ObjectiveTo investigate the potential mechanism of Danggui Buxuetang （DBT） in the treatment of vascular dementia （VAD）. MethodsSixty male SD rats were randomly assigned to the sham-operated group， model group， DBT low-， medium-， and high-dose groups， and the donepezil group. Except for the sham-operated group， rats in all other groups underwent bilateral common carotid artery ligation. After successful modeling， DBT was administered at doses of 9.2， 18.4， 36.8 g·kg^-1 for the low-， medium-， and high-dose groups， respectively， while the donepezil group received 3 mg·kg^-1 donepezil solution by gavage once daily. After 4 consecutive weeks of drug treatment， rats underwent the Morris water maze test， novel object recognition test， Nissl staining to observe hippocampal neurons， and immunofluorescence staining to detect the expression of neuronal nuclear protein （NeuN） in the hippocampus. Western blot was used to assess the expression of PTEN-induced kinase 1 （PINK1）， Parkin， microtubule-associated protein 1 light chain 3Ⅱ （LC3Ⅱ）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax）. Transmission electron microscopy was used to observe hippocampal neuronal ultrastructure. Real-time PCR was used to detect the expression of NADPH oxidase subunits p22^phox and p47^phox in hippocampal tissues. The levels of malondialdehyde （MDA）， glutathione （GSH）， superoxide dismutase （SOD）， and total antioxidant capacity were measured to evaluate oxidative stress levels. ResultsIn the Morris water maze test， escape latency changed significantly over time in all groups except the model group. Compared with the sham-operated group， the model group showed significantly prolonged escape latency （P<0.01）. Compared with the model group， rats in the DBT groups and the donepezil group exhibited significantly shorter escape latency （P<0.05， P<0.01）. The number of crossings over the original platform was significantly reduced in the model group compared with the sham-operated group （P<0.01）， whereas rats in the DBT and donepezil groups showed significantly increased platform crossings compared with the model group （P<0.05， P<0.01）. Compared with the sham-operated group， exploration time of new objects was significantly reduced in the model group （P<0.01）. Compared with the model group， exploration time of new objects increased significantly in the medium- and high-dose DBT groups and the donepezil group （P<0.05， P<0.01）， while no significant change was observed in the low-dose DBT group. Compared with the high-dose DBT group， rats in the donepezil group had significantly prolonged escape latency and reduced platform crossings and new-object exploration time （P<0.05）. Nissl staining showed decreased density of healthy neurons in the CA1 and CA3 regions of the hippocampus in the model group， with loss of Nissl bodies and nuclear atrophy or disappearance. In the high-dose DBT group， neuronal density in CA1 and CA3 increased， with neurons arranged closely and displaying normal morphology. Immunofluorescence showed that compared with the sham-operated group， the hippocampal NeuN⁺ cell count in the VAD model group was significantly decreased（P<0.01）， compared with the VAD model group， the hippocampal NeuN⁺ cell count in the high-dose DBT group was significantly increased（P<0.01）. Compared with the sham-operated group， the expression of PINK1， Parkin， LC3Ⅱ， and Bax proteins was significantly increased（P<0.01）， while the expression of Bcl-2 was significantly decreased in the VAD model group（P<0.01）. Compared with the VAD model group， the high-dose DBT group showed significantly decreased expression of PINK1， Parkin， LC3Ⅱ， and Bax proteins（P<0.01）and significantly upregulated Bcl-2 expression（P<0.01）. The medium-dose DBT