ObjectiveTo investigate the potential mechanism of Danggui Buxuetang （DBT） in the treatment of vascular dementia （VAD）. MethodsSixty male SD rats were randomly assigned to the sham-operated group， model group， DBT low-， medium-， and high-dose groups， and the donepezil group. Except for the sham-operated group， rats in all other groups underwent bilateral common carotid artery ligation. After successful modeling， DBT was administered at doses of 9.2， 18.4， 36.8 g·kg^-1 for the low-， medium-， and high-dose groups， respectively， while the donepezil group received 3 mg·kg^-1 donepezil solution by gavage once daily. After 4 consecutive weeks of drug treatment， rats underwent the Morris water maze test， novel object recognition test， Nissl staining to observe hippocampal neurons， and immunofluorescence staining to detect the expression of neuronal nuclear protein （NeuN） in the hippocampus. Western blot was used to assess the expression of PTEN-induced kinase 1 （PINK1）， Parkin， microtubule-associated protein 1 light chain 3Ⅱ （LC3Ⅱ）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax）. Transmission electron microscopy was used to observe hippocampal neuronal ultrastructure. Real-time PCR was used to detect the expression of NADPH oxidase subunits p22^phox and p47^phox in hippocampal tissues. The levels of malondialdehyde （MDA）， glutathione （GSH）， superoxide dismutase （SOD）， and total antioxidant capacity were measured to evaluate oxidative stress levels. ResultsIn the Morris water maze test， escape latency changed significantly over time in all groups except the model group. Compared with the sham-operated group， the model group showed significantly prolonged escape latency （P<0.01）. Compared with the model group， rats in the DBT groups and the donepezil group exhibited significantly shorter escape latency （P<0.05， P<0.01）. The number of crossings over the original platform was significantly reduced in the model group compared with the sham-operated group （P<0.01）， whereas rats in the DBT and donepezil groups showed significantly increased platform crossings compared with the model group （P<0.05， P<0.01）. Compared with the sham-operated group， exploration time of new objects was significantly reduced in the model group （P<0.01）. Compared with the model group， exploration time of new objects increased significantly in the medium- and high-dose DBT groups and the donepezil group （P<0.05， P<0.01）， while no significant change was observed in the low-dose DBT group. Compared with the high-dose DBT group， rats in the donepezil group had significantly prolonged escape latency and reduced platform crossings and new-object exploration time （P<0.05）. Nissl staining showed decreased density of healthy neurons in the CA1 and CA3 regions of the hippocampus in the model group， with loss of Nissl bodies and nuclear atrophy or disappearance. In the high-dose DBT group， neuronal density in CA1 and CA3 increased， with neurons arranged closely and displaying normal morphology. Immunofluorescence showed that compared with the sham-operated group， the hippocampal NeuN⁺ cell count in the VAD model group was significantly decreased（P<0.01）， compared with the VAD model group， the hippocampal NeuN⁺ cell count in the high-dose DBT group was significantly increased（P<0.01）. Compared with the sham-operated group， the expression of PINK1， Parkin， LC3Ⅱ， and Bax proteins was significantly increased（P<0.01）， while the expression of Bcl-2 was significantly decreased in the VAD model group（P<0.01）. Compared with the VAD model group， the high-dose DBT group showed significantly decreased expression of PINK1， Parkin， LC3Ⅱ， and Bax proteins（P<0.01）and significantly upregulated Bcl-2 expression（P<0.01）. The medium-dose DBT group exhibited significantly reduced expression of Parkin， LC3Ⅱ， and Bax proteins（P<0.05，P<0.01） and significantly increased Bcl-2 expression（P<0.01）， while no statistically significant differences were observed in the low-dose DBT group. Transmission electron microscopy showed mitochondrial pyknosis， thickened cristae， increased electron density， and the presence of mitochondrial autophagy in the model group. In contrast， hippocampal neurons in the high-dose DBT group contained abundant mitochondria with intact morphology， clear cristae， and uniform matrix. Compared with the sham-operated group， total antioxidant capacity， SOD activity， and GSH levels were significantly decreased， while MDA levels were significantly increased in the model group （P<0.01）. Compared with the model group， total antioxidant capacity and antioxidant levels （SOD， GSH） increased significantly， and MDA decreased significantly in the medium- and high-dose DBT groups （P<0.01）， while no significant changes were observed in the low-dose DBT group. Compared with the sham-operated group， mRNA expression of p22^phox and p47^phox was significantly increased in the model group （P<0.01）. Compared with the model group， expression of p22^phox and p47^phox was significantly decreased in the DBT groups （P<0.05， P<0.01）. ConclusionDBT may exert neuroprotective effects by regulating PINK1/Parkin-mediated mitochondrial autophagy， thereby improving learning and memory abilities and treating VAD.