect of hydroalcoholic extract of Portulaca oleracea L.(POHA)on ulcerative colitis(UC)and bone loss in mice.Methods The C57BL/6 mice were treated with dextran sulfate sodium(DSS)to establish UC model.A total of 50 mice were randomly assigned to including control group,DSS group,mesalazine(MS)group,low dose of POHA(POHAL)group,or high dose of POHA(POHAH)group.The control group freely drank drinking water,while the DSS,MS,POHAL and POHAH groups drank drinking water containing DSS for 8 weeks.Since the 2nd week,the control group and DSS group were given normal saline by gavage.The MS group was given MS(100 mg/kg)by gavage.The POHAL group and POHAH group were given POHA(1 000 mg/kg and 2 000 mg/kg)by gavage,respectively.Body weight and disease activity index(DAI)were recorded and calculated every 2 d.On the 56th day,the colon weight index,liver index,and spleen index were calculated,and the histological changes of colon were observed.Serum levels of bone metabolism markers and microstructure parameters of femur were detected.Results Compared with the control group,the DSS group showed significantly increased DAI score,colon weight index,liver index,and spleen index(all P＜0.01).The DSS group exhibited significant pathological damage in colon tissues and significantly increased serum levels of osteocalcin,C-terminal peptide of collagen type Ⅰ,and tartrate-resistant acid phosphatase 5b(P＜0.01).The bone loss was significant in the DSS group,manifested by markedly decreased bone mineral density(BMD),bone tissue volume to tissue volume ratio(BV/TV),trabecular bone number(Tb.N),and trabecular bone thickness(Tb.Th),and markedly increased bone surface to bone volume ratio(BS/BV)and trabecular bone separation(Tb.Sp)(P＜0.05 or P＜0.01).Compared with the DSS group,the BMD,BV/TV,Tb.N and Tb.Th of the femur in the MS group and POHAH group of mice were all increased(P＜0.05 or P＜0.01),the BS/BV all decreased(P＜0.05 or P＜0.01),and the Tb.Sp all decreased without significant differences(all P＞0.05).The above bone microstructure parameters in the POHAL group showed no significant differences compared with those in the DSS group(all P＞0.05).Conclusion POHA has protective effect on DSS-induced UC and bone loss,and the mechanism may be related to the inhibition of hyperactive bone metabolism.

Hypochlorous acid/hypochlorite(HClO/ClO-)plays a key role in biological processes and is commonly used as a disinfectant in drinking water.However,excessive intake of HClO/ClO-can oxidize biomolecules like DNA,RNA,and proteins,causing organ damage.Diseases such as rheumatoid arthritis and Alzheimer's disease can also lead to overproduction of HClO/ClO-.Therefore,accurately detecting HClO/ClO-levels is crucial.In this study,an HClO/ClO-fluorescent probe,NC-TPA-PPh3,was designed and synthesized,with a triphenylamine core as the fluorescent unit,carbon-carbon double bonds as recognition sites,and a quaternary ammonium salt for mitochondria targeting,forming a D-π-A structure.This probe had a fluorescence lifetime of 3.71 ns and a fluorescence quantum yield of 0.51.Upon exposure to HClO/ClO-,the maximum fluorescence emission wavelength of the probe in DMSO/H2O(9∶1,V/V,pH=7.4)solution(20 μmol/L)shifted from 550 nm to 430 nm,with a fluorescence intensity increase of 35.7 times compared to blank probe solution,allowing for selective recognition of HClO/ClO-.The probe also exhibited a large Stokes shift(130 nm)and a low limit of detection(LOD)of 9.16×10-8 mol/L.Based on characterization by proton nuclear magnetic resonance(1H NMR),electrospray ionization-mass spectrometry(ESI-MS),scanning electron microscopy(SEM)and theoretical calculations,it was speculated that NC-TPA-PPh3 recognized HClO/ClO-through oxidative cleavage of the C=C bond in the probe,generating TPA-CHO with lower water solubility and a smaller conjugated structure.This disrupted the D-π-A structure,blocking intramolecular charge transfer(ICT),causing the fluorescence emission peak to blue-shift from 550 nm to 430 nm.Additionally,this process induced an aggregation-induced fluorescence effect,significantly enhancing the fluorescence intensity at 430 nm.

