1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Staged Efficacy of Qijia Rougan Prescription Combined with Entecavir for Chronic Hepatitis B-related Hepatic Fibrosis with Qi Deficiency and Collateral Stasis Syndrome Based on "Zhu Ke Jiao" Theory
Baixue LI ; Xin WANG ; Jibin LIU ; Li WEN ; Cen JIANG ; Wenjun WU ; Dong WANG ; Shuwan LIU ; Huabao LIU ; Yongli ZHENG ; Liang HUANG ; Yue SU ; Song ZHANG ; Yanan SHANG ; Hang ZHOU ; Quansheng FENG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(9):180-188
ObjectiveThis paper aims to investigate and evaluate the staged efficacy and safety of the representative empirical prescription of the “Zhu Ke Jiao” theory, Qijia Rougan prescription, combined with entecavir in the treatment of hepatic fibrosis in chronic hepatitis B. MethodsA multicenter randomized controlled clinical study was conducted, and 101 patients diagnosed with chronic hepatitis B-related hepatic fibrosis (CHB-HF) who met the diagnosis and inclusion criteria were randomly assigned to an observation group (Qijia Rougan prescription + entecavir) and a control group (entecavir). The treatment duration was 24 weeks. Liver stiffness measurement (LSM), fibrosis-4 index (FIB-4), portal vein diameter, hepatitis B serology, biochemical indicators, hepatic fibrosis markers in serum [hyaluronic acid (HA), laminin (LN), procollagen Ⅲ peptide (PⅢP), and type Ⅳ collagen (Ⅳ-C)], and traditional Chinese medicine syndrome scores were used as efficacy evaluation indicators. Efficacy assessments and explorations of different staged subgroups of Qijia Rougan prescription were conducted according to LSM values based on the Metavir pathological staging standard. ResultsA total of 98 cases were included for statistical analysis, with 49 cases in the observation group and 49 in the control group. The general data of the patients in both groups were comparable. Compared with the same group before treatment, the observation group showed a significant reduction in LSM and FIB-4 (P<0.01), as well as notable improvements in LN, Ⅳ-C, and various TCM syndrome scores (P<0.05, P<0.01). When compared to the control group after treatment, the observation group demonstrated significant improvements in LSM, FIB-4, and various TCM syndrome score indicators (P<0.05, P<0.01), indicating that the observation group performed better than the control group. Subgroup analysis of the regression of hepatic fibrosis stages showed that compared to the same group before treatment, the observation group had better improvement in regression of stages F2 and F3 (P<0.05). When compared to the control group after treatment, the observation group exhibited superior improvement in regression of stage F3 (P<0.05). No adverse events occurred in either group during the treatment period. ConclusionCompared with entecavir alone, the combination of Qijia Rougan prescription and entecavir significantly improves the degree of hepatic fibrosis and clinical TCM symptoms in patients. The optimal intervention period is primarily during stage F3, which is a potential “interception” point of the “Zhu Ke Jiao” theory.
3.Strategies of HIV-1 Vaccines Based on mRNA Platforms
Pei LIU ; Zhong-Yue FANG ; Xin-Xin CHEN ; Shao-Wei LI ; Ying GU
Progress in Biochemistry and Biophysics 2026;53(4):826-839
Since its emergence in the 1980s, the human immunodeficiency virus (HIV) has caused a global pandemic, posing a severe threat to human life and health as well as social development. Although pre-exposure prophylaxis (PrEP) effectively curbs HIV transmission and antiretroviral therapy (ART) significantly extends the lifespan of patients, vaccines remain a pivotal tool for blocking transmission and ending the pandemic. The high genetic variability of HIV-1, the glycan shield of its envelope glycoproteins, and the long-term persistence of latent reservoirs have repeatedly led to bottlenecks in traditional vaccine strategies. In recent years, mRNA technology has offered a novel approach to addressing these challenges, leveraging advantages such as sequence programmability, short production cycles, native conformational expression of antigens, and self-adjuvant effects. In recent years, mRNA vaccine technology has emerged as a transformative solution to longstanding vaccinology challenges, characterized by its sequence programmability, rapid production cycles, native conformational antigen expression, and intrinsic self-adjuvanting properties. Unlike traditional platforms reliant on