ObjectiveTo investigate the potential mechanism of Danggui Buxuetang （DBT） in the treatment of vascular dementia （VAD）. MethodsSixty male SD rats were randomly assigned to the sham-operated group， model group， DBT low-， medium-， and high-dose groups， and the donepezil group. Except for the sham-operated group， rats in all other groups underwent bilateral common carotid artery ligation. After successful modeling， DBT was administered at doses of 9.2， 18.4， 36.8 g·kg^-1 for the low-， medium-， and high-dose groups， respectively， while the donepezil group received 3 mg·kg^-1 donepezil solution by gavage once daily. After 4 consecutive weeks of drug treatment， rats underwent the Morris water maze test， novel object recognition test， Nissl staining to observe hippocampal neurons， and immunofluorescence staining to detect the expression of neuronal nuclear protein （NeuN） in the hippocampus. Western blot was used to assess the expression of PTEN-induced kinase 1 （PINK1）， Parkin， microtubule-associated protein 1 light chain 3Ⅱ （LC3Ⅱ）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax）. Transmission electron microscopy was used to observe hippocampal neuronal ultrastructure. Real-time PCR was used to detect the expression of NADPH oxidase subunits p22^phox and p47^phox in hippocampal tissues. The levels of malondialdehyde （MDA）， glutathione （GSH）， superoxide dismutase （SOD）， and total antioxidant capacity were measured to evaluate oxidative stress levels. ResultsIn the Morris water maze test， escape latency changed significantly over time in all groups except the model group. Compared with the sham-operated group， the model group showed significantly prolonged escape latency （P<0.01）. Compared with the model group， rats in the DBT groups and the donepezil group exhibited significantly shorter escape latency （P<0.05， P<0.01）. The number of crossings over the original platform was significantly reduced in the model group compared with the sham-operated group （P<0.01）， whereas rats in the DBT and donepezil groups showed significantly increased platform crossings compared with the model group （P<0.05， P<0.01）. Compared with the sham-operated group， exploration time of new objects was significantly reduced in the model group （P<0.01）. Compared with the model group， exploration time of new objects increased significantly in the medium- and high-dose DBT groups and the donepezil group （P<0.05， P<0.01）， while no significant change was observed in the low-dose DBT group. Compared with the high-dose DBT group， rats in the donepezil group had significantly prolonged escape latency and reduced platform crossings and new-object exploration time （P<0.05）. Nissl staining showed decreased density of healthy neurons in the CA1 and CA3 regions of the hippocampus in the model group， with loss of Nissl bodies and nuclear atrophy or disappearance. In the high-dose DBT group， neuronal density in CA1 and CA3 increased， with neurons arranged closely and displaying normal morphology. Immunofluorescence showed that compared with the sham-operated group， the hippocampal NeuN⁺ cell count in the VAD model group was significantly decreased（P<0.01）， compared with the VAD model group， the hippocampal NeuN⁺ cell count in the high-dose DBT group was significantly increased（P<0.01）. Compared with the sham-operated group， the expression of PINK1， Parkin， LC3Ⅱ， and Bax proteins was significantly increased（P<0.01）， while the expression of Bcl-2 was significantly decreased in the VAD model group（P<0.01）. Compared with the VAD model group， the high-dose DBT group showed significantly decreased expression of PINK1， Parkin， LC3Ⅱ， and Bax proteins（P<0.01）and significantly upregulated Bcl-2 expression（P<0.01）. The medium-dose DBT group exhibited significantly reduced expression of Parkin， LC3Ⅱ， and Bax proteins（P<0.05，P<0.01） and significantly increased Bcl-2 expression（P<0.01）， while no statistically significant differences were observed in the low-dose DBT group. Transmission electron microscopy showed mitochondrial pyknosis， thickened cristae， increased electron density， and the presence of mitochondrial autophagy in the model group. In contrast， hippocampal neurons in the high-dose DBT group contained abundant mitochondria with intact morphology， clear cristae， and uniform matrix. Compared with the sham-operated group， total antioxidant capacity， SOD activity， and GSH levels were significantly decreased， while MDA levels were significantly increased in the model group （P<0.01）. Compared with the model group， total antioxidant capacity and antioxidant levels （SOD， GSH） increased significantly， and MDA decreased significantly in the medium- and high-dose DBT groups （P<0.01）， while no significant changes were observed in the low-dose DBT group. Compared with the sham-operated group， mRNA expression of p22^phox and p47^phox was significantly increased in the model group （P<0.01）. Compared with the model group， expression of p22^phox and p47^phox was significantly decreased in the DBT groups （P<0.05， P<0.01）. ConclusionDBT may exert neuroprotective effects by regulating PINK1/Parkin-mediated mitochondrial autophagy， thereby improving learning and memory abilities and treating VAD.