AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

The analysis presented here is based on the blood components of Guanxin Qiwei tablets, the key anti-atherosclerosis pathway of Guanxin Qiwei tablets was screened by network pharmacology, and the anti-atherosclerosis mechanism of Guanxin Qiwei tablets was clarified and verified by cell experiments. HPLC-Q-Exactive-MS/MS technique was used to analyze the components of Guanxin Qiwei tablets into blood, to determine the precise mass charge ratio of the compounds, and to conduct a comprehensive analysis of the components by using secondary mass spectrometry fragments and literature comparison. Finally, a total of 42 components of Guanxin Qiwei tablets into blood were identified. To better understand the interactions, we employed the Swiss Target Prediction database to predict the associated targets. Atherosclerosis (AS) disease targets were searched in disease databases Genecard, OMIM and Disgent, and 181 intersection targets of disease targets and component targets were obtained by Venny 2.1.0 software. Protein interactions were analyzed by String database. The 32 core targets were selected by Cytscape software. Gene Ontology (GO) enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis were performed in DAVID database. It was found that the anti-atherosclerosis pathways of Guanxin Qiwei tablets mainly include lipid metabolism and atherosclerosis and AGE-RAGE signaling pathway in diabetic complications and other signal pathways. The core targets and the core compounds were interlinked, and it was found that cryptotanshinone and tanshinone ⅡA in Guanxin Qiwei tablets were well bound to TNF, PPARγ, AKT1, PTG2 and other targets. The lipid metabolism and atherosclerotic pathway was verified using human hl-7702 hepatocytes. This study preliminarily identified the potential pharmacodynamic components of Guanxin Qiwei tablets in the treatment of AS diseases and predicted their pathways of action, and verified the relationship between regulating lipid metabolism and atherosclerosis of Guanxin Qiwei tablets in vitro, providing a reference for the further study of the pharmacodynamic material basis and mechanism of action of this prescription. This experiment was approved by the Medical Ethics Committee of Inner Mongolia Medical University (No. YKD202401262).

Objective To analyze the burden and epidemic trends of gastric cancer in China from 1990 to 2021, and to provide a scientific basis for the formulation of effective prevention and control strategies. Methods　Data from the 2021 Global Burden of Disease (GBD) database were used to extract the number of the incidence, prevalence, and death cases, as well as the disability-adjusted life years (DALY) for gastric cancer in China from 1990 to 2021. The corresponding crude rates and age-standardized rates were calculated. The Joinpoint regression model was employed to analyze the trends in the burden of gastric cancer, and a comprehensive examination was conducted from multiple dimensions including age, gender, and time. Results From 1990 to 2021, the age-standardized incidence rate (ASIR) of gastric cancer in China decreased from 48.03 per 100,000 to 29.05 per 100,000, the age-standardized prevalence rate (ASPR) decreased from 67.17 per 100,000 to 57.23 per 100,000, the age-standardized mortality rate (ASMR) decreased from 46.05 per 100,000 to 21.51 per 100,000, and the age-standardized DALY rate (ASDR) decreased from 1181.61 per 100,000 to 501.26 per 100,000. The AAPCs of ASIR, ASPR, ASMR, and ASDR were -1.61%, -0.50%, -2.44%, and -2.75%, respectively. The incidence, prevalence, mortality and DALY rates showed a trend of increasing first and then decreasing with age. Although females had higher incidence, prevalence, mortality, and DALY numbers in the older age groups, males exhibited higher crude rates across all age groups. Conclusion　The overall disease burden of gastric cancer in China showed a downward trend from 1990 to 2021, and men and middle-aged and elderly people are the key populations for prevention and control efforts.

This study systematically reviewed the randomized controlled trial(RCT) of traditional Chinese medicine(TCM) treatment of post-stroke depression(PSD) and analyzed the clinical study characteristics and outcome indicators, aiming to optimize the design and establish the core outcome set in the future clinical trials of the TCM treatment of PSD. PubMed, Web of Science, Cochrane Library, EMbase, CNKI, VIP, Wanfang, and SinoMed were searched for the relevant RCT published in recent 3 years. The basic characteristics, intervention measures, and outcome indicators of the included RCT were extracted, and the descriptive analysis was carried out. A total of 76 RCTs were eventually included, with the sample size concentrated in 80-100 cases. The most frequent TCM syndromes were liver depression and Qi stagnation(15 times, 31.91%) and phlegm combined with stasis(5 times, 10.63%). The frequency of intervention methods followed a descending trend of TCM decoction(35 times, 46.05%) and TCM decoction + acupuncture(4 times, 5.26%), Chinese patent medicine(3 times, 3.94%), and the intervention mainly lasted for 1 to 3 months(43 times, 60.56%). The adverse reactions of patients were mainly digestive system reaction(150 patients, 39.37%) and nervous system reaction(112 patients, 29.39%). Most of the included studies had unclear risk of bias, involving 84 outcome indicators, which belonged to 8 indicator domains. The RCTs of TCM treatment of PSD showed a variety of problems, such as non-standard TCM syndrome differentiation, inconsistent names of TCM syndrome scores and measurement tools, low quality, unclear risk of bias, neglect of endpoint indicators, unreasonable selection of substitute indicators, lack of differentiation between primary and secondary outcome indicators, non-standard reporting of safety indicators, insufficient attention to economic indicators, and lack of long-term prognosis evaluation. It is suggested that the future research should improve the quality of methodology and build a standardized core outcome set to promote the development of high-quality clinical research in this field.
Humans ; Randomized Controlled Trials as Topic ; Drugs, Chinese Herbal/administration & dosage* ; Stroke/psychology* ; Depression/etiology* ; Treatment Outcome ; Medicine, Chinese Traditional