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Stroke is one of the leading causes of disability and mortality worldwide. Research into its mechanisms and the development of therapeutic strategies heavily rely on animal models that accurately replicate the pathological features of human disease. An ideal animal model for stroke should not only reproduce the neurological deficits and pathological changes observed in clinical patients but also demonstrate good reproducibility and translational value. This review focuses on the preparation and evaluation methods of ischemic stroke animal models. Firstly, it elaborates on the selection criteria, advantages, and disadvantages of experimental animals, including rodents (rats, mice) and non-rodents (non-human primates, miniature pigs, rabbits, zebrafish). Secondly, it provides a detailed overview of the modeling principles, key procedures, and application scopes for ischemic stroke models and hemorrhagic stroke models. Furthermore, the review summarizes advances in the applications of emerging technologies—including gene editing [e.g., clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing], multimodal imaging (e.g., two-photon microscopy, photoacoustic imaging), artificial intelligence, optogenetics, 3D bioprinting, organoid models, and multi-omics–in model optimization, precise assessment, and mechanistic investigation. Finally, based on a systematic analysis of relevant domestic and international literature from 2019 to 2024, this review discusses model selection strategies based on research objectives, a multidimensional evaluation system encompassing behavioral, imaging, and molecular pathological assessments, and envisions future directions involving technological integration to achieve model precision and individualization. This article aims to provide a comprehensive methodological reference to help researchers select appropriate animal models of stroke according to specific scientific questions.

Stroke is the leading cause of death and disability among adults in China， and its common complications include digestive system abnormalities， cognitive impairment， depression， stroke-associated pneumonia， and hemiplegia. The combination of traditional Chinese and Western medicine has great potential in treating post-stroke complications. Xinglou Chengqitang （XLCQT） is a representative prescription of alleviating the disease in the upper part by treating the lower part. It has definite therapeutic effect and high safety. Clinically， XLCQT is often used to treat stroke and its complications. However， the quantity and quality of clinical trials of XLCQT in treating post-stroke complications need to be improved. Additionally， since the basic research is weak， the material basis and multi-target mechanism for the efficacy of this prescription are unknown. This article reviews XLCQT in terms of the pharmacodynamic basis， medicinal properties， safety evaluation， and progress in clinical research and mechanisms in treating post-stroke complications. This article summarizes 22 key active ingredients of XLCQT in treating acute stroke complicated with syndrome of phlegm heat and fu-organ excess. Among these key active ingredients， resveratrol， kaempferol， luteolin， chrysoeriol， apigenin， （+）-catechin， and adenosine have good pharmacokinetic properties and high bioavailability. The mechanisms of XLCQT in treating post-stroke complications are complex， including inflammatory response， brain-gut axis， hypothalamic-pituitary-adrenal （HPA） axis， intestinal flora， neurotrophic factors， autophagy， oxidative stress， and free radical damage. This review helps to deeply understand the pharmacodynamic basis and mechanisms of XLCQT in treating post-stroke complications and provides a theoretical basis for the clinical application of XLCQT against post-stroke complications and the development of drugs.