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Stroke is one of the leading causes of disability and mortality worldwide. Research into its mechanisms and the development of therapeutic strategies heavily rely on animal models that accurately replicate the pathological features of human disease. An ideal animal model for stroke should not only reproduce the neurological deficits and pathological changes observed in clinical patients but also demonstrate good reproducibility and translational value. This review focuses on the preparation and evaluation methods of ischemic stroke animal models. Firstly, it elaborates on the selection criteria, advantages, and disadvantages of experimental animals, including rodents (rats, mice) and non-rodents (non-human primates, miniature pigs, rabbits, zebrafish). Secondly, it provides a detailed overview of the modeling principles, key procedures, and application scopes for ischemic stroke models and hemorrhagic stroke models. Furthermore, the review summarizes advances in the applications of emerging technologies—including gene editing [e.g., clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing], multimodal imaging (e.g., two-photon microscopy, photoacoustic imaging), artificial intelligence, optogenetics, 3D bioprinting, organoid models, and multi-omics–in model optimization, precise assessment, and mechanistic investigation. Finally, based on a systematic analysis of relevant domestic and international literature from 2019 to 2024, this review discusses model selection strategies based on research objectives, a multidimensional evaluation system encompassing behavioral, imaging, and molecular pathological assessments, and envisions future directions involving technological integration to achieve model precision and individualization. This article aims to provide a comprehensive methodological reference to help researchers select appropriate animal models of stroke according to specific scientific questions.

Stroke is the leading cause of death and disability among adults in China， and its common complications include digestive system abnormalities， cognitive impairment， depression， stroke-associated pneumonia， and hemiplegia. The combination of traditional Chinese and Western medicine has great potential in treating post-stroke complications. Xinglou Chengqitang （XLCQT） is a representative prescription of alleviating the disease in the upper part by treating the lower part. It has definite therapeutic effect and high safety. Clinically， XLCQT is often used to treat stroke and its complications. However， the quantity and quality of clinical trials of XLCQT in treating post-stroke complications need to be improved. Additionally， since the basic research is weak， the material basis and multi-target mechanism for the efficacy of this prescription are unknown. This article reviews XLCQT in terms of the pharmacodynamic basis， medicinal properties， safety evaluation， and progress in clinical research and mechanisms in treating post-stroke complications. This article summarizes 22 key active ingredients of XLCQT in treating acute stroke complicated with syndrome of phlegm heat and fu-organ excess. Among these key active ingredients， resveratrol， kaempferol， luteolin， chrysoeriol， apigenin， （+）-catechin， and adenosine have good pharmacokinetic properties and high bioavailability. The mechanisms of XLCQT in treating post-stroke complications are complex， including inflammatory response， brain-gut axis， hypothalamic-pituitary-adrenal （HPA） axis， intestinal flora， neurotrophic factors， autophagy， oxidative stress， and free radical damage. This review helps to deeply understand the pharmacodynamic basis and mechanisms of XLCQT in treating post-stroke complications and provides a theoretical basis for the clinical application of XLCQT against post-stroke complications and the development of drugs.

