AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveThis paper aims to observe the protective effect of Huamoyan granules on knee osteoarthritis （KOA） and explore whether its protective effect is oriented toward an anti-inflammatory direction by regulation of macrophage polarization， which can effectively inhibit the progression of pathological inflammatory response， reduce the release of inflammatory pain mediators， and downregulate the protein expression level of transient receptor potential vanilloid 1 （TRPV1）， so as to provide experimental evidence for its clinical application and investigate its action mechanism. MethodsAfter adaptive feeding， Sprague-Dawley （SD） rats were randomly divided into six groups： sham group， model group， celecoxib group， and high， medium， and low-dose synovitis granule groups （9.6， 4.8， 2.4 g·kg^-1）. The administration dose of celecoxib capsules was 20 mg·kg^-1. There were 10 rats in the sham group and 12 rats in the model group and each administration group. A KOA animal model was established by means of intra-articular injection of sodium iodoacetate into the knee joint. From the 10^th day of the experiment， each administration group was given intragastric administration at a dose of 10 mL·kg^-1 for 4 weeks. General conditions of rats in each group were assessed daily. The pressure pain threshold （PPT） to mechanical stimulation and joint diameter were recorded. X-ray examination was performed on the right knee joints of rats for imaging analysis. Enzyme linked immunosorbent assay （ELISA） was performed to detect the tumor necrosis factor-α （TNF-α）， serum interleukin-1β （IL-1β）， and other pro-inflammatory cytokines in rat serum samples， as well as the expression levels of neurogenic inflammatory mediators such as nerve growth factor （NGF） and calcitonin gene-related peptide （CGRP）. Histopathological changes in the knee joint synovial tissues were examined by hematoxylineosin （HE） staining. Safranin O-fast green staining was performed to observe and evaluate the degree of knee cartilage lesions. Western blot was employed to quantitatively analyze TRPV1， p38 mitogen-activated protein kinase （p38 MAPK）， and phosphorylated （p）-p38 MAPK in rat knee synovial tissues. Immunofluorescence （IF） was used to measure and assess M1/M2 macrophage polarization. ResultsCompared with those in the sham group， the circumference and joint diameter of the right knee were markedly enlarged in the model group （P<0.01）， while PPTs of rats showed a significant reduction （P<0.01）. The contents of IL-1β， TNF-α， CGRP， and NGF in rats' serum were significantly elevated （P<0.01）， and the synovial Krenn score was increased （P<0.01）. The Mankin score of cartilage tissue was increased （P<0.01）， and the protein expressions of TRPV1 and p-p38 MAPK/p38 MAPK were significantly upregulated （P<0.01）. The experimental intervention significantly reduced the proportion of pro-inflammatory M1 macrophages in the total macrophage population （P<0.01）， and the percentage of M2 macrophages was decreased （P<0.01）. The M1/M2 macrophage ratio was significantly elevated （P<0.01）. Knee joint diameters of all dose groups of Huamoyan granules and the celecoxib group were reduced （P<0.01） compared with those of the model group， and the PPT recovery speeds in the high and medium-dose groups of Huamoyan granules were more obvious （P<0.05）. The contents of IL-1β， CGRP， and NGF in the rats' serum in all administration groups were significantly reduced （P<0.05， P<0.01）， and the content of TNF-α in rats' serum was significantly reduced （P<0.01）. All dose groups of Huamoyan granules demonstrated significant reductions in both synovial Krenn score （P<0.05， P<0.01） and protein expression of TRPV1 and p-p38 MAPK/p38 MAPK in rats' synovial tissues （P<0.01）. The percentage of M1 macrophages in the synovial tissues of the celecoxib group and all dose groups of Huamoyan granules was decreased （P<0.01）. The percentage of M2 macrophages was increased （P<0.05）， and the M1/M2 ratio was decreased （P<0.01）. ConclusionHuamoyan granules can alleviate the inflammatory response of KOA， reduce the release of inflammatory pain mediators， and downregulate TRPV1 protein expression by regulating macrophage polarization. Its mechanism may be related to the TRPV1/p38 MAPK signaling pathway， thereby achieving the effect of improving peripheral pain hypersensitivity in KOA.

Objective To analyze the burden and epidemic trends of gastric cancer in China from 1990 to 2021, and to provide a scientific basis for the formulation of effective prevention and control strategies. Methods　Data from the 2021 Global Burden of Disease (GBD) database were used to extract the number of the incidence, prevalence, and death cases, as well as the disability-adjusted life years (DALY) for gastric cancer in China from 1990 to 2021. The corresponding crude rates and age-standardized rates were calculated. The Joinpoint regression model was employed to analyze the trends in the burden of gastric cancer, and a comprehensive examination was conducted from multiple dimensions including age, gender, and time. Results From 1990 to 2021, the age-standardized incidence rate (ASIR) of gastric cancer in China decreased from 48.03 per 100,000 to 29.05 per 100,000, the age-standardized prevalence rate (ASPR) decreased from 67.17 per 100,000 to 57.23 per 100,000, the age-standardized mortality rate (ASMR) decreased from 46.05 per 100,000 to 21.51 per 100,000, and the age-standardized DALY rate (ASDR) decreased from 1181.61 per 100,000 to 501.26 per 100,000. The AAPCs of ASIR, ASPR, ASMR, and ASDR were -1.61%, -0.50%, -2.44%, and -2.75%, respectively. The incidence, prevalence, mortality and DALY rates showed a trend of increasing first and then decreasing with age. Although females had higher incidence, prevalence, mortality, and DALY numbers in the older age groups, males exhibited higher crude rates across all age groups. Conclusion　The overall disease burden of gastric cancer in China showed a downward trend from 1990 to 2021, and men and middle-aged and elderly people are the key populations for prevention and control efforts.