Fermented traditional Chinese medicine(TCM) has a long history of medicinal use, such as Sojae Semen Praeparatum, Arisaema Cum Bile, Pinelliae Rhizoma Fermentata, red yeast rice, and Jianqu. Fermentation technology was recorded in the earliest TCM work, Shen Nong's Classic of the Materia Medica. Microorganisms are essential components of the fermentation process. However, the contamination of fermented TCM by toxigenic fungi and mycotoxins due to unstandardized fermentation processes seriously affects the quality of TCM and poses a threat to the life and health of consumers. In this paper, the characteristics, microbial composition, and mycotoxin profile of fermented TCM are systematically summarized to provide a theoretical basis for its quality and safety control.
Fermentation ; Mycotoxins/analysis* ; Drugs, Chinese Herbal/analysis* ; Fungi/classification* ; Bacteria/genetics* ; Drug Contamination ; Medicine, Chinese Traditional

This study aimed to compare the ameliorative effects of Lycii Fructus and Chrysanthemi Flos at different ratios on retinal damage in mice and to elucidate the underlying mechanisms. A retinal injury model was established by intraperitoneal injection of sodium iodate(NaIO_3) solution. The mice were divided into the following groups: blank group, model group, positive drug(AREDS 2) group, low-and high-dose groups of Lycii Fructus and Chrysanthemi Flos at 1∶1, low-and high-dose groups at 3∶1, and low-and high-dose groups at 1∶3. Administration was carried out 15 days after modeling. The visual acuity of the mice was assessed using the black-and-white box test. The fundus was observed using an optical coherence tomography device, and retinal thickness was measured. HE staining was used to observe the morphology and pathological changes of the retina. The levels of oxidative factors in serum and ocular tissues were measured using assay kits. The levels of inflammatory factors in serum and ocular tissues were detected by enzyme-linked immunosorbent assay(ELISA), and the expression of Nrf2, HO-1, and NF-κB proteins in ocular tissues was analyzed by Western blot. The results showed that after administration of Lycii Fructus and Chrysanthemi Flos at different ratios, the model group showed improved retinal thinning and disordered arrangement of retinal layers, elevated content of SOD and GSH in the serum and ocular tissues, and reduced levels of MDA, TNF-α, IL-1β, and IL-6. Lycii Fructus and Chrysanthemi Flos at 1∶1 and 1∶3 showed better improvement effects. The combination significantly upregulated the expression levels of Nrf2 and HO-1 and downregulated the expression of NF-κB p65. These results indicate that Lycii Fructus and Chrysanthemi Flos at different ratios can improve retinal damage, reduce oxidative stress, and alleviate inflammation in both the body and ocular tissues of mice. The mechanism may be related to the regulation of the Nrf2/HO-1 and NF-κB signaling pathways in ocular tissues. These findings provide a theoretical basis for the clinical application of Lycii Fructus and Chrysanthemi Flos in the treatment of dry age-related macular degeneration.
Animals ; Mice ; Retina/injuries* ; Male ; Lycium/chemistry* ; Drugs, Chinese Herbal/administration & dosage* ; Chrysanthemum/chemistry* ; NF-kappa B/genetics* ; Humans ; Retinal Diseases/metabolism* ; NF-E2-Related Factor 2/metabolism* ; Oxidative Stress/drug effects* ; Flowers/chemistry* ; Heme Oxygenase-1/genetics*

Many triterpenoid compounds have been successfully heterologously synthesized in Saccharomyces cerevisiae. To increase the yield of triterpenoids, various metabolic engineering strategies have been developed. One commonly applied strategy is to enhance the supply of precursors, which has been widely used by researchers. Squalene, as a precursor to triterpenoid biosynthesis, plays a crucial role in the synthesis of these compounds. This study primarily investigates the effect of different squalene levels in chassis strains on the synthesis of triterpenoids(oleanolic acid and ursolic acid), and the underlying mechanisms are further explored using real-time quantitative PCR(qPCR) analysis. The results demonstrate that the chassis strain CB-9-5, which produces high levels of squalene, inhibits the synthesis of oleanolic acid and ursolic acid. In contrast, chassis strains with moderate to low squalene production, such as Y8-1 and CNPK, are more conducive to the synthesis of oleanolic acid and ursolic acid. The qPCR analysis reveals that the expression levels of ERG1, βAS, and CrCYP716A154 in the oleanolic acid-producing strain CB-OA are significantly lower than those in the control strains C-OA and Y-OA, suggesting that high squalene production in the chassis strains suppresses the transcription of certain genes, leading to a reduced yield of triterpenoids. Our findings indicate that when constructing S. cerevisiae strains for triterpenoid production, chassis strains with high squalene content may suppress the expression of certain genes, ultimately lowering their production, whereas chassis strains with moderate squalene levels are more favorable for triterpenoid biosynthesis.
Squalene/analysis* ; Saccharomyces cerevisiae/genetics* ; Triterpenes/metabolism* ; Metabolic Engineering ; Oleanolic Acid/biosynthesis* ; Ursolic Acid