To reduce the dependency on high-carbon-load chromatographic columns,a new method has been established for the determination of the content of docusate sodium using ion-pair high-performance liquid chromatography (IP-HPLC). Tetrapropylammonium chloride was used as the ion-pair reagent with a mobile phase, composition of acetonitrile:10 mmol/L tetrapropylammonium chloride solution = 66∶34, adjusting pH to 6.5 with 0.1% phosphoric acid solution,flow rate of 1.5 mL/min, detection wavelength of 214 nm,column temperature of 35 °C, and an injection volume of 25 μL,and quantified by an external standard method. The main peak of docusate sodium exhibited a tailing factor of 1.34. The method showed good linearity within the range of 0.02 mg/mL to 0.40 mg/mL, with a correlation coefficient (r) of 0.999 9. It also demonstrated good repeatability, with recovery ranging from 97.0% to 98.2% (n=6). The quantification limit was 3.31 μg/mL, and the detection limit was 2.76 μg/mL.In summary,the new method shows good durability, a wide linear range, and high sensitivity, it is suitable for the determination of docusate sodium.

OBJECTIVE To systematically evaluate the efficacy of dydrogesterone combined with estradiol valerate for the prevention of intrauterine adhesion （IUA） and prognosis improvement after induced abortion. METHODS Retrieved from CNKI， Wanfang Data， VIP， CBM， PubMed， Embase and the Cochrane Library， randomized controlled trial （RCT） about conventional treatment combined with dydrogesterone and estradiol valerate （trial group） versus conventional treatment （control group） for the prevention of IUA in patients after induced abortion were collected from the inception to Dec. 2024. After screening the literature， extracting data and evaluating the quality of literature， meta-analysis was performed using RevMan 5.4 software. RESULTS A total of 12 RCTs were included， involving 1 109 patients. Meta-analysis showed that the postoperative incidence of IUA [RR＝0.30， 95%CI （0.22， 0.41）， P＜0.000 01]， postoperative vaginal bleeding time [MD＝－1.69， 95%CI （－2.05， －1.32）， P＜0.000 01]， postoperative vaginal bleeding volume [MD＝－10.78， 95%CI （－12.19， －9.37）， P＜0.000 01]， postoperative menstrual resumption time [MD＝－6.99， 95%CI （－8.27， －5.71）， P＜0.000 01]， and the incidence of postoperative reduced menstrual flow [RR＝0.25， 95%CI （0.12， 0.56）， P＝0.000 7] were significantly lower， less or shorter than control group； postoperative endometrial thickness [MD＝ 1.90， 95%CI （1.68， 2.13）， P＜0.000 01] and the rate of postoperative re-pregnancy [RR＝6.26， 95%CI （1.88， 20.83）， P＝0.003] were significantly higher than control group. CONCLUSIONS Dydrogesterone combined with estradiol valerate may reduce the incidence of IUA after induced abortion patients， decrease postoperative vaginal bleeding volume， shorten postoperative vaginal bleeding time and postoperative menstrual resumption time， and increase postoperative endometrial thickness.

To investigate the mechanism of Jianpi Qutan Formula in regulating the balance between classically activated macrophages(M1) and alternatively activated macrophages(M2) in atherosclerotic plaques through phosphorylation and activation of the signal transducer and activator of transcription 6(STAT6), thereby reducing inflammation, increasing plaque stability, and exerting anti-atherosclerosis(AS) effects. An AS model was established by feeding apolipoprotein E(ApoE)~(-/-) mice with atherosclerotic chow for 8 weeks. The ApoE~(-/-) mice were randomly divided into a model group(Mod group), a Jianpi Qutan Formula group(JPQT group, 8.97 g·kg~(-1)), and a Atorvastatin Calcium Tablets group(ATO group, 1.3 mg·kg~(-1)) according to a random table method, with 10 mice in each group. Additionally, 10 male C57BL/6J mice of the same age, fed with a normal