pathogen culture or recombinant proteins, mRNA vaccines can be expeditiously designed and updated based solely on viral genomic sequences. Lipid nanoparticle (LNP)-encapsulated mRNA facilitates endogenous antigen expression and presentation, simultaneously eliciting potent humoral and cellular immune responses. Within this landscape, self-amplifying mRNA (saRNA) further extends in vivo antigen expression to enhance the persistence of immune responses. Moreover, the LNP delivery system not only protects mRNA from degradation and mediates endosomal escape but also synergizes with mRNA to optimize immune activation via self-adjuvant effects. Importantly, mRNA platforms circumvent the pre-existing immunity associated with viral vectors and the genomic integration risks of DNA vaccines, positioning them as a cornerstone for global pandemic preparedness. This review systematically delineates recent advances in mRNA technology for HIV-1 vaccine development, focusing on four pivotal research frontiers. First, mRNA innovations building upon the RV144 trial optimize antigens through codon modification and multivalent designs to induce more durable and broad-spectrum immunity. Second, particulate mRNA vaccine strategies, utilizing virus-like particles (VLPs) and ferritin nanoparticles, achieve in situ antigen self-assembly, significantly enhancing B cell activation and reducing infection risks in non-human primate models. Third, germline-targeting mRNA vaccines address the low-affinity barrier of broadly neutralizing antibody (bNAp) precursors, efficiently activating rare precursor B cells and promoting affinity maturation. Fourth, therapeutic mRNA vaccines offer unique advantages for an HIV functional cure; combining immunogens with mRNA-encoded adjuvants potentiates cellular immunity, while LNP-mediated “shock-and-kill” strategies specifically activate latent reservoirs to guide immune clearance. Comparative analyses with traditional platforms reveal that mRNA technology redefines antigen production and presentation, simulating chronic infection through sustained expression and enabling dual-pathway presentation via endogenous synthesis. Furthermore, we explore the mechanistic innovations of mRNA vaccines in inducing bNAps: sustained in vivo production prolongs the activation window for precursor B cells and maintains germinal center (GC) reactions; endogenously expressed antigens adopt native conformations to expose conserved epitopes; and self-adjuvanting effects modulate the functions of antigen-presenting cells (APCs) and follicular helper T cells (Tfh), driving somatic hypermutation and affinity maturation. We also address critical clinical translation challenges, including immune durability, adaptability to special populations, and large-scale LNP manufacturing, while proposing targeted optimization strategies. In conclusion, this review establishes a theoretical framework for utilizing mRNA technology to overcome HIV-1 immune escape, transitioning from a descriptive paradigm to a problem-solving-based synthesis of evidence. By integrating preclinical and early clinical data, we bridge the gap between basic design and translational verification. mRNA technology is poised to become a central pillar inHIV-1 prevention and therapy, providing a robust toolset to achieve the global goal of ending the AIDS pandemic and offering a blueprint for vaccine development against other recalcitrant infectious diseases.
4.Skeleton Binding Protein 1 of Plasmodium berghei Influences Deformability and Cytoskeletal Ultrastructure of Infected Erythrocyte
Xin-Yue GUO ; Huan-Qi ZHAO ; Yan-Xuan ZHONG ; Ru-Meng JIANG ; Yao-Xian LI ; Lei-Ting PAN ; Qian WANG ; Xiao-Yu SHI
Progress in Biochemistry and Biophysics 2026;53(4):1015-1027
ObjectiveThe malaria parasites remodel the host erythrocyte structure by exporting parasite proteins that interact with the membrane skeleton proteins of red blood cells (RBCs), facilitating their intracellular survival and pathogenicity. Skeleton-binding protein 1 (SBP1) is a conserved exported protein across Plasmodium species. In Plasmodium falciparum, SBP1 has been reported to interact with erythrocyte membrane skeleton proteins 4.1R and spectrin, while its contribution to erythrocyte remodeling and parasite virulence in Plasmodium berghei (Pb) remains unclear. This study aims to determine whether PbSBP1 associates with the host cytoskeletal protein 4.1R and to investigate its role in the remodeling of host