group exhibited significantly reduced expression of Parkin， LC3Ⅱ， and Bax proteins（P<0.05，P<0.01） and significantly increased Bcl-2 expression（P<0.01）， while no statistically significant differences were observed in the low-dose DBT group. Transmission electron microscopy showed mitochondrial pyknosis， thickened cristae， increased electron density， and the presence of mitochondrial autophagy in the model group. In contrast， hippocampal neurons in the high-dose DBT group contained abundant mitochondria with intact morphology， clear cristae， and uniform matrix. Compared with the sham-operated group， total antioxidant capacity， SOD activity， and GSH levels were significantly decreased， while MDA levels were significantly increased in the model group （P<0.01）. Compared with the model group， total antioxidant capacity and antioxidant levels （SOD， GSH） increased significantly， and MDA decreased significantly in the medium- and high-dose DBT groups （P<0.01）， while no significant changes were observed in the low-dose DBT group. Compared with the sham-operated group， mRNA expression of p22^phox and p47^phox was significantly increased in the model group （P<0.01）. Compared with the model group， expression of p22^phox and p47^phox was significantly decreased in the DBT groups （P<0.05， P<0.01）. ConclusionDBT may exert neuroprotective effects by regulating PINK1/Parkin-mediated mitochondrial autophagy， thereby improving learning and memory abilities and treating VAD.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

AIM: To evaluate the repeatability and accuracy of iCare IC100 tonometer in measuring intraocular pressure(IOP)by comparing the correlation and difference with Goldmann applanation tonometry(GAT)and non-contact tonometer(NCT), and to compare the correlation of the three types of IOP measurement with the central corneal thickness(CCT).METHODS: Prospective study. A total of 90 outpatients(90 eyes)in Liaoning Aier Eye Hospital from March 2019 to May 2019 were randomly selected as study subjects. All patients were measured IOP using iCare IC100, NCT, and GAT. The interclass correlation coefficient(ICC)was used to evaluate the repeatability of IOP measured 3 times consecutively using an intraocular tonometer. The correlation and consistency of iCare IC100, GAT and NCT were compared by one-way ANOVA, Pearson linear correlation analysis and Bland-Altman analysis. The linear regression analysis was used to analyze the correlation of the three tonometers with CCT.RESULTS: The mean IOP measured with iCare IC100, GAT and NCT was 19.74±6.90, 19.88±7.07 and 18.47±6.31 mmHg, respectively(F=1.180, P=0.309). The measurements of iCare IC100 with GAT, iCare IC100 with NCT and GAT with NCT were all positively correlated(r=0.930, 0.946, 0.918, all P<0.05), the Bland-Altman analysis showed that the mean differences between iCare IC100 and GAT, iCare IC100 and NCT, GAT and NCT were -0.142±2.61, 1.27±2.24, and 1.41±2.81 mmHg, respectively, with 97%(87/90), 96%(86/90), and 97%(87/90)IOP differences distributed within their 95% confidence intervals. The IOP measured with iCare IC100 and CCT, GAT and CCT and NCT and CCT were all positively correlated(r=0.426, 0.353, 0.451, all P<0.01). The linear regression equations between iCare IC100, GAT and NCT measurement and CCT were iCare IC100 IOP=-19.62+0.074×CCT; GAT IOP=-13.54+0.063×CCT; NCT IOP=-19.65+0.072×CCT; that is, for every 10 μm increase in CCT, iCare IC100 measurement increased by 0.74 mmHg, GAT measurement increased by 0.63 mmHg, and NCT measurement increased by 0.72 mmHg.CONCLUSION: The iCare IC100 tonometer has good repeatability and accuracy in measuring IOP, and the CCT has a greater impact on the measurement of iCare IC100 than the GAT and NCT.

