AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo observe the changes in the levels of different subtypes of epidermal growth factor receptor （ErbB）， namely ErbB1， ErbB2， ErbB3， and ErbB4， in the spinal dorsal horn of inflammatory pain model rats， and to explore their mechanism of mediating hyperalgesia as well as the intervention mechanism of electroacupuncture at "Zusanli （ST 36）" and "Kunlun （BL 60）". MethodsThe study was divided into five parts. In experiment 1， 14 Sprague Dawley （SD） rats were randomly divided into control and inflammatory pain group （7 rats each group） to observe the pain behavior and the protein expression of different ErbB receptor subtypes in the spinal dorsal horn. In experiment 2， 30 rats were randomly divided into control group 1， inflammatory pain group 1， and low-， medium-， and high-concentration TX1-85-1 groups， with 6 rats in each group， to observe the effect of inhibiting spinal ErbB3 on inflammatory pain. In experiment 3， 12 rats were randomly divided into control virus group and ErbB3 knockdown virus group， with 6 rats in each group， to observe the effect of knocking down ErbB3 in the spinal dorsal horn on inflammatory pain. In experiment 4， 44 rats were randomly divided into control group 2， inflammatory pain group 2， electroacupuncture group， and sham electroacupuncture group， with 11 rats in each group， to observe the effect of electroacupuncture. In experiment 5， 40 rats were randomly divided into control group 3， inflammatory pain group 3， electroacupuncture group 1， and electroacupuncture + NRG1 group， with 10 rats in each group， to observe the effect of activating ErbB3 on electroacupuncture. A rat model of inflammatory pain was established by subcutaneous injection of 100 μl of complete Freund's adjuvant into the sole of the unilateral hind foot of SD rats. Rats in the low-， medium-， and high-concentration TX1-85-1 groups were intrathecally injected with ErbB3 inhibitor TX1-85-1 on day 5 to day 7 after modeling. Rats in the ErbB3 knockdown virus group were injected with ErbB3 knockdown virus packaged with adenovirus vector-based short hairpin RNA （shRNA） into the spinal dorsal horn in situ 3 weeks before modeling. Rats in each electroacupuncture group received electroacupuncture at bilateral "Zusanli （ST 36）" and "Kunlun （BL 60）" from day 1 to day 7 after modeling， with dense-sparse waves at a frequency of 2 Hz/100 Hz and a current of 0.5-1.5 mA for 30 minutes once a day. Rats in the electroacupuncture + NRG1 group were intrathecally injected with ErbB3 ligand recombinant human neuregulin-1 （NRG1） after electroacupuncture intervention from day 5 to day 7 after modeling. The mechanical withdrawal threshold and thermal withdrawal latency of rats were measured on day 1， 3， 5， and 7 after modeling to evaluate behavior， and Western Blot was used to detect the protein and phosphorylation levels of each ErbB subtype in the spinal dorsal horn. ResultsCompared with the control group， rats in the inflammatory pain group showed decreased mechanical withdrawal threshold and thermal withdrawal latency of rats， and increased expression of phosphorylated ErbB3 （p-ErbB3） protein in the spinal dorsal horn on days 1， 3， 5， and 7 after modeling （P＜0.01）. On day 5 and day 7 after modeling， compared with the inflammatory pain group 1， the mecha-nical withdrawal threshold and thermal withdrawal latency of rats in the medium- and high-concentration TX1-85-1 groups increased， and the expression of p-ErbB3 protein decreased （P＜0.05）. On day 1， 3， 5， and 7 after modeling， compared with the control virus group， the mechanical withdrawal threshold and thermal withdrawal latency of rats in the ErbB3 knockdown virus group increased （P＜0.05）. On day 5 and day 7 after modeling， compared with the inflammatory pain group 2 and the sham electroacupuncture group， the mechanical withdrawal threshold and thermal withdrawal latency of rats in the electroacupuncture group increased， and the expression of p-ErbB3 protein decreased （P＜0.05）. On day 5 and day 7 after modeling， compared with the electroacupuncture + NRG1 group， the mechanical withdrawal threshold and thermal withdrawal latency of rats in the electroacupuncture group 1 increased （P＜0.05）. ConclusionThe p-ErbB3 in the spinal dorsal horn involved in hyperalgesia in rats with inflammatory pain， and electroacupuncture at "Zusanli （ST 36）" and "Kunlun （BL 60）" can alleviate inflammatory pain by inhibiting the expression of p-ErbB3 protein in the spinal dorsal horn of rats.