RBCs and the pathogenicity of Plasmodium berghei. MethodsIn Plasmodium berghei, the relationship between PbSBP1 and the erythrocyte cytoskeletal protein 4.1R was examined using co-immunoprecipitation. A Pbsbp1 gene knockout mutant of Plasmodium berghei (Pbsbp1∆) was generated based on the principle of double crossover homologous recombination. The deformability of erythrocytes infected with Pbsbp1∆ parasites was assessed using microfluidic methods. Microchannels with an array of cylindrical pillars were used to detect modifications in infected RBC deformability. The infected RBCs were squashed between the rows and recovered between the columns and the transit velocity (μm/s) of infected RBCs travelling through the microchannel was recorded. The component of the erythrocyte membrane skeleton junctional complex, tropomodulin (TMOD), was fluorescently labeled, and the cytoskeletal network of infected erythrocytes was imaged using super-resolution stochastic optical reconstruction microscopy (STORM) to analyze ultrastructural changes in the cytoskeleton of wild-type (WT) and Pbsbp1∆-infected erythrocytes. Actin-based junctional complexes were displayed as individual clusters by the labeled TMOD in the STORM images, and the cluster densities and distances between adjacent clusters of infected RBCs were calculated. Additionally, rodent malaria models (BALB/c mice) and experimental cerebral malaria models (C57BL/6 mice) were employed to monitor the growth of Pbsbp1∆ and WT parasites during the intraerythrocytic stage and their capacity to induce cerebral malaria in mice. ResultsPbSBP1 may participate in the remodeling of infected erythrocytes through direct or indirect interaction with the erythrocyte cytoskeletal protein 4.1R. Microfluidic assays revealed that the deformability of erythrocytes infected with Pbsbp1∆ parasites was significantly enhanced compared to those infected with WT parasites. STORM imaging further demonstrated that the ultrastructure of the erythrocyte cytoskeleton in Pbsbp1∆-infected cells was altered relative to that in WT-infected erythrocytes. The distances between nearest neighbors of clusters had a tendency to increase while the cluster densities were decreased in Pbsbp1∆-infected RBCs compared to WT-infected RBCs. Subsequent phenotypic analysis indicated that the growth rate of Pbsbp1∆ parasites during the intraerythrocytic stage was significantly slower than that of WT parasites, and their ability to induce cerebral malaria in mice was also attenuated. These findings suggest that PbSBP1 is involved in the remodeling of the erythrocyte membrane skeleton, likely through its direct or indirect interaction with protein 4.1R, thereby regulating the deformability of infected erythrocytes and influencing the pathogenicity of the blood-stage parasites. ConclusionThis study establishes a role for PbSBP1 in host erythrocyte remodeling and parasite virulence, providing new research strategies for the prevention and treatment of malaria.
5.The Role of Lysosomal Dysfunction in Hepatocellular Carcinoma: From Pathogenesis to Targeted Therapies
Yue-Yan WU ; Xin CHEN ; Ce-Fan ZHOU ; Jing-Feng TANG ; Rui ZHANG
Progress in Biochemistry and Biophysics 2026;53(3):609-622
Hepatocellular carcinoma (HCC) is a lethal cancer with high morbidity rates worldwide. It is a major threat to public health in China, due to the combination of known and new risk factors, such as endemic hepatitis B virus (HBV), dietary aflatoxin exposure, and the occurrence of metabolic dysfunction-associated steatotic liver disease (MASLD). Although many methods for surveillance and multimodal therapies, such as surgery, local ablation, transarterial therapy, and new systemic agents, have been available, the survival rates of HCC remains poor. They have very limited durable responses, long post-treatment recurrence rates, and high resistance to treatment. This reflects an imperfect picture of the biological cause of the disease and a need for new mechanistic or targeted techniques. A significant characteristic of HCC, in common with other aggressive cancers, is the presence of reprogrammed, hyperactive cell metabolism. Tumor cells hijack metabolic pathways to promote their uncontrolled growth, stress survival, invasion and metastasis. While classical mechanisms such as the Warburg effect, lipid metabolism and glutamine utilization have been understood, the lysosome, which was once viewed as a static “waste disposal unit” to remove old