OBJECTIVE To form an expert consensus on the clinical application of parenteral direct thrombin inhibitors （DTIs） in patients during the perioperative period. METHODS Led by Sichuan Academy of Medical Sciences & Sichuan Provincial People’s Hospital （the Affiliated Hospital of UESTC）， a multidisciplinary working group was established. Through literature review and the Delphi method， clinical questions related to the rational perioperative use of parenteral DTIs were identified. A structured design was adopted using the “Population-Intervention-Comparison-Outcome” framework； systematic searches were conducted in CNKI， Medline， Embase and other databases. Relevant evidence from randomized controlled trials and cohort studies was included and synthesized. Evidence quality was assessed using the Grades of Recommendations Assessment，Development and Evaluation （GRADE） approach， and recommendations were formulated through multiple rounds of Delphi surveys and expert consensus meetings. RESULTS &CONCLUSIONS Seven recommendations （each with an expert consensus rate exceeding 90%） on the use of parenteral DTIs in perioperative patients were developed. These recommendations specify drug selection， dosing ranges， key monitoring points， and safety management strategies for parenteral DTIs in various scenarios， including the perioperative period of ventricular assist device implantation， the perioperative period of cardiac surgery， perioperative patients with lower-extremity atherosclerotic disease， the perioperative period of percutaneous coronary intervention in patients with acute coronary syndrome， the perioperative period of carotid artery stenting in patients with carotid stenosis， the perioperative period of patients with right heart thrombosis， and patients who develop related thrombosis and dysfunction after a central venous catheter insertion. In addition， warning and management pathways for perioperative bleeding and thrombotic events were proposed. This expert consensus， which is formulated based on the best available evidence， provides evidence-based guidance for standardized and individualized use of parenteral DTIs in perioperative period.

ObjectiveDonkey hide is the sole legally designated raw material for the preparation of the traditional Chinese medicine Ejiao. The quality stability of donkey hide during preservation directly determines the efficacy and safety of Ejiao. This study focuses on the dynamic succession of microbial communities during the preservation of donkey hides from different origins, aiming to clarify the correlation between microbial biodiversity difference and the degradation profiles of hide collagen and critical biochemical components, thereby providing a theoretical foundation for developing targeted preservation strategies based on microbial regulation. MethodsDonkey hides originating from four different regions were subjected to an accelerated microbial aging assay to simulate the spoilage process. The microbial community succession was analyzed using high-throughput sequencing. Microstructure changes and pore structure characteristics were assessed by scanning electron microscopy and mercury intrusion porosimetry, respectively. Additionally, the content of major components, including lipids, proteins, and sugars were determined by biochemical methods. ResultsAfter 96 h of aging, the collagen fiber structure in Africa donkey hides (ADH) exhibited significant degradation and collapse, followed by Xinjiang donkey hides (XDH). Instead, the microstructure of Dong’e black donkey hides (DDH) and Peru donkey hides (PDH) remained relatively intact. The porosities of DDH, XDH, PDH, and ADH increased from 27.9%, 15.7%, 30.3%, and 46.2% to 36.5%, 52.6%, 42.8%, and 57.7%, respectively, during the aging process, which suggested that the originally compact fiber structure was disrupted by microbial aging. Fourier transform infrared spectrometer analysis revealed the amide bands in XDH exhibited relatively weak intensity, and no collagen amide I band was observed in ADH. Meanwhile, the lipid and protein contents decreased in all four types of donkey hides, indicating that these components served as the primary nutrient sources for the growth of microorganism. Notably, the most severe collagen degradation was observed in XDH and ADH. A substantial increase was detected in the total soluble sugar in PDH aging solution and hydroxyproline in the ADH aging solution, respectively. These results indicated that donkey hides exhibit distinct patterns of structural degradation and nutrient utilization. Furthermore, the viable cells number of donkey hides increased sharply after 48 h of aging. Metagenomic analysis revealed that the relative abundance of Euryarchaeota in ADH, PDH and XDH declining from initial 93.19%, 97.73% and 30.08% to 0.79%, 1.43% and 0.02% after 96 h, respectively. Conversely, a significantly increase was observed in the abundance of Bacillota, with a marked increase in ADH, peaking at 92.75%. Additionally, the abundance of Pseudomonadota in PDH increased from 0.10% to 87.84%, suggesting that Bacillota and Pseudomonadota may be key factors exacerbating donkey hide spoilage. Unlike the other three types of donkey hides, the dominant bacterial phylum in DDH shifted from Pseudomonadota to Bacteroidota, characterized by a substantial abundance increase of Bacteroidota from 0.13% to 44.22%. ConclusionRegional variation in origin significantly influence the microbial aging of donkey hides, leading to distinct patterns of structural deterioration and differential nutrient utilization. Therefore, implementing origin-specific preservation strategies, through the precisely controlling environmental factors to suppress harmful phyla such as Bacillota and Pseudomonadota, is crucial for enhancing the storage quality of donkey hides.