ObjectiveIn order to provide a reference for the optimization of preparation process of stir-fried Glycyrrhizae Radix et Rhizoma（sf-GRR）， the quality changes during the processing was studied. MethodsGlycyrrhizae Radix et Rhizoma was processed by stir-frying for 17 min， and samples were collected every 1 min during the processing. The appearance color of the samples was determined by visual analysis technology， the moisture and extract of the process samples were detected by the drying method and the hot extraction method of alcohol-soluble extract in the general rules of the 2020 edition of Chinese Pharmacopoeia（part Ⅳ）， and the contents of liquiritin apioside， liquiritin， isoliquiritin apioside， isoliquiritin， licoricesaponin G₂ and glycyrrhizic acid in the process samples were determined by high performance liquid chromatography（HPLC）. Then principal component analysis（PCA）， partial least squares-discriminant analysis（PLS-DA） and Spearman correlation analysis were used for clustering， discrimination and correlation analysis of the appearance color， moisture， extract and the contents of six internal components. Based on artificial neural network and random forest algorithm， the prediction model of processing degree of sf-GRR was established. On this basis， based on the five principles of quality marker（Q-Maker）， explore the monitoring Q-Maker of sf-GRR. ResultsThe color of Glycyrrhizae Radix et Rhizoma deepened after stir-frying， and the appearance color of the sample changed from light yellow to dark yellow during processing. During the stir-frying process， the moisture content showed a decreasing trend with the extension of processing time， while the extract content showed an increasing trend with the extension of processing time. After stir-frying， the contents of liquiritin apioside， liquiritin and licoricesaponin G₂ showed an overall decreasing trend， while the contents of isoliquiritin apioside and isoliquiritin increased， and the content of glycyrrhizic acid increased slightly. The correlation analysis showed that moisture was positively correlated with brightness（L^*） and red/green value（a^*）， and negatively correlated with yellow/blue value（b^*） and total color difference（E^*ab）. Isoliquiritin apioside and isoliquiritin had negative correlation with L^* and a^*， and positive correlation with b^* and E^*ab. The processing process of sf-GRR could be divided into two stages of the early stage（0-14 min） and the late stage（15-17 min）， and could be divided into three stages of the early stage（0-6 min）， the middle stage（7-14 min） and the late stage（15-17 min） by combining the moisture， extract， the contents of 6 components and color values. Based on artificial neural network analysis and random forest algorithm， isoliquiritin apioside， isoliquiritin， liquiritin and glycyrrhizic acid were selected as monitoring markers for sf-GRR. ConclusionBased on the analysis of the exterior-interior indicators of process samples of sf-GRR， this paper ultimately identifies four processing monitoring markers， which can provide a basis for optimizing the processing technology of sf-GRR.

Objective To compare the imaging characteristics and surgical methods of pulmonary nodules in the external 1/3 group and internal 2/3 group. Methods A retrospective analysis of clinical data from patients who underwent thoracoscopic preoperative CT-guided lung nodule localization at the Department of Radiology, the First Affiliated Hospital of Xiamen University from September 2020 to April 2022 was conducted. Results A total of 215 patients were enrolled (247 pulmonary nodules), including 70 males and 145 females, with a median age of 48 years. Based on the location of the nodules under CT guidance, those located in the external 1/3 area of the lung were classified into an external 1/3 group, while those located in the middle 1/3 and inner 1/3 areas were classified into an internal 2/3 group. There was no statistical difference between the two groups in terms of general clinical data, nature of pulmonary nodules, distribution of pulmonary nodules in lobes, localization time, or localization complications (P>0.05). However, there were statistical differences in the distance of pulmonary nodules from the pleura [0.6 (0.0-1.9) cm vs. 1.8 (0.0-4.5) cm, P<0.001], size of pulmonary nodules [0.7 (0.2-1.8) cm vs. 1.0 (0.2-2.0) cm, P<0.001], and surgical methods (P=0.002). In the external 1/3 group, 92.1% of nodules underwent thoracoscopic wedge resection, while fewer patients underwent other procedures; in the internal 2/3 group, 77.1% of nodules underwent thoracoscopic wedge resection, and 19.3% underwent segmentectomy. Conclusion The diameter of pulmonary nodules, the distance of pulmonary nodules from the pleura, and surgical methods differ between the external 1/3 group and internal 2/3 group. Thoracic surgeons can develop more precise surgical plans based on the location and size of pulmonary nodules.