organelles and proteins, is instead a dynamic signaling and metabolic core. The lysosomes incorporate nutrients, energy and stress signals by master regulators such as mTORC1 (activated on its surface) that balance anabolic growth and catabolic recycling to the cellular demands. In HCC, lysosomes are not passive, but are highly active and dysregulated. HCC cells upregulate lysosomes, which scavenge intracellular components via enhanced autophagy and engulf extracellular proteins via macropinocytosis, crucial for survival in the nutrient-poor, hypoxic tumor microenvironment. In addition to metabolism, lysosomes exhibit pro-invasive functions by secreting hydrolases to remodel the extracellular matrix, promote angiogenesis, and suppress stromal immune cells to foster a pro-tumor microenvironment. In a clinical context, lysosomes play an important role in therapeutic resistance: they sequester and inactivate chemotherapeutics via lysosomal sequestration, and enhanced autophagic flux protects the cell from therapy-induced damage, contributing to relapse, as lysosomal dysfunction is a key cause of treatment failure. This makes lysosomes promising yet challenging therapeutic targets in HCC. Recent preclinical and early clinical studies investigate multiple strategies to exploit the susceptibility of lysosomes: lysosome-specific agents, alkalinizing the lysosome lumen or inducing membrane permeabilization and lysosome-dependent cell death; pharmacological inhibition of key lysosomal enzymes or autophagy to impair nutrient recycling and stress adaptation; smart nanotherapeutic agents or antibody-drug conjugates, specifically activated in the acidic lysosomal environment or utilizing lysosomal pathways for efficient intracellular drug release; and combination strategies of lysosome-targeting agents with tyrosine kinase inhibitors or immunotherapy to overcome resistance and achieve synergistic antitumor effects. In summary, our review systematically presents the role of lysosomes in HCC, from metabolic reprogramming and microenvironmental adaptation to therapeutic resistance. By synthesizing the latest mechanistic insights and preclinical advances, this review highlights the indispensable role of lysosomes in the complex HCC biological network, emphasizing that an in-depth understanding of this dynamic organelle holds great promise for developing innovative, targeted therapies, offering new hope for improving the poor prognosis of global HCC patients.
6.DIA Proteomic Profiling on Staged Regulatory Effect of Tonifying Deficiency and Dredging Collaterals Method on Liver Fibrosis in Rats Based on Theory of "Zhu Ke Jiao"
Xin WANG ; Pengyu ZHU ; Li WEN ; Jibin LIU ; Aochun YUE ; Ziyi CHEN ; Jing ZHANG ; Li ZHU ; Quansheng FENG ; Cen JIANG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(14):119-132
ObjectiveThis paper aims to investigate the differential mechanisms underlying the staged therapeutic effects of Qijia Rougan formula on liver fibrosis using proteomic technology. MethodsThe staged rat model of liver fibrosis was established by subcutaneous injection of carbon tetrachloride (CCl4) and olive oil. One hundred and four SD rats were randomized into thirteen groups:a normal group,a two-week model group,a four-week model group,a six-week model group,an eight-week model group,a two-week Qijia Rougan formula group,a four-week Qijia Rougan formula group,a six-week Qijia Rougan formula group,an eight-week Qijia Rougan formula group,a two-week compound Biejia Ruangan tablet group,a four-week Compound Biejia Ruangan Tablet group,a six-week Compound Biejia Ruangan Tablet group,and an eight-week compound Biejia Ruangan tablet group. After two weeks of drug intervention,liver tissue and abdominal aortic blood samples were collected from the rats for testing. Hematoxylin-eosin (HE) staining,Masson staining,and Picro Sirius red staining were used to observe pathological damage and collagen fiber deposition in liver tissues. Immunohistochemistry (IHC) was employed to detect the contents of fibrosis markers in liver tissues. The contents of liver function indicators in the serum were measured using a fully automated biochemical analyzer,and the levels of liver fibrosis indicators in the serum were assessed by enzyme-linked immunosorbent assay (ELISA). Liver tissues from the normal group,each model group,and each Qijia Rougan formula group were subjected to label-free quantitative proteomic analysis to identify differential proteins