Introducing fingerprint level 3 features(especially sweat pores)in fingerprint recognition can significantly improve the value of fingerprints.However,conventional fingerprint visualization methods suffer from issues such as poor stability and reproducibility,insufficient resolution,and feature masking in detecting level 3 features.Electrospun membrane has unique advantages in latent fingerprint(LFP)detection due to its excellent adsorption performance and high specific surface area,and thus its application potential in LFP visualization urgently need to be explored.A novel pore visualization method based on core-shell structured PAN-Flu/PVP composite nanofibrous membrane was proposed in this work.Specifically,the PAN-Flu/PVP composite nanofibrous membrane was prepared via coaxial electrospinning technology,with polyacrylonitrile(PAN)loaded with fluorescein(Flu)as the core and polyvinylpyrrolidone(PVP)as the shell.The experimental results showed that the prepared PAN Flu/PVP composite nanofibrous membrane had a porous structure and excellent adsorption performance.Based on the water solubility of the outer shell PVP and the water induced fluorescence enhancement effect of the core Flu,high-resolution visualization of sweat pores could be achieved within 2 s.The optimization experiment showed that the best quality of sweat latent fingerprints was obtained when the Flu content was 4 mg/mL,the spinning time was 1 h,and the sweating time was 2 min.Through repeated fingerprinting and live fingerprint comparison experiment,the strong stability and high reproducibility of the as-produced membrane in displaying fingerprint sweat pores were finally verified.In summary,the development method could quickly,stably and accurately extract the spatial distribution and activity level of fingerprint sweat pores,which was of great significance for improving the utilization and value of fingerprints.

Loop-mediated isothermal amplification(LAMP)is a newin vitronucleic acid amplification technique,which has been widely used in rapid detection of pathogenic bacteria,with advantages of high efficiency,simple operation and low cost.Microfluidic chip technique is a kind of miniaturized and integrated analytical technology,which integrates automation and high throughput,and can effectively avoid sample cross-contamination and has the advantages of high sample utilization rate and high cost-effectivenes.LAMP combined with microfluidic chip can detect multiple samples of the same pathogen at the same time or single samples of different pathogens at the same time,providing a new method for the rapid,field detection of pathogens.In this paper,the research progresses of LAMP microfluidic chip and its application in rapid detection of pathogenic bacteria in recent years were reviewed,and the future prospect was discussed.

Objective: To investigate the indoor fine particulate matter (PM 2.5 ) pollution and its influencing factors in children s bedrooms using solid fuel, so as to provide evidence for effective strategy to reduce PM 2.5 pollution. Methods: From December 2019 to November 2020, 198 households (108 in the north, 90 in the south) from two pilots in the north(Jiamusi in Heilongjiang Province) and south of China (Mianyang in Sichuan Province) were selected, and status of solid fuels using were obtained through home visits, dynamic changes in PM 2.5 concentrations in children s bedrooms were monitored by using real time online instruments, and the influencing factors of PM 2.5 pollution were analyzed by using a mixed effects model. Results: During the monitoring period, the daily PM 2.5 concentrations in the northern and southern pilot were 78.33 (40.50, 154.80) and 38.54(26.20, 58.46) μg/m 3, respectively, exceeding standard rates of 44.57% and 33.22%. During the heating period, the daily PM 2.5 concentrations in the northern and southern pilot were 212.50(133.60,244.10) and 104.42(73.97, 134.90) μg/m 3, respectively, with over standard rates of 96.75% and 86.96%. The mixed effects model analysis results showed that children s bedroom PM 2.5 concentrations were associated with solid fuel usage duration, window opening time, room layout (shared entrance door between kitchen and bedroom), indoor smoking, indoor humidity, and solid fuel use in the bedroom ( β =0.19, -0.05, 1.20, 0.43, 0.02, 0.35, all P <0.05). Conclusion Solid fuel combustion significantly comtributes to PM 2.5 pollution in children s bedrooms, with more pronounced impacts observed in northern China compared to southern regions.