Aromatic inhalation therapy is a key traditional Chinese medicine （TCM） approach for preventing respiratory infectious diseases. Its foundational theory， "aromatics acting on the spleen"， is deeply rooted in TCM principles and supported by modern medical research. The theory posits that the aromatic properties of medicinals primarily act on the spleen， and the aromatic inhalation therapy achieved its protective effects by modulation of the spleen and spleen channel to enhance the regulation of wei qi， striae and interstices. In TCM， the spleen is considered the mother of the lungs， with the function of nurturing lung； it is also seen as the source of wei qi， responsible for external defense； and the root of healthy qi， forming the foundation of acquired （postnatal） constitution. Thus， preventive strategies for respiratory infectious diseases focus on strengthening the spleen. From a modern medical perspective， the spleen's role in regulating lung immune responses， the shared immune functions of the respiratory and gastrointestinal mucosa， and the spleen's overall immune modulation provide scientific evidence for using aromatic inhalation therapy to prevent respiratory infections. Additionally， aromatic inhalation therapy offers several advantages， including direct action， rapid onset， minimal side effects， controllable risks， convenience， and ease of dissemination， making it a practical and effective preventive measure for respiratory infectious diseases.

Objective: To investigate the mechanism of action of Prim-O-glucosylcimifugin (POG) to improve cholesterol metabolism in osteoarthritic (OA) chondrocytes based on the long noncoding RNA nuclear-enriched transcript 1 (lncRNA NEAT1)/microRNA-128-3p (miR-128-3p) pathway. Methods: For in vivo experiments, 60 mice were divided into the normal, sham operation, model, and POG groups using the random number table method, with 15 mice per group. The osteoarthritis mouse model was constructed using the modified Hulth method in the model and POG groups. Mice in the POG group were administered 30 mg/(kg·d)POG by gavage. The other groups were administered an equal amount of normal saline for 8 weeks. The cartilage tissue structure of mice in each group was observed using hematoxylin and eosin staining. Real-time PCR was used to detect changes in the lncRNA NEAT1 and miR-128-3p mRNA expression levels in the cartilage tissues of mice. Western blotting was used to detect the protein expressions of ATP-binding cassette transporter A1 (ABCA1), liver X receptor β (LXRβ), matrix metalloprotein-3 (MMP-3), and B-lymphoblastoma-2-associated X protein (Bax) in articular cartilage of mice. An enzyme-linked immunosorbent assay was used to measure the tumor necrosis factor-α (TNF-α) content in the synovial fluid of mice. A biochemical microplate assay was used to measure the total cholesterol level in the synovial fluid of mice. The in vitro experiments were divided into the negative control, interleukin-1β(IL-1β), IL-1β+ POG, IL-1β+ oe-lncRNA NEAT1, IL-1β+ oe-lncRNA NEAT1 + POG, IL-1β + miR-128-3p inhibition, and IL-1β+ miR-128-3p inhibition+ POG groups. An OA model was established by inducing chondrocytes with IL-1β for 24 h, and 90 mg/L of POG and miR-128-3p inhibitor(50 nmol/L) were administered for 48 h as an intervention. lncRNA NEAT1 expression in chondrocytes was detected using fluorescence in situ hybridization. A dual luciferase assay was used to detect the targeting relationship between lncRNA NEAT1 and miR-128-3p. Lentiviral plasmids overexpressing lncRNA NEAT1 were used to transfect mouse chondrocytes. Real-time PCR was used to detect the effect of lncRNA NEAT1 overexpression on the mRNA level of miR-128-3p in chondrocytes. Western blotting was used to detect ABCA1, LXRβ, MMP-3, and Bax protein expression in chondrocytes after lncRNA NEAT1 overexpression and miR-128-3p inhibition. Results: POG significantly reduced OA cartilage tissue damage. Compared with the model group, the lncRNA NEAT1 mRNA level decreased, whereas the miR-128-3p mRNA level increased in the cartilage tissue of the POG group (P<0.05). Compared with the model group, ABCA1 and LXRβ protein expression increased in the POG group, whereas MMP-3 and Bax protein expression decreased (P<0.05). The TNF-α levels decreased in the POG group compared to the model group (P<0.05). Compared with the model group, the total cholesterol level in the synovial fluid of the joint of mice in the POG group decreased (P<0.05). The mean fluorescence intensity of lncRNA NEAT1 in the IL-1β+ POG group decreased compared with the IL-1β group (P<0.05). The relative luciferase activity in the miR-128-3p mimics group bound to the lncRNA NEAT1-WT plasmid decreased compared with the miR-128-3p negative control group (P<0.05). The lncRNA NEAT1 mRNA levels decreased, whereas the miR-128-3p mRNA levels increased in the IL-1β+ oe-lncRNA NEAT1 + POG group compared with the IL-1β+ oe-lncRNA NEAT1 group (P<0.05). Compared with the IL-1β+ POG group, ABCA1 and LXRβ protein expression decreased, whereas MMP-3 and Bax protein expression increased (P<0.05). Conclusion POG mediates lncRNA NEAT1/miR-128-3p to improve cholesterol metabolism in OA chondrocytes.