AIM: To evaluate the repeatability and accuracy of iCare IC100 tonometer in measuring intraocular pressure(IOP)by comparing the correlation and difference with Goldmann applanation tonometry(GAT)and non-contact tonometer(NCT), and to compare the correlation of the three types of IOP measurement with the central corneal thickness(CCT).METHODS: Prospective study. A total of 90 outpatients(90 eyes)in Liaoning Aier Eye Hospital from March 2019 to May 2019 were randomly selected as study subjects. All patients were measured IOP using iCare IC100, NCT, and GAT. The interclass correlation coefficient(ICC)was used to evaluate the repeatability of IOP measured 3 times consecutively using an intraocular tonometer. The correlation and consistency of iCare IC100, GAT and NCT were compared by one-way ANOVA, Pearson linear correlation analysis and Bland-Altman analysis. The linear regression analysis was used to analyze the correlation of the three tonometers with CCT.RESULTS: The mean IOP measured with iCare IC100, GAT and NCT was 19.74±6.90, 19.88±7.07 and 18.47±6.31 mmHg, respectively(F=1.180, P=0.309). The measurements of iCare IC100 with GAT, iCare IC100 with NCT and GAT with NCT were all positively correlated(r=0.930, 0.946, 0.918, all P<0.05), the Bland-Altman analysis showed that the mean differences between iCare IC100 and GAT, iCare IC100 and NCT, GAT and NCT were -0.142±2.61, 1.27±2.24, and 1.41±2.81 mmHg, respectively, with 97%(87/90), 96%(86/90), and 97%(87/90)IOP differences distributed within their 95% confidence intervals. The IOP measured with iCare IC100 and CCT, GAT and CCT and NCT and CCT were all positively correlated(r=0.426, 0.353, 0.451, all P<0.01). The linear regression equations between iCare IC100, GAT and NCT measurement and CCT were iCare IC100 IOP=-19.62+0.074×CCT; GAT IOP=-13.54+0.063×CCT; NCT IOP=-19.65+0.072×CCT; that is, for every 10 μm increase in CCT, iCare IC100 measurement increased by 0.74 mmHg, GAT measurement increased by 0.63 mmHg, and NCT measurement increased by 0.72 mmHg.CONCLUSION: The iCare IC100 tonometer has good repeatability and accuracy in measuring IOP, and the CCT has a greater impact on the measurement of iCare IC100 than the GAT and NCT.

The medicinal use of Malvae Semen has a long history. In this paper， by consulting the ancient materia medica， prescription， agronomy， literature and other aspects of the classics， the name， origin， evolution of scientific name， quality， harvesting and processing， functions and indications and others of Malvae Semen were systematically sorted out and verified， so as to provide a basis for the development and utilization of famous classical formulas containing this herb. According to the textual research， Shennong Bencaojing began to use Dongkuizi as the correct name， which was used in the past dynasties， and there were also aliases such as Kuicaizi， Huacai， and Kuizi. Through the original research， it can be seen that Kuicai is the mainstream original plant of Malvae Semen， that is， Malva verticillata var. crispa， the Alcea rosea and M. cathayensis are also used. In modern times， the seeds of Abutilon theophrasti have been passed off as Malvae Semen， while the seeds of M. verticillata var. crispa have rarely been used in medicine. And Abutili Semen has been another medicinal material with different efficacy since the collection of Newly Revised Materia Medica in the Tang dynasty. Since the Ming and Qing dynasties， the cultivation of Kuicai has been decreasing， while A. theophrasti is more common and easy to obtain， and Abutili Semen and Malvae Semen are similar in morphology and confused， which should be corrected. In addition， Malvae Fructus is a Mongolian customary medicinal herb， which is different from the traditional use of seeds in traditional Chinese medicine. Kuicai， as an important vegetable in history， was widely cultivated and gradually shrunk after the Song dynasty， it is now mainly produced in southern provinces. The quality evaluation of Malvae Semen is better for those with dry bodies， full grain， grayish brown color， no mud， and no impurities. The harvesting is generally in the autumn and winter. After drying， it is seeded， sieved peel and impurities， mashed， or slightly stir-fried to yellow-white color with gentle fire. It is sweet， cold and slippery in nature and taste， with the main effects of laxation， diuresis， lactation and elimination of swelling. The efficacy of Abutili Semen is clearing heat and removing toxicity， promoting diuresis and removing nebula， the efficacy is quite different from that of Malvae Semen. Based on the results of textual research， it is suggested that M. verticillata var. crispa should be used as the medicinal source of Malvae Semen in the development of famous classical formulas， the corresponding processing methods should be selected according to the requirements of drug processing in the formulas， while the raw products are recommended to be used if the processing is not specified.