diet, were set as the control group(Con group). The JPQT and ATO groups received their respective treatments via oral gavage for 8 consecutive weeks, while the Con and Mod groups were administered an equivalent volume of saline. Body weight was continuously monitored, and after blood collection, total cholesterol(TC) and triglyceride(TG) levels in the serum of each group were compared. Hematoxylin-eosin(HE) staining and oil red O staining were used to observe plaque formation in aortic tissue. Enzyme-linked immunosorbent assay(ELISA) was employed to detect the expression levels of pro-inflammatory cytokines interleukin(IL)-6 and IL-12, as well as the anti-inflammatory cytokine IL-10. Immunofluorescence was used to detect the positive expression of aortic cluster of differentiation(CD)86 and CD206. Western blot analysis was conducted to detect the protein expression levels of aortic inducible nitric oxide synthase(iNOS), arginase 1(Arg1), STAT6, and p-STAT6. Compared to the Con group, the Mod group exhibited increased body weight and blood lipid levels, disordered aortic structure, significant AS plaque formation accompanied by extensive lipid deposition, and elevated serum levels of pro-inflammatory cytokines IL-6 and IL-12, as well as elevated CD86 and iNOS protein levels. In contrast, the serum levels of the anti-inflammatory cytokine IL-10, along with the protein expression levels of CD206, Arg1, and p-STAT6/STAT6, were reduced. Compared to the Mod group, the drug intervention groups showed improvements in body weight and lipid metabolism, with a more significant improvement in aortic structure, reduced lipid accumulation, decreased serum levels of IL-6 and IL-12, and lower CD86 and iNOS protein levels. Meanwhile, levels of IL-10, CD206, Arg1, and p-STAT6/STAT6 increased. Jianpi Qutan Formula improves AS by regulating the imbalance in M1/M2 macrophage polarization, and its mechanism is likely closely related to the activation of the STAT6 signaling pathway.
Animals ; Atherosclerosis/metabolism* ; Male ; Drugs, Chinese Herbal/administration & dosage* ; Mice ; Macrophages/cytology* ; Mice, Inbred C57BL ; STAT6 Transcription Factor/immunology* ; Humans ; Apolipoproteins E/genetics* ; Interleukin-6/immunology*

To investigate the protective effects and underlying mechanisms of Qin-Zhu-Liang-Xue decoction (QZLX) in atopic dermatitis (AD) and glucocorticoid resistance, we conducted a single-blinded, randomized controlled clinical trial to evaluate the efficacy and safety of this concoction. Network pharmacology analysis was performed and validated through clinical studies. The efficacy, safety, and mechanism of action of QZLX and glucocorticoid receptor (GR) α recombinant protein were assessed in AD mice induced by 2,4-dinitrofluorobenzene (DNFB). Correlation analysis was performed to determine the clinical relevance of GRα. The trial demonstrated that patients who received QZLX showed considerable improvements in their Scoring Atopic Dermatitis (SCORAD) and Dermatology Life Quality Index (DLQI) scores compared with those who received mizolastine at week 4. Network pharmacological analysis identified GRα as a key target for QZLX in AD treatment. QZLX administration increased the serum GRα expression in AD patients, alleviated AD symptoms in mice, decreased inflammatory cytokine expression, and increased GRα expression without affecting liver or kidney function. In addition, GRα recombinant protein improved AD-like skin lesions in DNFB-induced mice. A negative correlation was observed between GRα expression and clinical parameters, including SCORAD, DLQI, and serum IgE levels. QZLX alleviates AD symptoms through the upregulation of GRα and thus presents a novel therapeutic strategy for the prevention of glucocorticoid resistance in AD management.