among the groups,with key proteins validated by Western blot. Finally,bioinformatics analysis was performed on the differential proteins. Results(1) The staged rat model of liver fibrosis constructed with CCl4 and olive oil showed pathological results at the 2nd,4th,6th,and 8th weeks of modeling that were consistent with the Metavir standards for the F1,F2,F3,and F4 stages. Compared with those in the normal control group,the protein expressions of α-smooth muscle actin (α-SMA) and Collagen Ⅰ were significantly increased in each stage (P<0.05). The levels of liver function indicators in the serum,including alanine aminotransferase (ALT),aspartate aminotransferase (AST),alkaline phosphatase (ALP),direct bilirubin (DBIL),and total bilirubin (TBil) in each model group,were significantly elevated in each stage (P<0.01). The levels of liver fibrosis indicators in the serum,including procollagen Ⅲ peptide (PⅢP),type Ⅳ collagen(Ⅳ-C),hyaluronic acid (HA),and laminin (LN) in each model group,were significantly increased in each stage (P<0.05,P<0.01). This study successfully established a staged rat model of liver fibrosis. (2) Compared with the model groups at each stage,the administration groups showed a reduction in hepatocyte ballooning degeneration,a more orderly arrangement of hepatocytes,and a decrease of inflammatory cell infiltration. The blue-stained collagen fibers became significantly thinner and finer,with reduced and narrowed fibrous septa. The areas of collagen fibers and Picro Sirius red staining were reduced (P<0.05). The positive areas of α-SMA and Collagen Ⅰ expression were significantly decreased (P<0.05). The levels of ALT,AST,ALP,DBIL,and TBil in the rats of the model groups at each stage were significantly reduced (P<0.05,P<0.01). The levels of PⅢP,Ⅳ-C,HA,and LN in the rats of the model groups at each stage were significantly decreased (P<0.05). Among these,the improvements in all indicators were most significant in the F3 stage (P<0.01).(3) The proteomic results show that a total of 165 differential proteins exhibit a callback trend when comparing the model groups at four stages with the normal group,and when comparing the Qijia Rougan formula group with the model group. Western blot analysis reveals that the levels of NAD(P)H:quinone oxidoreductase 1 (NQO1),mitogen-activated protein kinase 1 (MAPK1),arginase 1 (Arg1),and glutathione S-transferase α1 (GSTA1) were consistent with the proteomic results. Bioinformatics results reveal that 165 differentially expressed proteins are enriched in multiple signaling pathways. Notably,signaling pathways such as drug metabolism-cytochrome P450,arginine biosynthesis,and the peroxisome proliferator-activated receptor (PPAR) signaling pathway were found to be closely associated with liver fibrosis,suggesting that the Qijia Rougan formula may exert its staged regulatory effects on liver fibrosis by regulating these pathways. ConclusionThe Qijia Rougan formula may achieve staged regulation of liver fibrosis by regulating drug metabolism-cytochrome P450,arginine biosynthesis,and the PPAR signaling pathway.
7.The constituent elements, experiences, and popularization significance of the palliative care model of integrated elderly care and medical services
Zehuan HUANG ; Mengdong XIN ; Lidan QI ; Long ZHAO ; Minyu WANG ; Lu QIN ; Zhenhua LU ; Zhao LI ; Yue HE ; Xi ZENG
Chinese Medical Ethics 2025;38(7):914-923
Under the trend of increasing aging, integrated elderly care and medical services is an important measure to optimize the supply of elderly care services and promote the good death of the elderly. Using the cooperative production theory and the classical grounded theory, a qualitative analysis was conducted on 38 cases of elderly palliative care and 25 cases of hospital-based palliative care under the integrated elderly care and medical services model from a hospital in Nanning City using Nvivo 20.0 software. This paper found that the integrated elderly care and medical services mode emphasized the deep integration of medical and elderly care services by integrating resources and improving service efficiency, to achieve the basic experience of comprehensive health care for the elderly. The promotion of these experiences has a positive significance for building a multi-agent cooperative production system, strengthening personnel training, perfecting the performance distribution mechanism, and further promoting the development of the national palliative care pilot.