This study aims to evaluate the efficacy of Chinese medicine injections in treating transient ischemic attack(TIA) based on network Meta-analysis. Randomized controlled trial(RCT) about Chinese medicine injections in treating TIA were retrieved from PubMed, Web of Science, Cochrane Library, EMbase, CNKI, VIP, Wanfang, and SinoMed with the time interval from inception to March 1, 2024. The methodological quality of the included articles was assessed by ROB 2.0, and the GRADE system was employed to evaluate the quality of evidence. The gemtc package of R 4.1.2 was used to perform the network Meta-analysis. Finally, 63 RCTs with a total sample size of 5 750 cases were included, involving 11 Chinese medicine injections(Shuxuetong Injection, Danhong Injection, Shuxuening Injection, Ginkgo Damo Injection, Shenxiong Glucose Injection, Ligustrazine Injection, Salviae Miltiorrhizae and Ligustrazine Hydrochloride Injection, Salvianolic Acids for Injection, Dengzhan Xixin Injection, Guhong Injection, and Xueshuantong Injection). All patients received conventional western medicine treatment, and the experimental group was additionally treated with Chinese medicine injection. Network Meta-analysis yielded the following results.(1) In terms of improving the clinical total response rate, 11 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Dengzhan Xixin Injection + conventional western medicine had the best effect.(2) In terms of reducing plasma viscosity, 7 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Shenxiong Glucose Injection + conventional western medicine had the best effect.(3) In terms of reducing whole blood high shear viscosity, 6 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Guhong Injection + conventional western medicine had the best effect.(4) In terms of reducing whole blood low shear viscosity, 6 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Shuxuening Injection + conventional western medicine had the best effect.(5) In terms of reducing fibrinogen, 9 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Ginkgo Damo Injection + conventional western medicine had the best effect.(6) In terms of increasing the average blood flow velocity, 3 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Shuxuening Injection + conventional western medicine had the best effect. In summary, compared with conventional western medicine alone, Chinese medicine injections combined with conventional western medicine were effective in improving the clinical total response rate and the average blood flow velocity, as well as reducing plasma viscosity, whole blood high shear viscosity, whole blood low shear viscosity, and fibrinogen. However, due to the limited quality and quantity of the included articles, the above conclusions need to be verified by more high-quality, multi-center, and large-sample RCT.
Humans ; Drugs, Chinese Herbal/administration & dosage* ; Injections ; Ischemic Attack, Transient/drug therapy* ; Randomized Controlled Trials as Topic ; Treatment Outcome

OBJECTIVES: To investigate the clinical and immunological features of children with primary immune thrombocytopenia (pITP) or connective tissue disease (CTD) with thrombocytopenia as the initial manifestation at initial diagnosis, and to provide a basis for early differentiation. METHODS: A retrospective study was performed on 236 children with pITP (pITP group) or CTD with thrombocytopenia as the initial manifestation (CTD-TP group) who were admitted from January 2019 to August 2024. Clinical and immunological indicators were compared between the two groups to identify potential influencing factors for early differentiation and their discriminative validity. RESULTS: Compared with the pITP group, the CTD-TP group had a significantly older age of onset and significantly lower leukocyte count, eosinophil count, lymphocyte count, and complement C4 level (P<0.05), as well as significantly higher levels of C-reactive protein, IgE, and IgM (P<0.05). The logistic regression analysis showed that age, IgE, IgM, total B cells, and complement C4 were predictive factors for early differentiation between pITP and CTD-TP (P<0.05). The receiver operating characteristic curve analysis showed that a combination of these five factors had a good discriminative validity, with an area under the curve of 0.944. The correlation analysis showed a negative correlation between IgG and platelet count in the pITP group (r_s=-0.363, P<0.05) and a positive correlation between NK cells and platelet count in the CTD-TP group (r_s=0.713, P<0.05). CONCLUSIONS There is heterogeneity in the clinical and immunological indicators between children with pITP and CTD-TP at initial diagnosis, and these research findings can help with the early differentiation between the two diseases.
Purpura, Thrombocytopenic, Idiopathic/immunology* ; Diagnosis, Differential ; Connective Tissue Diseases/immunology* ; Retrospective Studies ; Early Diagnosis ; Age of Onset ; Leukocyte Count ; Complement C4/immunology* ; C-Reactive Protein/immunology* ; Immunoglobulin E/immunology* ; Immunoglobulin M/immunology* ; Humans ; Male ; Female ; Infant ; Child, Preschool ; Child ; Adolescent ; Biomarkers/blood*