Immobilized enzyme-based enzyme electrode biosensors, characterized by high sensitivity and efficiency, strong specificity, and compact size, demonstrate broad application prospects in life science research, disease diagnosis and monitoring, etc. Immobilization of enzyme is a critical step in determining the performance (stability, sensitivity, and reproducibility) of the biosensors. Random immobilization (physical adsorption, covalent cross-linking, etc.) can easily bring about problems, such as decreased enzyme activity and relatively unstable immobilization. Whereas, directional immobilization utilizing amino acid residue mutation, affinity peptide fusion, or nucleotide-specific binding to restrict the orientation of the enzymes provides new possibilities to solve the problems caused by random immobilization. In this paper, the principles, advantages and disadvantages and the application progress of enzyme electrode biosensors of different directional immobilization strategies for enzyme molecular sensing elements by specific amino acids (lysine, histidine, cysteine, unnatural amino acid) with functional groups introduced based on site-specific mutation, affinity peptides (gold binding peptides, carbon binding peptides, carbohydrate binding domains) fused through genetic engineering, and specific binding between nucleotides and target enzymes (proteins) were reviewed, and the application fields, advantages and limitations of various immobilized enzyme interface characterization techniques were discussed, hoping to provide theoretical and technical guidance for the creation of high-performance enzyme sensing elements and the manufacture of enzyme electrode sensors.

Collagen is a major structural protein in the matrix of animal cells and the most widely distributed and abundant functional protein in mammals. Collagen’s good biocompatibility, biodegradability and biological activity make it a very valuable biomaterial. According to the source of collagen, it can be broadly categorized into two types: one is animal collagen; the other is recombinant collagen. Animal collagen is mainly extracted and purified from animal connective tissues by chemical methods, such as acid, alkali and enzyme methods, etc. Recombinant collagen refers to collagen produced by gene splicing technology, where the amino acid sequence is first designed and improved according to one’s own needs, and the gene sequence of improved recombinant collagen is highly consistent with that of human beings, and then the designed gene sequence is cloned into the appropriate vector, and then transferred to the appropriate expression vector. The designed gene sequence is cloned into a suitable vector, and then transferred to a suitable expression system for full expression, and finally the target protein is obtained by extraction and purification technology. Recombinant collagen has excellent histocompatibility and water solubility, can be directly absorbed by the human body and participate in the construction of collagen, remodeling of the extracellular matrix, cell growth, wound healing and site filling, etc., which has demonstrated significant effects, and has become the focus of the development of modern biomedical materials. This paper firstly elaborates the structure, type, and tissue distribution of human collagen, as well as the associated genetic diseases of different types of collagen, then introduces the specific process of producing animal source collagen and recombinant collagen, explains the advantages of recombinant collagen production method, and then introduces the various systems of expressing recombinant collagen, as well as their advantages and disadvantages, and finally briefly introduces the application of animal collagen, focusing on the use of animal collagen in the development of biopharmaceutical materials. In terms of application, it focuses on the use of animal disease models exploring the application effects of recombinant collagen in wound hemostasis, wound repair, corneal therapy, female pelvic floor dysfunction (FPFD), vaginal atrophy (VA) and vaginal dryness, thin endometritis (TE), chronic endometritis (CE), bone tissue regeneration in vivo, cardiovascular diseases, breast cancer (BC) and anti-aging. The mechanism of action of recombinant collagen in the treatment of FPFD and CE was introduced, and the clinical application and curative effect of recombinant collagen in skin burn, skin wound, dermatitis, acne and menopausal urogenital syndrome (GSM) were summarized. From the exploratory studies and clinical applications, it is evident that recombinant collagen has demonstrated surprising effects in the treatment of all types of diseases, such as reducing inflammation, promoting cell proliferation, migration and adhesion, increasing collagen deposition, and remodeling the extracellular matrix. At the end of the review, the challenges faced by recombinant collagen are summarized: to develop new recombinant collagen types and dosage forms, to explore the mechanism of action of recombinant collagen, and to provide an outlook for the future development and application of recombinant collagen.