The analysis presented here is based on the blood components of Guanxin Qiwei tablets, the key anti-atherosclerosis pathway of Guanxin Qiwei tablets was screened by network pharmacology, and the anti-atherosclerosis mechanism of Guanxin Qiwei tablets was clarified and verified by cell experiments. HPLC-Q-Exactive-MS/MS technique was used to analyze the components of Guanxin Qiwei tablets into blood, to determine the precise mass charge ratio of the compounds, and to conduct a comprehensive analysis of the components by using secondary mass spectrometry fragments and literature comparison. Finally, a total of 42 components of Guanxin Qiwei tablets into blood were identified. To better understand the interactions, we employed the Swiss Target Prediction database to predict the associated targets. Atherosclerosis (AS) disease targets were searched in disease databases Genecard, OMIM and Disgent, and 181 intersection targets of disease targets and component targets were obtained by Venny 2.1.0 software. Protein interactions were analyzed by String database. The 32 core targets were selected by Cytscape software. Gene Ontology (GO) enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis were performed in DAVID database. It was found that the anti-atherosclerosis pathways of Guanxin Qiwei tablets mainly include lipid metabolism and atherosclerosis and AGE-RAGE signaling pathway in diabetic complications and other signal pathways. The core targets and the core compounds were interlinked, and it was found that cryptotanshinone and tanshinone ⅡA in Guanxin Qiwei tablets were well bound to TNF, PPARγ, AKT1, PTG2 and other targets. The lipid metabolism and atherosclerotic pathway was verified using human hl-7702 hepatocytes. This study preliminarily identified the potential pharmacodynamic components of Guanxin Qiwei tablets in the treatment of AS diseases and predicted their pathways of action, and verified the relationship between regulating lipid metabolism and atherosclerosis of Guanxin Qiwei tablets in vitro, providing a reference for the further study of the pharmacodynamic material basis and mechanism of action of this prescription. This experiment was approved by the Medical Ethics Committee of Inner Mongolia Medical University (No. YKD202401262).

OBJECTIVE: We aimed to investigate the patterns of fasting blood glucose (FBG) trajectories and analyze the relationship between various occupational hazard factors and FBG trajectories in male steelworkers. METHODS: The study cohort included 3,728 workers who met the selection criteria for the Tanggang Occupational Cohort (TGOC) between 2017 and 2022. A group-based trajectory model was used to identify the FBG trajectories. Environmental risk scores (ERS) were constructed using regression coefficients from the occupational hazard model as weights. Univariate and multivariate logistic regression analyses were performed to explore the effects of occupational hazard factors using the ERS on FBG trajectories. RESULTS: FBG trajectories were categorized into three groups. An association was observed between high temperature, noise exposure, and FBG trajectory ( P < 0.05). Using the first quartile group of ERS1 as a reference, the fourth quartile group of ERS1 had an increased risk of medium and high FBG by 1.90 and 2.21 times, respectively (odds ratio [ OR] = 1.90, 95% confidence interval [ CI]: 1.17-3.10; OR = 2.21, 95% CI: 1.09-4.45). CONCLUSION An association was observed between occupational hazards based on ERS and FBG trajectories. The risk of FBG trajectory levels increase with an increase in ERS.
Humans ; Male ; Adult ; Blood Glucose/analysis* ; China ; Prospective Studies ; Occupational Exposure/adverse effects* ; Risk Factors ; Middle Aged ; Steel ; Fasting/blood* ; Metal Workers ; East Asian People

OBJECTIVE: Cigarette smoking exacerbates the progression of pulmonary tuberculosis (TB). The role of tertiary lymphoid structures (TLS) in chronic lung diseases has gained attention; however, it remains unclear whether smoking-exacerbated lung damage in TB is associated with TLS. This study aimed to analyze the characteristics of pulmonary TLS in smokers with TB and to explore the possible role of TLS in smoking-related lung injury in TB. METHODS: Lung tissues from 36 male patients (18 smokers and 18 non-smokers) who underwent surgical resection for pulmonary TB were included in this study. Pathological and immunohistological analyses were conducted to evaluate the quantity of TLS, and chest computed tomography (CT) was used to assess the severity of lung lesions. The correlation between the TLS quantity and TB lesion severity scores was analyzed. The immune cells and chemokines involved in TLS formation were also evaluated and compared between smokers and non-smokers. RESULTS: Smoker patients with TB had significantly higher TLS than non-smokers ( P < 0.001). The TLS quantity in both the lung parenchyma and peribronchial regions correlated with TB lesion severity on chest CT (parenchyma: r = 0.5767; peribronchial: r = 0.7373; both P < 0.001). Immunohistochemical analysis showed increased B cells, T cells, and C-X-C motif chemokine ligand 13 (CXCL13) expression in smoker patients with TB ( P < 0.001). CONCLUSION Smoker TB patients exhibited increased pulmonary TLS, which was associated with exacerbated lung lesions on chest CT, suggesting that cigarette smoking may exacerbate lung damage by promoting TLS formation.
Humans ; Male ; Tuberculosis, Pulmonary/immunology* ; Middle Aged ; Tertiary Lymphoid Structures/pathology* ; Adult ; Lung/pathology* ; Smoking/adverse effects* ; Smokers ; Aged ; Tomography, X-Ray Computed