Objective:To explore the clinical characteristics, diagnosis and treatment strategies, and prognosis of pulmonary embolism (PE) complicating childhood rheumatic diseases.Methods:A retrospective case series study was performed on the demographic data, laboratory indicators, imaging features, treatment regimens, and follow-up data of 8 children with rheumatic diseases complicated by PE who were admitted to the Department of Rheumatology and Immunology, Capital Center for Children′s Health, Capital Medical University from January 2014 to October 2023.Results:Among the 8 children, there were 4 boys and 4 girls, with an age of 12.0 (7.5, 13.0) years. Among the primary diseases, there were 3 cases of systemic lupus erythematosus, 2 cases of Beh?et′s disease, 2 cases of Takayasu arteritis, and 1 case of antiphospholipid syndrome. All children developed PE during the active phase of the primary disease. PE was detected at the onset of the primary disease in 3 cases, and the median time from the diagnosis of the primary disease to the development of PE was 10.0 (6.0, 25.0) months in the remaining 5 cases. Fever was present in all 8 children, 4 cases were accompanied by chest tightness, dyspnea, etc., and 2 cases only presented with fever. Laboratory examinations revealed the following results: erythrocyte sedimentation rate was 42.0 (17.0, 78.0) mm/1 h, high-sensitivity C-reactive protein was 12.7 (2.6, 78.7) mg/L, white blood cell count was 9.6 (7.2, 18.7)×10 9/L; D-dimer was 2.3 (0.9, 6.2) mg/L; and hemoglobin was (109±16) g/L.Imaging examinations revealed that 5 cases had involvement of the bilateral lower pulmonary arteries, 5 cases had peripheral embolism, and 3 cases had central PE. Complications included 3 cases of deep vein thrombosis, 2 cases of intracranial venous sinus thrombosis, and 1 case of mild pulmonary hypertension.In terms of treatment, 7 cases received anticoagulation with heparin followed by warfarin. Immunomodulation was mainly based on glucocorticoids combined with immunosuppressants, and 4 cases were combined with biological agents. The follow-up time of 4.17 (1.75, 7.17) years, the time for complete absorption of PE was 10.5 (6.0, 18.0) months; all 8 children had no target events, with no recurrence or chronic thromboembolic pulmonary hypertension, and the pulmonary artery remodeling was good. Conclusions:PE complicating childhood rheumatic diseases is closely related to the activity of the primary disease. The clinical manifestations are insidious, with fever as the main symptom. Imaging examination is the key to diagnosis.Early adoption of heparin followed by warfarin anticoagulation and glucocorticoids combined with immunosuppressants and (or) biological agents to control the primary disease can achieve a favorable prognosis.