Objective: This study aimed to compare the long-term radiographic incidence of adjacent segment degeneration (ASD) following minimally invasive transforaminal lumbar interbody fusion (MIS-TLIF) versus open TLIF (O-TLIF) in a matched cohort, and to identify radiographic parameters associated with the development of kyphosis-type ASD. Methods: A retrospective matched-pair analysis was conducted involving 60 patients (30 MIS-TLIF and 30 O-TLIF) who underwent single-level TLIF between 2004 and 2009 and had a minimum follow-up of 8 years. Patients were matched for age (±3 years), sex, body mass index (±2 kg/m²), and operative level. Radiographic ASD was defined as greater than 50% disc-height loss, greater than 3 mm of listhesis, or greater than 10° of kyphotic change at the adjacent segment. Continuous variables were analyzed using independent-sample t-tests or Mann-Whitney U-tests, as appropriate, and categorical variables were analyzed using chi-square or Fisher exact tests, with statistical significance set at p<0.05. Results: The mean follow-up duration was 8.9±1.2 years. The MIS-TLIF group had a significantly shorter hospital stay than the O-TLIF group (3.4±1.7 days vs 6.0±2.3 days, p<0.001). Radiographic ASD occurred significantly less frequently in the MIS-TLIF group at 2 years (3.3% vs. 23.3%, p=0.023), but no significant difference was observed at ≥8 years of follow-up (43.3% vs. 50.0%, p=0.605). An increased Cobb angle at the superior adjacent level was significantly associated with kyphosis-type ASD (p=0.017). No demographic characteristics or preoperative magnetic resonance imaging parameters were found to predict ASD occurrence. Conclusion MIS-TLIF demonstrated an early radiographic advantage in reducing ASD compared with O-TLIF; however, this advantage diminished over time. Long-term ASD appears to be multifactorial, with sagittal imbalance playing a more prominent role in the progression of kyphosis-type ASD than the surgical approach itself.

Introduction: Hypertension is common in obesity and increases cardiovascular risk. Bariatric surgery improves metabolic health, but subgroup differences in blood pressure response remain unclear. This study examined 1-year changes in systolic blood pressure (SBP) and diastolic blood pressure (DBP) after bariatric surgery across sex, age group, and diabetes status. Methodology: This study included 32 obese adults undergoing bariatric surgery, with blood pressure measured at baseline, 6 and 12 months. Generalized estimating equation models were used to evaluate changes in SBP and DBP over time, adjusting for age, sex, surgery type, diabetes category, baseline body mass index, antihypertensive medication use, and baseline blood pressure. Interaction terms were tested to assess differences in blood pressure trajectories across subgroups. Results: Participants were predominantly female (67.4%), with a mean age of 36.9 ± 6.2 years and a mean body mass index of 40.7 ± 8.8 kg/m². Hypertension and diabetes were present in 40.6 and 31.3% of participants, respectively. There was a significant time effect for both SBP (p <0.001) and DBP (p = 0.004). At 12 months post-surgery, mean SBP decreased by 15 mmHg and DBP by 7.9 mmHg compared with baseline (both p <0.001). No significant interactions were observed between time and sex, diabetes category, or age category, indicating that blood pressure improvements were comparable across subgroups. Conclusion Bariatric surgery was associated with clinically meaningful reductions in both SBP and DBP, with similar improvement patterns observed across demographic and metabolic subgroups. These findings support the effectiveness of bariatric surgery as a strategy for blood pressure reduction and cardiovascular risk management in patients with obesity.