Metabolic reprogramming in the tumor microenvironment is closely associated with tumor initiation and progression.Endogenous metabolites can not only regulate tumor formation and metastasis,but also impair antitumor immune efficacy by influencing immune cells.However,current research focuses on the effects of single metabolites on tumors rather than take into account the systemic nature of metabolic networks,the diversity of metabolic products,and their dynamic regulatory roles in the tumor immune microenvironment.An in-depth analysis of the key nodes in metabolic pathways related to endogenous metabolites and their regulatory mechanisms in tumor progression is crucial to the development of antitumor therapies based on metabolic intervention.This paper provides an overview of the molecular mechanisms by which endogenous metabolites,such as amino acids,lipids and nucleotides,contribute to tumor progression and regulate the immune microenvironment.By offering new theoretical insights into the complex network of the metabolism-immune axis in tumor development,this review aims to provide data for the development of metabolism-targeted antitumor immuno-therapy strategies.

OBJECTIVES: To report the development, validation, and findings of the Multi-dimensional Attention Rating Scale (MARS), a self-report tool crafted to evaluate six-dimension attention levels. METHODS: The MARS was developed based on Classical Test Theory (CTT). Totally 202 highly educated healthy adult participants were recruited for reliability and validity tests. Reliability was measured using Cronbach's alpha and test-retest reliability. Structural validity was explored using principal component analysis. Criterion validity was analyzed by correlating MARS scores with the Toronto Hospital Alertness Test (THAT), the Attentional Control Scale (ACS), and the Attention Network Test (ANT). RESULTS: The MARS comprises 12 items spanning six distinct dimensions of attention: focused attention, sustained attention, shifting attention, selective attention, divided attention, and response inhibition.As assessed by six experts, the content validation index (CVI) was 0.95, the Cronbach's alpha for the MARS was 0.78, and the test-retest reliability was 0.81. Four factors were identified (cumulative variance contribution rate 68.79%). The total score of MARS was correlated positively with THAT (r = 0.60, P < 0.01) and ACS (r = 0.78, P < 0.01) and negatively with ANT's reaction time for alerting (r = -0.31, P = 0.049). CONCLUSIONS The MARS can reliably and validly assess six-dimension attention levels in real-world settings and is expected to be a new tool for assessing multi-dimensional attention impairments in different mental disorders.
Humans ; Adult ; Male ; Attention/physiology* ; Female ; Middle Aged ; Reproducibility of Results ; Young Adult ; Psychometrics

OBJECTIVE: To investigate the characteristics of Vitamin D (VitD) and bone metabolism in patients with knee osteoarthritis (KOA) concurrent with osteoporosis (OP). METHODS: A retrospective analysis was performed on 240 patients who were admitted to the orthopedics department between March 2019 and March 2024. Patients were stratified into four distinct groups according to their respective disease categories.There were 90 patients in the simple KOA group, comprising 13 males and 77 females, age ranged from 50 to 91 years old with an average of (68.48±8.96) years old. There were 90 patients in the simple OP group, comprising 7 males and 83 females, age ranged from 52 to 88 years old with an average of (69.60±8.94 )years old. There were 30 patients in the KOA with OP group, comprising 1 male and 29 females, age ranged from 51 to 91 years old with an average of(69.03±7.93) years old. There were 30 patients in the physical examination group, comprising 5 males and 25 females, age ranged from 53 to 79 years old with an average of(64.93±6.51) years old. The general data and the levels of osteocalcin (OC), β-CrossLaps, parathyroid hormone(PTH) and VitD in each group were observed. RESULTS: The level of VitD in KOA with OP group (19.62±10.38) ng·ml^-1 and OP group (20.65±10.50) ng·ml^-1 was lower than that in physical examination group (27.46±8.00) ng·ml^-1 and KOA group (24.01±9.11) ng·ml^-1 (P<0.05). There were significant differences in β- CrossLaps and PTH levels among the four groups (P<0.001, P=0.019, respectively), while there was no significant difference in OC levels (P=0.763). Compared with the two simple disease groups, the KOA with OP group had higher levels of β - CrossLaps(0.81±0.30) ng·ml^-1 (P<0.001). There were significant differences in β-CrossLaps and PTH between the simple KOA group(0.54±0.22) ng·ml^-1, (46.03±18.08) pg·ml^-1 and the physical examination group (0.44±0.19) ng·ml^-1, (36.65±9.63) pg·mL^-1(P=0.038;P=0.006). There was a significant difference in PTH between the OP group(43.85±14.30) ng·ml-1, and the physical examination group, P=0.004. There was a significant difference in Kallgren-Lawrence grading between KOA with OP group and KOA group (P=0.006). Within KOA with OP group, the differences of β-CrossLaps and VitD levels among different K-L grades were statistically significant (P=0.016). The level of OC, β-CrossLaps and PTH within KOA with OP group was significantly different at different VitD levels (P=0.013, P=0.033, P=0.046). CONCLUSION Patients with KOA complicated by OP exhibit greater disturbances in bone metabolism and reduced VitD levels, particularly reflected by elevated β-CrossLaps. These findings underscore the importance of early monitoring of bone turnover and VitD supplementation in advanced-stage KOA with bone loss.
Humans ; Female ; Male ; Middle Aged ; Aged ; Vitamin D/blood* ; Osteoporosis/complications* ; Aged, 80 and over ; Osteoarthritis, Knee/complications* ; Retrospective Studies ; Bone and Bones/metabolism* ; Parathyroid Hormone/metabolism* ; Osteocalcin/metabolism*