ObjectiveThis paper aims to observe the protective effect of Huamoyan granules on knee osteoarthritis （KOA） and explore whether its protective effect is oriented toward an anti-inflammatory direction by regulation of macrophage polarization， which can effectively inhibit the progression of pathological inflammatory response， reduce the release of inflammatory pain mediators， and downregulate the protein expression level of transient receptor potential vanilloid 1 （TRPV1）， so as to provide experimental evidence for its clinical application and investigate its action mechanism. MethodsAfter adaptive feeding， Sprague-Dawley （SD） rats were randomly divided into six groups： sham group， model group， celecoxib group， and high， medium， and low-dose synovitis granule groups （9.6， 4.8， 2.4 g·kg^-1）. The administration dose of celecoxib capsules was 20 mg·kg^-1. There were 10 rats in the sham group and 12 rats in the model group and each administration group. A KOA animal model was established by means of intra-articular injection of sodium iodoacetate into the knee joint. From the 10^th day of the experiment， each administration group was given intragastric administration at a dose of 10 mL·kg^-1 for 4 weeks. General conditions of rats in each group were assessed daily. The pressure pain threshold （PPT） to mechanical stimulation and joint diameter were recorded. X-ray examination was performed on the right knee joints of rats for imaging analysis. Enzyme linked immunosorbent assay （ELISA） was performed to detect the tumor necrosis factor-α （TNF-α）， serum interleukin-1β （IL-1β）， and other pro-inflammatory cytokines in rat serum samples， as well as the expression levels of neurogenic inflammatory mediators such as nerve growth factor （NGF） and calcitonin gene-related peptide （CGRP）. Histopathological changes in the knee joint synovial tissues were examined by hematoxylineosin （HE） staining. Safranin O-fast green staining was performed to observe and evaluate the degree of knee cartilage lesions. Western blot was employed to quantitatively analyze TRPV1， p38 mitogen-activated protein kinase （p38 MAPK）， and phosphorylated （p）-p38 MAPK in rat knee synovial tissues. Immunofluorescence （IF） was used to measure and assess M1/M2 macrophage polarization. ResultsCompared with those in the sham group， the circumference and joint diameter of the right knee were markedly enlarged in the model group （P<0.01）， while PPTs of rats showed a significant reduction （P<0.01）. The contents of IL-1β， TNF-α， CGRP， and NGF in rats' serum were significantly elevated （P<0.01）， and the synovial Krenn score was increased （P<0.01）. The Mankin score of cartilage tissue was increased （P<0.01）， and the protein expressions of TRPV1 and p-p38 MAPK/p38 MAPK were significantly upregulated （P<0.01）. The experimental intervention significantly reduced the proportion of pro-inflammatory M1 macrophages in the total macrophage population （P<0.01）， and the percentage of M2 macrophages was decreased （P<0.01）. The M1/M2 macrophage ratio was significantly elevated （P<0.01）. Knee joint diameters of all dose groups of Huamoyan granules and the celecoxib group were reduced （P<0.01） compared with those of the model group， and the PPT recovery speeds in the high and medium-dose groups of Huamoyan granules were more obvious （P<0.05）. The contents of IL-1β， CGRP， and NGF in the rats' serum in all administration groups were significantly reduced （P<0.05， P<0.01）， and the content of TNF-α in rats' serum was significantly reduced （P<0.01）. All dose groups of Huamoyan granules demonstrated significant reductions in both synovial Krenn score （P<0.05， P<0.01） and protein expression of TRPV1 and p-p38 MAPK/p38 MAPK in rats' synovial tissues （P<0.01）. The percentage of M1 macrophages in the synovial tissues of the celecoxib group and all dose groups of Huamoyan granules was decreased （P<0.01）. The percentage of M2 macrophages was increased （P<0.05）， and the M1/M2 ratio was decreased （P<0.01）. ConclusionHuamoyan granules can alleviate the inflammatory response of KOA， reduce the release of inflammatory pain mediators， and downregulate TRPV1 protein expression by regulating macrophage polarization. Its mechanism may be related to the TRPV1/p38 MAPK signaling pathway， thereby achieving the effect of improving peripheral pain hypersensitivity in KOA.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective:To explore the clinical characteristics, diagnosis and treatment strategies, and prognosis of pulmonary embolism (PE) complicating childhood rheumatic diseases.Methods:A retrospective case series study was performed on the demographic data, laboratory indicators, imaging features, treatment regimens, and follow-up data of 8 children with rheumatic diseases complicated by PE who were admitted to the Department of Rheumatology and Immunology, Capital Center for Children′s Health, Capital Medical University from January 2014 to October 2023.Results:Among the 8 children, there were 4 boys and 4 girls, with an age of 12.0 (7.5, 13.0) years. Among the primary diseases, there were 3 cases of systemic lupus erythematosus, 2 cases of Beh?et′s disease, 2 cases of Takayasu arteritis, and 1 case of antiphospholipid syndrome. All children developed PE during the active phase of the primary disease. PE was detected at the onset of the primary disease in 3 cases, and the median time from the diagnosis of the primary disease to the development of PE was 10.0 (6.0, 25.0) months in the remaining 5 cases. Fever was present in all 8 children, 4 cases were accompanied by chest tightness, dyspnea, etc., and 2 cases only presented with fever. Laboratory examinations revealed the following results: erythrocyte sedimentation rate was 42.0 (17.0, 78.0) mm/1 h, high-sensitivity C-reactive protein was 12.7 (2.6, 78.7) mg/L, white blood cell count was 9.6 (7.2, 18.7)×10 9/L; D-dimer was 2.3 (0.9, 6.2) mg/L; and hemoglobin was (109±16) g/L.Imaging examinations revealed that 5 cases had involvement of the bilateral lower pulmonary arteries, 5 cases had peripheral embolism, and 3 cases had central PE. Complications included 3 cases of deep vein thrombosis, 2 cases of intracranial venous sinus thrombosis, and 1 case of mild pulmonary hypertension.In terms of treatment, 7 cases received anticoagulation with heparin followed by warfarin. Immunomodulation was mainly based on glucocorticoids combined with immunosuppressants, and 4 cases were combined with biological agents. The follow-up time of 4.17 (1.75, 7.17) years, the time for complete absorption of PE was 10.5 (6.0, 18.0) months; all 8 children had no target events, with no recurrence or chronic thromboembolic pulmonary hypertension, and the pulmonary artery remodeling was good. Conclusions:PE complicating childhood rheumatic diseases is closely related to the activity of the primary disease. The clinical manifestations are insidious, with fever as the main symptom. Imaging examination is the key to diagnosis.Early adoption of heparin followed by warfarin anticoagulation and glucocorticoids combined with immunosuppressants and (or) biological agents to control the primary disease can achieve a favorable prognosis.