Blood Pressure ; Bariatric Surgery

Objective: To evaluate the clinical efficacy and safety of injectable platelet-rich fibrin (i-PRF) in the treatment of mild to moderate female pattern hair loss (FPHL), and to analyze the related clinical factors affecting the therapeutic efficacy of i-PRF. Methods: This was a secondary analysis of a prospective, randomized controlled trial. A total of 29 FPHL patients with Sinclair grade Ⅱ-Ⅲ, who attended the outpatient clinics of Beijing Friendship Hospital, Capital Medical University and Peking University Third Hospital from March 2024 to April 2025, were enrolled. All patients received i-PRF treatment once every 4 weeks for a total of 4 sessions, with follow-up up to 24 weeks. Standardized clinical photographs were taken at baseline, week 12 and week 24. Trichoscopic examination was performed to measure the non-vellus target area hair count (TAHC) and hair diameter (HD) in the target area, and all adverse events were recorded. The Mann-Whitney U test was used to compare the intergroup differences in efficacy for categorical influencing factors; Spearman rank correlation analysis was employed to assess the correlation between continuous influencing factors and efficacy; and multiple linear regression (enter method) was performed to identify independent influencing factors of efficacy. Results: A total of 27 patients completed the trial. At week 12, TAHC significantly increased from 112 (105, 120) hairs/cm at baseline to 128 (110, 150) hairs/cm , with a median increase of 12 (5, 28) hairs/cm and a median growth rate of 10.5 (4.2, 24.5)% (P=0.045); hair diameter significantly increased from 42.5 (39.8, 45.2) μm to 52.0 (47.0, 58.0) μm, with a median increase of 7.5 (3.0, 12.5) μm and a median growth rate of 18.0 (7.5, 29.0)% (P<0.001). At week 24, TAHC further significantly increased to 141 (125, 158) hairs/cm (P<0.001), with a median growth rate of 24.8 (18.5, 32.0)%; hair diameter continued to improve to 55.0 (50.0, 61.0) μm (P=0.008), with a median growth rate of 21.5 (16.0, 27.0)%. The overall incidence of adverse events was 10.34% (3/29), mainly presenting as mild scalp pruritus and transient headache, without severe adverse effects. Multiple linear regression analysis revealed that baseline TAHC was an independent influencing factor for i-PRF efficacy (P<0.05), while age, BMI, disease duration, Sinclair grade, family history of AGA, and baseline HD showed no significant independent effect on efficacy in this model (P>0.05). Conclusion: This preliminary study indicates that i-PRF can improve hair density and hair shaft diameter in patients with FPHL with a favorable safety profile. Patients with FPHL and lower baseline TAHC may achieve greater clinical improvement.

Attention is the cornerstone of effective functioning in a complex and information-rich world. While the neural activity of attention has been extensively studied in the cortex, the brain-wide neural activity patterns are largely unknown. In this study, we conducted a comprehensive analysis of neural activity across the mouse brain during attentional processing using EEG and c-Fos staining, utilizing hierarchical clustering and c-Fos-based functional network analysis to evaluate the c-Fos activation patterns. Our findings reveal that a wide range of brain regions are activated, notably in the high-order cortex, thalamus, and brain stem regions involved in advanced cognition and arousal regulation, with the central lateral nucleus of the thalamus as a strong hub, suggesting the crucial role of the thalamus in attention control. These results provide valuable insights into the neural network mechanisms underlying attention, offering a foundation for formulating functional hypotheses and conducting circuit-level testing.
Animals ; Attention/physiology* ; Mice ; Brain/physiology* ; Male ; Electroencephalography ; Reaction Time/physiology* ; Brain Mapping ; Mice, Inbred C57BL ; Choice Behavior/physiology* ; Proto-Oncogene Proteins c-fos/metabolism*

To investigate the mechanism of Jianpi Qutan Formula in regulating the balance between classically activated macrophages(M1) and alternatively activated macrophages(M2) in atherosclerotic plaques through phosphorylation and activation of the signal transducer and activator of transcription 6(STAT6), thereby reducing inflammation, increasing plaque stability, and exerting anti-atherosclerosis(AS) effects. An AS model was established by feeding apolipoprotein E(ApoE)~(-/-) mice with atherosclerotic chow for 8 weeks. The ApoE~(-/-) mice were randomly divided into a model group(Mod group), a Jianpi Qutan Formula group(JPQT group, 8.97 g·kg~(-1)), and a Atorvastatin Calcium Tablets group(ATO group, 1.3 