CD20 is a surface marker protein of B-cell lymphoma, and its extracellular region is the target of specific antibodies and drugs. To obtain a cheap and easily modified specific preparation targeting CD20, we optimized the gene of CD20 extracellular region according to codon degeneracy to facilitate its expression in Escherichia coli. The optimized gene was cloned into pGEX-4T-1 vector, and the recombinant vector was transformed into E. coli BL21(DE3) for expression. The purified protein was identified by SDS-PAGE and Western blotting. Systematic evolution of ligands by exponential enrichment (SELEX) was employed to screen the ssDNA aptamer that specifically binds to the fusion protein, and the affinity of the aptamer to CD20 was detected by flow cytometry. Then, the cytotoxicity test was carried out to examine the inhibitory effect of the aptamer on B lymphoma cells. In this study, we established the prokaryotic expression method of CD20 and obtained the aptamer specifically binding to the extracellular region of CD20, which laid a foundation for the development of therapeutic drugs targeting CD20.
Humans ; Escherichia coli/metabolism* ; SELEX Aptamer Technique/methods* ; Aptamers, Nucleotide/genetics* ; Antigens, CD20/metabolism* ; Ligands

This study systematically reviewed the randomized controlled trial(RCT) of traditional Chinese medicine(TCM) treatment of post-stroke depression(PSD) and analyzed the clinical study characteristics and outcome indicators, aiming to optimize the design and establish the core outcome set in the future clinical trials of the TCM treatment of PSD. PubMed, Web of Science, Cochrane Library, EMbase, CNKI, VIP, Wanfang, and SinoMed were searched for the relevant RCT published in recent 3 years. The basic characteristics, intervention measures, and outcome indicators of the included RCT were extracted, and the descriptive analysis was carried out. A total of 76 RCTs were eventually included, with the sample size concentrated in 80-100 cases. The most frequent TCM syndromes were liver depression and Qi stagnation(15 times, 31.91%) and phlegm combined with stasis(5 times, 10.63%). The frequency of intervention methods followed a descending trend of TCM decoction(35 times, 46.05%) and TCM decoction + acupuncture(4 times, 5.26%), Chinese patent medicine(3 times, 3.94%), and the intervention mainly lasted for 1 to 3 months(43 times, 60.56%). The adverse reactions of patients were mainly digestive system reaction(150 patients, 39.37%) and nervous system reaction(112 patients, 29.39%). Most of the included studies had unclear risk of bias, involving 84 outcome indicators, which belonged to 8 indicator domains. The RCTs of TCM treatment of PSD showed a variety of problems, such as non-standard TCM syndrome differentiation, inconsistent names of TCM syndrome scores and measurement tools, low quality, unclear risk of bias, neglect of endpoint indicators, unreasonable selection of substitute indicators, lack of differentiation between primary and secondary outcome indicators, non-standard reporting of safety indicators, insufficient attention to economic indicators, and lack of long-term prognosis evaluation. It is suggested that the future research should improve the quality of methodology and build a standardized core outcome set to promote the development of high-quality clinical research in this field.
Humans ; Randomized Controlled Trials as Topic ; Drugs, Chinese Herbal/administration & dosage* ; Stroke/psychology* ; Depression/etiology* ; Treatment Outcome ; Medicine, Chinese Traditional

Fermented traditional Chinese medicine(TCM) has a long history of medicinal use, such as Sojae Semen Praeparatum, Arisaema Cum Bile, Pinelliae Rhizoma Fermentata, red yeast rice, and Jianqu. Fermentation technology was recorded in the earliest TCM work, Shen Nong's Classic of the Materia Medica. Microorganisms are essential components of the fermentation process. However, the contamination of fermented TCM by toxigenic fungi and mycotoxins due to unstandardized fermentation processes seriously affects the quality of TCM and poses a threat to the life and health of consumers. In this paper, the characteristics, microbial composition, and mycotoxin profile of fermented TCM are systematically summarized to provide a theoretical basis for its quality and safety control.
Fermentation ; Mycotoxins/analysis* ; Drugs, Chinese Herbal/analysis* ; Fungi/classification* ; Bacteria/genetics* ; Drug Contamination ; Medicine, Chinese Traditional