8.Exploring Mechanism of Hei Xiaoyaosan Regulating PI3K/Akt Pathway to Improve Learning and Memory Ability of Insomnia Rats with Liver Depression Syndrome Based on Transcriptomics
Jiamin LIU ; Yale WANG ; Hai HUANG ; Yue LI ; Xin FAN ; Pengpeng LIANG ; Shizhao ZHANG ; Mei YAN ; Guiyun LI ; Hongyan WU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(16):114-125
ObjectiveBased on transcriptomics, to explore the mechanism of Hei Xiaoyaosan regulating the phosphatidylinositol 3-kinase/protein kinase B (PI3K/Akt) signaling pathway to improve the learning and memory ability of insomnia rats with liver depression syndrome. MethodsSixty 8-week-old male SD rats were randomly divided into the blank group, model group, eszopiclone group (0.09 mg·kg-1), and low, medium, and high dose groups of Hei Xiaoyaosan (3.82, 7.65, 15.30 g·kg-1), with ten rats in each group. Except for the blank group, the other groups were induced insomnia rat model with liver depression by chronic restraint, tail clamping stimulation and intraperitoneal injection of p-chlorophenylalanine (PCPA). Each treatment group received intragastric administration according to the specified dosage, once a day for 14 consecutive days. The pentobarbital sodium cooperative sleep test, open field test, and Morris water maze test were used to test the sleep quality, depressive-like behavior, and learning and memory abilities of rats. Additionally, enzyme-linked immunosorbent assay (ELISA) was used to detect the contents of 5-hydroxytryptamine (5-HT), γ-aminobutyric acid (GABA), brain-derived neurotrophic factor (BDNF), glial cell line-derived neurotrophic factor (GDNF) and nitric oxide (NO) in hippocampus. Hematoxylin-eosin (HE) staining was performed to observe pathological changes of the hippocampal tissue, while terminal deoxynucleotidyl transferase deoxyuridine triphosphate (dUTP) nick end labeling (TUNEL) was used to evaluate apoptosis of hippocampal neurons. Transcriptomic sequencing technology was employed to identify differentially expressed genes in hippocampus between the model group and the blank group, as well as between the medium-dose group of Hei Xiaoyaosan and the model group. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis were performed on the intersecting genes. Subsequently, the enriched key genes and signaling pathways were analyzed and verified. Real-time fluorescence quantitative polymerase chain reaction (Real-time PCR) was utilized to assess the mRNA expression levels of phosphatase and tensin homolog (PTEN), B-cell lymphoma-2 (Bcl-2)-like protein 11 (BCL2L11), and mitogen-activated protein kinase 1 (MAPK1) in hippocampus, and Western blot was employed to evaluate the protein expressions of PI3K, phosphorylation (p)-PI3K, Akt, p-Akt, Bcl-2, Bcl-2-associated X protein (Bax), and cleaved Caspase-3 in the same tissue. ResultsCompared with the blank group, the model group exhibited a reduction in body weight, an increase in sleep latency, and a decrease in sleep duration (P<0.01). Additionally, rats showed obvious depression-like behavior, and their learning and memory abilities decreased. Furthermore, the contents of 5-HT, GABA, NO, BDNF and GDNF in hippocampus decreased (P<0.01). Histological examination revealed a disorganized cell arrangement in the CA1 region of the hippocampus, characterized by irregular cell shapes, a reduced cell count, deeply stained and pyknotic nuclei, increased vacuolar degeneration, and an elevated apoptosis rate (P<0.01). Compared with the model group, the body weight of the high and medium dose groups of Hei Xiaoyaosan increased, the sleep latency shortened and the sleep time prolonged (P<0.05, P<0.01). Additionally, depression-like behavior and learning and memory abilities of rats were significantly improved, the levels of 5-HT, GABA, NO, BDNF and GDNF in the hippocampus increased (P<0.05, P<0.01). These interventions also ameliorated pathological damage in the hippocampal CA1 area and reduced the apoptosis of hippocampal neurons (P<0.01). Transcriptomic sequencing results indicated that Hei Xiaoyaosan might exert a therapeutic effect by regulating PI3K/Akt pathway through key mRNAs such as PTEN, BCL2L11, and MAPK1. The roles of these key mRNAs and proteins within PI3K/Akt pathway were further validated. In comparison to the blank group, the expression levels of PTEN, BCL2L11 and MAPK1 mRNA in the hippocampus of rats in the model group were increased (P<0.01), while the protein expression levels of p-PI3K, p-Akt and Bcl-2 were decreased (P<0.01), and the protein expression levels of PTEN, Bax and cleaved Caspase-3 were increased (P<0.01). Compared with the model group, the high-dose and medium-dose groups of Hei Xiaoyaosan could down-regulate the expressions of PTEN, BCL2L11 and MAPK1 mRNAs (P<0.01), up-regulate the expressions of p-PI3K, p-Akt and Bcl-2 proteins (P<0.01), and down-regulate the protein expressions of PTEN, Bax and cleaved Caspase-3 (P<0.05, P<0.01). ConclusionHei Xiaoyaosan may regulate PI3K/Akt signaling pathway by down-regulating expressions of key genes such as PTEN, BCL2L11 and MAPK1, and thus improve the learning and memory abilities of insomnia rats with liver depression syndrome.