Objective To summarize the changing prevalence of carbapenem resistance in Enterobacterales based on the data of CHINET Antimicrobial Resistance Surveillance Program from 2015 to 2021 for improving antimicrobial treatment in clinical practice.Methods Antimicrobial susceptibility testing was performed using a commercial automated susceptibility testing system according to the unified CHINET protocol.The results were interpreted according to the breakpoints of the Clinical & Laboratory Standards Institute(CLSI)M100 31st ed in 2021.Results Over the seven-year period(2015-2021),the overall prevalence of carbapenem-resistant Enterobacterales(CRE)was 9.43％(62 342/661 235).The prevalence of CRE strains in Klebsiella pneumoniae,Citrobacter freundii,and Enterobacter cloacae was 22.38％,9.73％,and 8.47％,respectively.The prevalence of CRE strains in Escherichia coli was 1.99％.A few CRE strains were also identified in Salmonella and Shigella.The CRE strains were mainly isolated from respiratory specimens(44.23±2.80)％,followed by blood(20.88±3.40)％and urine(18.40±3.45)％.Intensive care units(ICUs)were the major source of the CRE strains(27.43±5.20)％.CRE strains were resistant to all the β-lactam antibiotics tested and most non-β-lactam antimicrobial agents.The CRE strains were relatively susceptible to tigecycline and polymyxins with low resistance rates.Conclusions The prevalence of CRE strains was increasing from 2015 to 2021.CRE strains were highly resistant to most of the antibacterial drugs used in clinical practice.Clinicians should prescribe antimicrobial agents rationally.Hospitals should strengthen antibiotic stewardship in key clinical settings such as ICUs,and take effective infection control measures to curb CRE outbreak and epidemic in hospitals.

Objective To characterize the changing species distribution and antibiotic resistance profiles of respiratory isolates in hospitals participating in the CHINET Antimicrobial Resistance Surveillance Program from 2015 to 2021.Methods Commercial automated antimicrobial susceptibility testing systems and disk diffusion method were used to test the susceptibility of respiratory bacterial isolates to antimicrobial agents following the standardized technical protocol established by the CHINET program.Results A total of 589 746 respiratory isolates were collected from 2015 to 2021.Overall,82.6％of the isolates were Gram-negative bacteria and 17.4％were Gram-positive bacteria.The bacterial isolates from outpatients and inpatients accounted for(6.0±0.9)％and(94.0±0.1)％,respectively.The top microorganisms were Klebsiella spp.,Acinetobacter spp.,Pseudomonas aeruginosa,Staphylococcus aureus,Haemophilus spp.,Stenotrophomonas maltophilia,Escherichia coli,and Streptococcus pneumoniae.Each microorganism was isolated from significantly more males than from females(P＜0.05).The overall prevalence of methicillin-resistant S.aureus(MRSA)was 39.9％.The prevalence of penicillin-resistant S.pneumoniae was 1.4％.The prevalence of extended-spectrum β-lactamase(ESBL)-producing E.coli and K.pneumoniae was 67.8％and 41.3％,respectively.The overall prevalence of carbapenem-resistant E.coli,K.pneumoniae,Enterobacter cloacae,Pseudomonas aeruginosa,and Acinetobacter baumannii was 3.7％,20.8％,9.4％,29.8％,and 73.3％,respectively.The prevalence of β-lactamase was 96.1％in Moraxella catarrhalis and 60.0％in Haemophilus influenzae.The H.influenzae isolates from children(＜18 years)showed significantly higher resistance rates to β-lactam antibiotics than the isolates from adults(P＜0.05).Conclusions Gram-negative bacteria are still predominant in respiratory isolates associated with serious antibiotic resistance.Antimicrobial resistance surveillance should be strengthened in clinical practice to support accurate etiological diagnosis and appropriate antimicrobial therapy based on antimicrobial susceptibility testing results.