mg·kg~(-1)) according to a random table method, with 10 mice in each group. Additionally, 10 male C57BL/6J mice of the same age, fed with a normal diet, were set as the control group(Con group). The JPQT and ATO groups received their respective treatments via oral gavage for 8 consecutive weeks, while the Con and Mod groups were administered an equivalent volume of saline. Body weight was continuously monitored, and after blood collection, total cholesterol(TC) and triglyceride(TG) levels in the serum of each group were compared. Hematoxylin-eosin(HE) staining and oil red O staining were used to observe plaque formation in aortic tissue. Enzyme-linked immunosorbent assay(ELISA) was employed to detect the expression levels of pro-inflammatory cytokines interleukin(IL)-6 and IL-12, as well as the anti-inflammatory cytokine IL-10. Immunofluorescence was used to detect the positive expression of aortic cluster of differentiation(CD)86 and CD206. Western blot analysis was conducted to detect the protein expression levels of aortic inducible nitric oxide synthase(iNOS), arginase 1(Arg1), STAT6, and p-STAT6. Compared to the Con group, the Mod group exhibited increased body weight and blood lipid levels, disordered aortic structure, significant AS plaque formation accompanied by extensive lipid deposition, and elevated serum levels of pro-inflammatory cytokines IL-6 and IL-12, as well as elevated CD86 and iNOS protein levels. In contrast, the serum levels of the anti-inflammatory cytokine IL-10, along with the protein expression levels of CD206, Arg1, and p-STAT6/STAT6, were reduced. Compared to the Mod group, the drug intervention groups showed improvements in body weight and lipid metabolism, with a more significant improvement in aortic structure, reduced lipid accumulation, decreased serum levels of IL-6 and IL-12, and lower CD86 and iNOS protein levels. Meanwhile, levels of IL-10, CD206, Arg1, and p-STAT6/STAT6 increased. Jianpi Qutan Formula improves AS by regulating the imbalance in M1/M2 macrophage polarization, and its mechanism is likely closely related to the activation of the STAT6 signaling pathway.
Animals ; Atherosclerosis/metabolism* ; Male ; Drugs, Chinese Herbal/administration & dosage* ; Mice ; Macrophages/cytology* ; Mice, Inbred C57BL ; STAT6 Transcription Factor/immunology* ; Humans ; Apolipoproteins E/genetics* ; Interleukin-6/immunology*

BACKGROUND: Atrial fibrillation (AF) is a common cardiac arrhythmia in the elderly. This study aimed to evaluate urban-rural disparities in its prevalence and management in elderly Chinese. METHODS: Consecutive participants aged ≥ 65 years attending outpatient clinics were enrolled for AF screening using handheld single-lead electrocardiogram (ECG) from April 2017 to December 2022. Each ECG rhythm strip was reviewed from the research team. AF or uninterpretable single-lead ECGs were referred for 12-lead ECG. Primary study outcome comparison was between rural and urban areas for the prevalence of AF. The Student's t-test was used to compare mean values of clinical characteristics between rural and urban participants, while the Pearson's chi-square test was used to compare between-group proportions. Multivariate stepwise logistic regression analysis was performed to estimate the association between AF and various patient characteristics. RESULTS: The 29,166 study participants included 13,253 men (45.4%) and had a mean age of 72.2 years. The 7073 rural participants differed significantly (P ≤ 0.02) from the 22,093 urban participants in several major characteristics, such as older age, greater body mass index, and so on. The overall prevalence of AF was 4.6% (n = 1347). AF was more prevalent in 7073 rural participants than 22,093 urban participants (5.6% vs. 4.3%, P < 0.01), before and after adjustment for age, body mass index, blood pressure, pulse rate, cigarette smoking, alcohol consumption and prior medical history. Multivariate logistic regression analysis identified overweight/obesity (OR = 1.35, 95% CI: 1.17-1.54) in urban areas and cigarette smoking (OR = 1.62, 95% CI: 1.20-2.17) and alcohol consumption (OR = 1.42, 95% CI: 1.04-1.93) in rural areas as specific risk factors for prevalent AF. In patients with known AF in urban areas (n = 781) and rural areas (n = 338), 60.6% and 45.9%, respectively, received AF treatment (P < 0.01), and only 22.4% and 17.2%, respectively, received anticoagulation therapy (P = 0.05). CONCLUSIONS In China, there are urban-rural disparities in AF in the elderly, with a higher prevalence and worse management in rural areas than urban areas. Our study findings provide insight for health policymakers to consider urban-rural disparity in the prevention and treatment of AF.