9.Mechanism of Shenqi guben formula in improving cancer-related fatigue by regulating IL-17 signaling pathway
Xin LI ; Chongkai FANG ; Yue HUANG ; Yaoxuan LI ; Haifu HUANG ; Xianlin WU ; Zhesheng CHEN ; Meng LI
China Pharmacy 2025;36(14):1722-1729
OBJECTIVE To explore the mechanism of Shenqi guben formula (SQGB) in improving cancer-related fatigue (CRF) based on network pharmacology and cellular experiments. METHODS Active components of SQGB and CRF-related targets were identified on the basis of databases such as the Traditional Chinese Medicine Systems Pharmacology platform. An in vitro CRF cell model was established by inducing A549 cells with interleukin-17 (IL-17). Cells were treated with low (1.0 mg/mL) or high (1.5 mg/mL) concentrations of SQGB. The effects on cell viability, migration, apoptosis, inflammatory factors, mRNA expression, apoptosis-related proteins and key proteins 011) of IL-17 signaling pathway were evaluated using scratch assay, flow cytometry, ELISA, real-time fluorescent quantitative PCR and Western blot analysis. RESULTS SQGB contained 84 active components acting on 209 potential CRF targets. Among E-these, quercetin, kaempferol, and luteolin were identified as the core components of the compound. Core targets included tumor protein p53, AKT serine/threonine kinase 1, IL-6, and tumor necrosis factor (TNF). IL-17, TNF and phosphatidylinositol-3- kinase-serine/threonine protein kinase (PI3K/Akt) signaling pathways were identified as crucial pathways. Compared with IL-17 intervention group, the cell migration rate, B-cell lymphoma 2 (Bcl-2) protein expression, the levels of IL-6 and TNF-α in the supernatant, mRNA expression of IL-17 receptor A (IL-17RA), TNF-α, and IL-6, as well as the protein expression of IL-17RA and nuclear factor kappa-B p65 subunit (p65), and phosphorylated (p)-p65/p65 ratio in IL-17+SQGB low- and high- quality concentration groups were all significantly decreased or down-regulation (P<0.05); the apoptosis rate, expression levels of Bcl-2 associated X protein (Bax) and cleaved caspase-3 protein, the ratio of Bax/Bcl-2, the expression level of p-p38 protein, and the p- p38/p38 ratio were all significantly increased or up-regulated (P<0.05). Moreover, the improvement effects of these indicators were mostly better in the high-quality concentration groups compared to the low-quality concentration groups (P<0.05). CONCLUSIONS SQGB ameliorates CRF by regulating the IL-17 signaling pathway, inhibiting the expression of inflammatory factors, and activating p38 MAPK-dependent apoptosis pathway.
10.Analysis of pollution of PM 2.5 in children s bedrooms caused by using solid fuels and the influencing factors
ZHENG Ping, SHI Chunli, XIN Shuzhi, CHEN Shunqiang, SHEN Yue, ZHANG Bei, XU Ning, WANG Qiang
Chinese Journal of School Health 2025;46(7):932-936
Objective:
To investigate the indoor fine particulate matter (PM 2.5 ) pollution and its influencing factors in children s bedrooms using solid fuel, so as to provide evidence for effective strategy to reduce PM 2.5 pollution.
Methods:
From December 2019 to November 2020, 198 households (108 in the north, 90 in the south) from two pilots in the north(Jiamusi in Heilongjiang Province) and south of China (Mianyang in Sichuan Province) were selected, and status of solid fuels using were obtained through home visits, dynamic changes in PM 2.5 concentrations in children s bedrooms were monitored by using real time online instruments, and the influencing factors of PM 2.5 pollution were analyzed by using a mixed effects model.
Results:
During the monitoring period, the daily PM 2.5 concentrations in the northern and southern pilot were 78.33 (40.50, 154.80) and 38.54(26.20, 58.46) μg/m 3, respectively, exceeding standard rates of 44.57% and 33.22%. During the heating period, the daily PM 2.5 concentrations in the northern and southern pilot were 212.50(133.60,244.10) and 104.42(73.97, 134.90) μg/m 3, respectively, with over standard rates of 96.75% and 86.96%. The mixed effects model analysis results showed that children s bedroom PM 2.5 concentrations were associated with solid fuel usage duration, window opening time, room layout (shared entrance door between kitchen and bedroom), indoor smoking, indoor humidity, and solid fuel use in the bedroom ( β =0.19, -0.05, 1.20, 0.43, 0.02, 0.35, all P <0.05).
Conclusion
Solid fuel combustion significantly comtributes to PM 2.5 pollution in children s bedrooms, with more pronounced impacts observed in northern China compared to southern regions.


Result Analysis
Print
Save
E-mail