The high pathogenicity and mortality of respiratory viral infections pose a significant clinical burden.Due to the high de-gree of variability of viral proteins,some current targeted drugs are highly susceptible to drug resistance,and there is an urgent need for the development of effective therapeutic strategies.Glycoconjugates are widely distributed in hosts and viruses,and participate in host-virus interactions,viral replication,innate and adaptive immunity,etc.Aberrant glycosylation is involved in the pathogenesis of a vari-ety of diseases,and anti-respiratory viral strategies targeting glycosylation have the advantages of high specificity,low drug resistance,and broad-spectrum.In recent years,traditional Chinese medicines(TCMs)have shown unique potential in intervening in glycosylation-related antiviral fields due to their multi-target regulatory properties.The aim of this paper is to focus on the biological functions of glycosylation modifications,the research progress of virus infection and potential TCM monomers targeting glycosylation,which not only reveals the scientific connotation of TCM regulation of glycosylation,but also provides a natural molecular library for the development of novel antiviral strategies based on glycosylation intervention.In the future,it is necessary to further combine the tech-niques of glycomics and structural biology to elucidate the precise mechanism of spatial and temporal dynamics of TCM monomers in regulating glycosylation,and to promote the modernization of TCM.

Objective:To investigate the clinical features and multi-slice spiral computed tomography(CT)imaging features of acute appendicitis in soldiers who have been living in plateau for a long time.Methods:The clinical features and imaging data of 56 cases of acute appendicitis in soldiers who have been living in plateau for a long time confirmed by surgery from February 2022 to August 2024 were retrospectively analyzed.Results:In 56 cases with acute appendicitis in soldiers who have been living in plateau for a long time,the appendectomy position results showed:anterior ileum 4 cases(7.14％),lower ileum 10 cases(17.86％),posterior cecum 16 cases(28.57％),lower cecum 9 cases(16.07％),lateral cecum 2 cases(3.58％),posterior ileum 6 cases(10.71％),high(subhepatic)9 cases(16.07％),and left lower abdominal 0 cases,retroperitoneal appendicitis 0 cases,which was suggested that the anatomical position variation of appendicitis in soldiers with acute appendicitis who have been living at high altitude for a long time was relatively large.The direct manifestations of multi-slice spiral CT showed:appendectomy enlarged diameter＞6 mm in 49 cases(87.50％),appendicular wall thickening＞2 mm in 42 cases(75.00％),ppendiceal dilation lumen and effusion in 29 cases(51.79％),appendix indistinctness in 3 cases(5.36％),lppendix fecalith:27 cases(48.21％),gas in the appendix in 16 cases(28.57％).Indirect findings of multi-slice spiral CT showed that,periappendiceal exudation with shadow in 32 cases(57.14％),appendiceal cellulitis with peripheral abscess in 9 cases(16.07％),peritonitis and ascites in 13 cases(23.21％),ileocecal intestinal wall thickening in 22 cases(39.29％),mesenteric lymph node enlargement in 16 cases(28.57％),reflexive intestinal stasis in ileocecal region was observed in 19 cases(33.93％).Conclusion:In the officers and soldiers with acute appendicitis who lived at high altitude for a long time,multi-slice spiral CT showed the direct manifestations of appendiceal thickening,tube wall thickening,lumen dilatation,fluid accumulation,etc.,and the indirect manifestations were periappendiceal exudation with shadow,appendiceal cellulitis with peripheral abscess,ileocecal intestinal wall thickening,reflexes of small intestine and mesenteric lymph node enlargement.Multi-slice spiral CT has the advantages of clear and intuitive,high safety,high resolution and simple operation in the diagnosis of acute appendicitis.