OBJECTIVE: To explore the effectiveness and feasibility of two osteotomy guides in medial open wedge high tibial osteotomy (MOWHTO). METHODS: Clinical data of 103 patients who underwent routine MOWHTO surgery between January 2020 and December 2022 were collected for retrospective analysis. The patients were divided into two groups based on the method of osteotomy guide plate. The control group of 51 patients received traditional osteotomy guide plate technique, including 17 males and 34 females, aged from 48 to 68 years old with an average of(57.93±4.82) years old, with a disease duration ranged from 1 to 8 years with an average of (4.89±1.49) years. The observation group of 52 patients received personalized osteotomy guide plate technique, including 23 males and 29 females, aged from 48 to 69 with an average of (58.22±5.10) years, with a disease duration ranged from 1 to 9 years with an average of(5.10±1.55) years. The perioperative indicators, complications, and knee joint recovery rate were statistically analyzed for both groups, as well as the preoperative and postoperative coagulation function, fibrinogen (FIB), D-dimer (D-D), gait parameters (step frequency, step length, step speed), biomechanical indicators, weight bearing line (WBL), medial proximal tibial angle (MPTA), joint line conergence angle (JLCA), and anterior cruciate ligament (ACL) function (body width, tibial anterior displacement). RESULTS: All patients were followed up for 6 months. The intraoperative blood loss, operation time, and number of fluoroscopic views in the observation group were (358.58±93.76) ml, (84.42±8.17) min, and (2.00±0.44) times, respectively, which were all less than those in the control group (465.55±105.38) ml, (96.53±10.51) min, and (6.31±0.58) times (P<0.05). Three days after surgery, the FIB and D-D levels in the observation group were (4.21±0.48) g·L^-1 and (204.47±35.59) μg·L^-1, respectively, which were both lower than those in the control group (5.56±0.57) g·L^-1 and (311.12±42.23) μg·L^-1 (P<0.05). Three months after surgery, the step frequency, step length, and step speed in the observation group were (1.89±0.23) steps·s^-1, (0.57±0.15) m, and (0.99±0.11) m·s^-1, respectively, which were all higher than those in the control group (1.80±0.18) steps·s^-1, (0.50±0.14) m, and (0.95±0.09) m·s^-1 (P<0.05). Three months after surgery, the WBL and MPTA in the observation group were (45.53±4.41)% and (87.03±8.15)°, respectively, which were both higher than those in the control group (38.38±4.36)% and (83.68±8.50)°, and the JLCA was (2.36±0.24)°, which was lower than that in the control group (2.61±0.33)° (P<0.05). The ACL body width during internal fixation removal was (5.60±0.51) mm, which was greater than that in the control group (5.08±0.56) mm, and the tibial migration was (5.70±0.42) mm, which was less than that in the control group (6.33±0.48) mm (P<0.05). There was no significant difference in the incidence of complications between the two groups (P>0.05). Six months after surgery, there was no significant difference in the recovery rate of knee joint between the two groups (P>0.05). CONCLUSION The application of personalized osteotomy guide technique in MOWHTO can help improve knee biomechanics and ACL function, and has less effect on coagulation function and no increase in complications.
Humans ; Male ; Female ; Osteotomy/methods* ; Middle Aged ; Tibia/physiopathology* ; Aged ; Biomechanical Phenomena ; Retrospective Studies ; Osteoarthritis, Knee/physiopathology*