The medicinal use of Malvae Semen has a long history. In this paper， by consulting the ancient materia medica， prescription， agronomy， literature and other aspects of the classics， the name， origin， evolution of scientific name， quality， harvesting and processing， functions and indications and others of Malvae Semen were systematically sorted out and verified， so as to provide a basis for the development and utilization of famous classical formulas containing this herb. According to the textual research， Shennong Bencaojing began to use Dongkuizi as the correct name， which was used in the past dynasties， and there were also aliases such as Kuicaizi， Huacai， and Kuizi. Through the original research， it can be seen that Kuicai is the mainstream original plant of Malvae Semen， that is， Malva verticillata var. crispa， the Alcea rosea and M. cathayensis are also used. In modern times， the seeds of Abutilon theophrasti have been passed off as Malvae Semen， while the seeds of M. verticillata var. crispa have rarely been used in medicine. And Abutili Semen has been another medicinal material with different efficacy since the collection of Newly Revised Materia Medica in the Tang dynasty. Since the Ming and Qing dynasties， the cultivation of Kuicai has been decreasing， while A. theophrasti is more common and easy to obtain， and Abutili Semen and Malvae Semen are similar in morphology and confused， which should be corrected. In addition， Malvae Fructus is a Mongolian customary medicinal herb， which is different from the traditional use of seeds in traditional Chinese medicine. Kuicai， as an important vegetable in history， was widely cultivated and gradually shrunk after the Song dynasty， it is now mainly produced in southern provinces. The quality evaluation of Malvae Semen is better for those with dry bodies， full grain， grayish brown color， no mud， and no impurities. The harvesting is generally in the autumn and winter. After drying， it is seeded， sieved peel and impurities， mashed， or slightly stir-fried to yellow-white color with gentle fire. It is sweet， cold and slippery in nature and taste， with the main effects of laxation， diuresis， lactation and elimination of swelling. The efficacy of Abutili Semen is clearing heat and removing toxicity， promoting diuresis and removing nebula， the efficacy is quite different from that of Malvae Semen. Based on the results of textual research， it is suggested that M. verticillata var. crispa should be used as the medicinal source of Malvae Semen in the development of famous classical formulas， the corresponding processing methods should be selected according to the requirements of drug processing in the formulas， while the raw products are recommended to be used if the processing is not specified.

The innate immune system can be boosted in response to subsequent triggers by pre-exposure to microbes or microbial products, known as “trained immunity”. Compared to classical immune memory, innate trained immunity has several different features. Firstly, the molecules involved in trained immunity differ from those involved in classical immune memory. Innate trained immunity mainly involves innate immune cells (e.g., myeloid immune cells, natural killer cells, innate lymphoid cells) and their effector molecules (e.g., pattern recognition receptor (PRR), various cytokines), as well as some kinds of non-immune cells (e.g., microglial cells). Secondly, the increased responsiveness to secondary stimuli during innate trained immunity is not specific to a particular pathogen, but influences epigenetic reprogramming in the cell through signaling pathways, leading to the sustained changes in genes transcriptional process, which ultimately affects cellular physiology without permanent genetic changes (e.g., mutations or recombination). Finally, innate trained immunity relies on an altered functional state of innate immune cells that could persist for weeks to months after initial stimulus removal. An appropriate inducer could induce trained immunity in innate lymphocytes, such as exogenous stimulants (including vaccines) and endogenous stimulants, which was firstly discovered in bone marrow derived immune cells. However, mature bone marrow derived immune cells are short-lived cells, that may not be able to transmit memory phenotypes to their offspring and provide long-term protection. Therefore, trained immunity is more likely to be relied on long-lived cells, such as epithelial stem cells, mesenchymal stromal cells and non-immune cells such as fibroblasts. Epigenetic reprogramming is one of the key molecular mechanisms that induces trained immunity, including DNA modifications, non-coding RNAs, histone modifications and chromatin remodeling. In addition to epigenetic reprogramming, different cellular metabolic pathways are involved in the regulation of innate trained immunity, including aerobic glycolysis, glutamine catabolism, cholesterol metabolism and fatty acid synthesis, through a series of intracellular cascade responses triggered by the recognition of PRR specific ligands. In the view of evolutionary, trained immunity is beneficial in enhancing protection against secondary infections with an induction in the evolutionary protective process against infections. Therefore, innate trained immunity plays an important role in therapy against diseases such as tumors and infections, which has signature therapeutic effects in these diseases. In organ transplantation, trained immunity has been associated with acute rejection, which prolongs the survival of allografts. However, trained immunity is not always protective but pathological in some cases, and dysregulated trained immunity contributes to the development of inflammatory and autoimmune diseases. Trained immunity provides a novel form of immune memory, but when inappropriately activated, may lead to an attack on tissues, causing autoinflammation. In autoimmune diseases such as rheumatoid arthritis and atherosclerosis, trained immunity may lead to enhance inflammation and tissue lesion in diseased regions. In Alzheimer’s disease and Parkinson’s disease, trained immunity may lead to over-activation of microglial cells, triggering neuroinflammation even nerve injury. This paper summarizes the basis and mechanisms of innate trained immunity, including the different cell types involved, the impacts on diseases and the effects as a therapeutic strategy to provide novel ideas for different diseases.