The medicinal use of Malvae Semen has a long history. In this paper， by consulting the ancient materia medica， prescription， agronomy， literature and other aspects of the classics， the name， origin， evolution of scientific name， quality， harvesting and processing， functions and indications and others of Malvae Semen were systematically sorted out and verified， so as to provide a basis for the development and utilization of famous classical formulas containing this herb. According to the textual research， Shennong Bencaojing began to use Dongkuizi as the correct name， which was used in the past dynasties， and there were also aliases such as Kuicaizi， Huacai， and Kuizi. Through the original research， it can be seen that Kuicai is the mainstream original plant of Malvae Semen， that is， Malva verticillata var. crispa， the Alcea rosea and M. cathayensis are also used. In modern times， the seeds of Abutilon theophrasti have been passed off as Malvae Semen， while the seeds of M. verticillata var. crispa have rarely been used in medicine. And Abutili Semen has been another medicinal material with different efficacy since the collection of Newly Revised Materia Medica in the Tang dynasty. Since the Ming and Qing dynasties， the cultivation of Kuicai has been decreasing， while A. theophrasti is more common and easy to obtain， and Abutili Semen and Malvae Semen are similar in morphology and confused， which should be corrected. In addition， Malvae Fructus is a Mongolian customary medicinal herb， which is different from the traditional use of seeds in traditional Chinese medicine. Kuicai， as an important vegetable in history， was widely cultivated and gradually shrunk after the Song dynasty， it is now mainly produced in southern provinces. The quality evaluation of Malvae Semen is better for those with dry bodies， full grain， grayish brown color， no mud， and no impurities. The harvesting is generally in the autumn and winter. After drying， it is seeded， sieved peel and impurities， mashed， or slightly stir-fried to yellow-white color with gentle fire. It is sweet， cold and slippery in nature and taste， with the main effects of laxation， diuresis， lactation and elimination of swelling. The efficacy of Abutili Semen is clearing heat and removing toxicity， promoting diuresis and removing nebula， the efficacy is quite different from that of Malvae Semen. Based on the results of textual research， it is suggested that M. verticillata var. crispa should be used as the medicinal source of Malvae Semen in the development of famous classical formulas， the corresponding processing methods should be selected according to the requirements of drug processing in the formulas， while the raw products are recommended to be used if the processing is not specified.

The medicinal use of Malvae Semen has a long history. In this paper， by consulting the ancient materia medica， prescription， agronomy， literature and other aspects of the classics， the name， origin， evolution of scientific name， quality， harvesting and processing， functions and indications and others of Malvae Semen were systematically sorted out and verified， so as to provide a basis for the development and utilization of famous classical formulas containing this herb. According to the textual research， Shennong Bencaojing began to use Dongkuizi as the correct name， which was used in the past dynasties， and there were also aliases such as Kuicaizi， Huacai， and Kuizi. Through the original research， it can be seen that Kuicai is the mainstream original plant of Malvae Semen， that is， Malva verticillata var. crispa， the Alcea rosea and M. cathayensis are also used. In modern times， the seeds of Abutilon theophrasti have been passed off as Malvae Semen， while the seeds of M. verticillata var. crispa have rarely been used in medicine. And Abutili Semen has been another medicinal material with different efficacy since the collection of Newly Revised Materia Medica in the Tang dynasty. Since the Ming and Qing dynasties， the cultivation of Kuicai has been decreasing， while A. theophrasti is more common and easy to obtain， and Abutili Semen and Malvae Semen are similar in morphology and confused， which should be corrected. In addition， Malvae Fructus is a Mongolian customary medicinal herb， which is different from the traditional use of seeds in traditional Chinese medicine. Kuicai， as an important vegetable in history， was widely cultivated and gradually shrunk after the Song dynasty， it is now mainly produced in southern provinces. The quality evaluation of Malvae Semen is better for those with dry bodies， full grain， grayish brown color， no mud， and no impurities. The harvesting is generally in the autumn and winter. After drying， it is seeded， sieved peel and impurities， mashed， or slightly stir-fried to yellow-white color with gentle fire. It is sweet， cold and slippery in nature and taste， with the main effects of laxation， diuresis， lactation and elimination of swelling. The efficacy of Abutili Semen is clearing heat and removing toxicity， promoting diuresis and removing nebula， the efficacy is quite different from that of Malvae Semen. Based on the results of textual research， it is suggested that M. verticillata var. crispa should be used as the medicinal source of Malvae Semen in the development of famous classical formulas， the corresponding processing methods should be selected according to the requirements of drug processing in the formulas， while the raw products are recommended to be used if the processing is not specified.