Dermatitis, Atopic/drug therapy* ; Animals ; Drugs, Chinese Herbal/administration & dosage* ; Humans ; Mice ; Network Pharmacology ; Male ; Female ; Adult ; Receptors, Glucocorticoid/metabolism* ; Disease Models, Animal ; Single-Blind Method ; Middle Aged ; Young Adult

AIM: To evaluate the repeatability and accuracy of iCare IC100 tonometer in measuring intraocular pressure(IOP)by comparing the correlation and difference with Goldmann applanation tonometry(GAT)and non-contact tonometer(NCT), and to compare the correlation of the three types of IOP measurement with the central corneal thickness(CCT).METHODS: Prospective study. A total of 90 outpatients(90 eyes)in Liaoning Aier Eye Hospital from March 2019 to May 2019 were randomly selected as study subjects. All patients were measured IOP using iCare IC100, NCT, and GAT. The interclass correlation coefficient(ICC)was used to evaluate the repeatability of IOP measured 3 times consecutively using an intraocular tonometer. The correlation and consistency of iCare IC100, GAT and NCT were compared by one-way ANOVA, Pearson linear correlation analysis and Bland-Altman analysis. The linear regression analysis was used to analyze the correlation of the three tonometers with CCT.RESULTS: The mean IOP measured with iCare IC100, GAT and NCT was 19.74±6.90, 19.88±7.07 and 18.47±6.31 mmHg, respectively(F=1.180, P=0.309). The measurements of iCare IC100 with GAT, iCare IC100 with NCT and GAT with NCT were all positively correlated(r=0.930, 0.946, 0.918, all P<0.05), the Bland-Altman analysis showed that the mean differences between iCare IC100 and GAT, iCare IC100 and NCT, GAT and NCT were -0.142±2.61, 1.27±2.24, and 1.41±2.81 mmHg, respectively, with 97%(87/90), 96%(86/90), and 97%(87/90)IOP differences distributed within their 95% confidence intervals. The IOP measured with iCare IC100 and CCT, GAT and CCT and NCT and CCT were all positively correlated(r=0.426, 0.353, 0.451, all P<0.01). The linear regression equations between iCare IC100, GAT and NCT measurement and CCT were iCare IC100 IOP=-19.62+0.074×CCT; GAT IOP=-13.54+0.063×CCT; NCT IOP=-19.65+0.072×CCT; that is, for every 10 μm increase in CCT, iCare IC100 measurement increased by 0.74 mmHg, GAT measurement increased by 0.63 mmHg, and NCT measurement increased by 0.72 mmHg.CONCLUSION: The iCare IC100 tonometer has good repeatability and accuracy in measuring IOP, and the CCT has a greater impact on the measurement of iCare IC100 than the GAT and NCT.

AIM: To evaluate the repeatability and accuracy of iCare IC100 tonometer in measuring intraocular pressure(IOP)by comparing the correlation and difference with Goldmann applanation tonometry(GAT)and non-contact tonometer(NCT), and to compare the correlation of the three types of IOP measurement with the central corneal thickness(CCT).METHODS: Prospective study. A total of 90 outpatients(90 eyes)in Liaoning Aier Eye Hospital from March 2019 to May 2019 were randomly selected as study subjects. All patients were measured IOP using iCare IC100, NCT, and GAT. The interclass correlation coefficient(ICC)was used to evaluate the repeatability of IOP measured 3 times consecutively using an intraocular tonometer. The correlation and consistency of iCare IC100, GAT and NCT were compared by one-way ANOVA, Pearson linear correlation analysis and Bland-Altman analysis. The linear regression analysis was used to analyze the correlation of the three tonometers with CCT.RESULTS: The mean IOP measured with iCare IC100, GAT and NCT was 19.74±6.90, 19.88±7.07 and 18.47±6.31 mmHg, respectively(F=1.180, P=0.309). The measurements of iCare IC100 with GAT, iCare IC100 with NCT and GAT with NCT were all positively correlated(r=0.930, 0.946, 0.918, all P<0.05), the Bland-Altman analysis showed that the mean differences between iCare IC100 and GAT, iCare IC100 and NCT, GAT and NCT were -0.142±2.61, 1.27±2.24, and 1.41±2.81 mmHg, respectively, with 97%(87/90), 96%(86/90), and 97%(87/90)IOP differences distributed within their 95% confidence intervals. The IOP measured with iCare IC100 and CCT, GAT and CCT and NCT and CCT were all positively correlated(r=0.426, 0.353, 0.451, all P<0.01). The linear regression equations between iCare IC100, GAT and NCT measurement and CCT were iCare IC100 IOP=-19.62+0.074×CCT; GAT IOP=-13.54+0.063×CCT; NCT IOP=-19.65+0.072×CCT; that is, for every 10 μm increase in CCT, iCare IC100 measurement increased by 0.74 mmHg, GAT measurement increased by 0.63 mmHg, and NCT measurement increased by 0.72 mmHg.CONCLUSION: The iCare IC100 tonometer has good repeatability and accuracy in measuring IOP, and the CCT has a greater impact on the measurement of iCare IC100 than the GAT and NCT.