OBJECTIVE To systematically evaluate the efficacy of dydrogesterone combined with estradiol valerate for the prevention of intrauterine adhesion （IUA） and prognosis improvement after induced abortion. METHODS Retrieved from CNKI， Wanfang Data， VIP， CBM， PubMed， Embase and the Cochrane Library， randomized controlled trial （RCT） about conventional treatment combined with dydrogesterone and estradiol valerate （trial group） versus conventional treatment （control group） for the prevention of IUA in patients after induced abortion were collected from the inception to Dec. 2024. After screening the literature， extracting data and evaluating the quality of literature， meta-analysis was performed using RevMan 5.4 software. RESULTS A total of 12 RCTs were included， involving 1 109 patients. Meta-analysis showed that the postoperative incidence of IUA [RR＝0.30， 95%CI （0.22， 0.41）， P＜0.000 01]， postoperative vaginal bleeding time [MD＝－1.69， 95%CI （－2.05， －1.32）， P＜0.000 01]， postoperative vaginal bleeding volume [MD＝－10.78， 95%CI （－12.19， －9.37）， P＜0.000 01]， postoperative menstrual resumption time [MD＝－6.99， 95%CI （－8.27， －5.71）， P＜0.000 01]， and the incidence of postoperative reduced menstrual flow [RR＝0.25， 95%CI （0.12， 0.56）， P＝0.000 7] were significantly lower， less or shorter than control group； postoperative endometrial thickness [MD＝ 1.90， 95%CI （1.68， 2.13）， P＜0.000 01] and the rate of postoperative re-pregnancy [RR＝6.26， 95%CI （1.88， 20.83）， P＝0.003] were significantly higher than control group. CONCLUSIONS Dydrogesterone combined with estradiol valerate may reduce the incidence of IUA after induced abortion patients， decrease postoperative vaginal bleeding volume， shorten postoperative vaginal bleeding time and postoperative menstrual resumption time， and increase postoperative endometrial thickness.

To reduce the dependency on high-carbon-load chromatographic columns,a new method has been established for the determination of the content of docusate sodium using ion-pair high-performance liquid chromatography (IP-HPLC). Tetrapropylammonium chloride was used as the ion-pair reagent with a mobile phase, composition of acetonitrile:10 mmol/L tetrapropylammonium chloride solution = 66∶34, adjusting pH to 6.5 with 0.1% phosphoric acid solution,flow rate of 1.5 mL/min, detection wavelength of 214 nm,column temperature of 35 °C, and an injection volume of 25 μL,and quantified by an external standard method. The main peak of docusate sodium exhibited a tailing factor of 1.34. The method showed good linearity within the range of 0.02 mg/mL to 0.40 mg/mL, with a correlation coefficient (r) of 0.999 9. It also demonstrated good repeatability, with recovery ranging from 97.0% to 98.2% (n=6). The quantification limit was 3.31 μg/mL, and the detection limit was 2.76 μg/mL.In summary,the new method shows good durability, a wide linear range, and high sensitivity, it is suitable for the determination of docusate sodium.