ObjectiveTo investigate the potential mechanism of Danggui Buxuetang （DBT） in the treatment of vascular dementia （VAD）. MethodsSixty male SD rats were randomly assigned to the sham-operated group， model group， DBT low-， medium-， and high-dose groups， and the donepezil group. Except for the sham-operated group， rats in all other groups underwent bilateral common carotid artery ligation. After successful modeling， DBT was administered at doses of 9.2， 18.4， 36.8 g·kg^-1 for the low-， medium-， and high-dose groups， respectively， while the donepezil group received 3 mg·kg^-1 donepezil solution by gavage once daily. After 4 consecutive weeks of drug treatment， rats underwent the Morris water maze test， novel object recognition test， Nissl staining to observe hippocampal neurons， and immunofluorescence staining to detect the expression of neuronal nuclear protein （NeuN） in the hippocampus. Western blot was used to assess the expression of PTEN-induced kinase 1 （PINK1）， Parkin， microtubule-associated protein 1 light chain 3Ⅱ （LC3Ⅱ）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax）. Transmission electron microscopy was used to observe hippocampal neuronal ultrastructure. Real-time PCR was used to detect the expression of NADPH oxidase subunits p22^phox and p47^phox in hippocampal tissues. The levels of malondialdehyde （MDA）， glutathione （GSH）， superoxide dismutase （SOD）， and total antioxidant capacity were measured to evaluate oxidative stress levels. ResultsIn the Morris water maze test， escape latency changed significantly over time in all groups except the model group. Compared with the sham-operated group， the model group showed significantly prolonged escape latency （P<0.01）. Compared with the model group， rats in the DBT groups and the donepezil group exhibited significantly shorter escape latency （P<0.05， P<0.01）. The number of crossings over the original platform was significantly reduced in the model group compared with the sham-operated group （P<0.01）， whereas rats in the DBT and donepezil groups showed significantly increased platform crossings compared with the model group （P<0.05， P<0.01）. Compared with the sham-operated group， exploration time of new objects was significantly reduced in the model group （P<0.01）. Compared with the model group， exploration time of new objects increased significantly in the medium- and high-dose DBT groups and the donepezil group （P<0.05， P<0.01）， while no significant change was observed in the low-dose DBT group. Compared with the high-dose DBT group， rats in the donepezil group had significantly prolonged escape latency and reduced platform crossings and new-object exploration time （P<0.05）. Nissl staining showed decreased density of healthy neurons in the CA1 and CA3 regions of the hippocampus in the model group， with loss of Nissl bodies and nuclear atrophy or disappearance. In the high-dose DBT group， neuronal density in CA1 and CA3 increased， with neurons arranged closely and displaying normal morphology. Immunofluorescence showed that compared with the sham-operated group， the hippocampal NeuN⁺ cell count in the VAD model group was significantly decreased（P<0.01）， compared with the VAD model group， the hippocampal NeuN⁺ cell count in the high-dose DBT group was significantly increased（P<0.01）. Compared with the sham-operated group， the expression of PINK1， Parkin， LC3Ⅱ， and Bax proteins was significantly increased（P<0.01）， while the expression of Bcl-2 was significantly decreased in the VAD model group（P<0.01）. Compared with the VAD model group， the high-dose DBT group showed significantly decreased expression of PINK1， Parkin， LC3Ⅱ， and Bax proteins（P<0.01）and significantly upregulated Bcl-2 expression（P<0.01）. The medium-dose DBT group exhibited significantly reduced expression of Parkin， LC3Ⅱ， and Bax proteins（P<0.05，P<0.01） and significantly increased Bcl-2 expression（P<0.01）， while no statistically significant differences were observed in the low-dose DBT group. Transmission electron microscopy showed mitochondrial pyknosis， thickened cristae， increased electron density， and the presence of mitochondrial autophagy in the model group. In contrast， hippocampal neurons in the high-dose DBT group contained abundant mitochondria with intact morphology， clear cristae， and uniform matrix. Compared with the sham-operated group， total antioxidant capacity， SOD activity， and GSH levels were significantly decreased， while MDA levels were significantly increased in the model group （P<0.01）. Compared with the model group， total antioxidant capacity and antioxidant levels （SOD， GSH） increased significantly， and MDA decreased significantly in the medium- and high-dose DBT groups （P<0.01）， while no significant changes were observed in the low-dose DBT group. Compared with the sham-operated group， mRNA expression of p22^phox and p47^phox was significantly increased in the model group （P<0.01）. Compared with the model group， expression of p22^phox and p47^phox was significantly decreased in the DBT groups （P<0.05， P<0.01）. ConclusionDBT may exert neuroprotective effects by regulating PINK1/Parkin-mediated mitochondrial autophagy， thereby improving learning and memory abilities and treating VAD.

ObjectiveTo identify the pathogen species responsible for the wilt disease of Tetradium ruticarpum in Chongqing， investigate there biological characteristics， and screen effective fungicides， so as to provide a theoretical basis for disease control in production. MethodsThe pathogen was isolated via the tissue culture method. Pathogenicity was verified according to Koch's postulates. The pathogen was identified based on morphological characteristics and multi-gene phylogenetic analysis. The mycelial growth rate method was used for biological characterization of the pathogen and fungicide screening. ResultsThe pathogen colonies were nearly circular with irregular edges， white， short， velvety aerial hyphae， and pale purple undersides. Macroconidia were colorless， sickle-shaped， with 3-5 septa， while microconidia were transparent， elliptical， aseptate or with 1-2 septa. Multi-gene phylogenetic analysis showed that the pathogen clustered in the same clade as Fusarium fujikuroi with 100% support， which， combined with morphological characteristics， identified the pathogen causing wilt of T. ruticarpum in Chongqing as F. fujikuroi. The optimal conditions for the mycelial growth of F. fujikuroi were mung bean agar （MBA） with glucose as the carbon source， beef extract and yeast powder as nitrogen sources， 28 ℃， pH 7.0， and alternating light/dark conditions. The optimal conditions for sporulation were potato dextrose agar （PDA） with glucose as the carbon source， beef extract as the nitrogen source， 28 ℃， pH 7.0， and complete darkness. Among chemical fungicides， phenazine-1-carboxylic acid exhibited the strongest inhibitory effect on F. fujikuroi. Shenqinmycin and tetramycin were the most effective bio-fungicides. ConclusionThis study is the first to report F. fujikuroi as the causal agent of wilt disease in T. rutaecarpa. The chemical fungicide phenazine-1-carboxylic acid and the bio-fungicides shenqinmycin and tetramycin showed strong inhibitory effects against F. fujikuroi.

AIM:To investigate the effect of apoptosis stimulation protein 2(ASPP2)on the development of traumatic proliferative vitreoretinopathy(PVR)in a rabbit model.METHODS:A total of 30 New Zealand white rabbits were selected, and the right eyes of all rabbits were inflicted with a scleral penetrating wound of approximately 6 mm. Then rabbits were randomly and evenly divided into experimental and control group. The experimental group received an intravitreal injection of 0.1 mL of ARPE-19 cell suspension transfected with lentivirus-ASPP2, while the control group received an intravitreal injection of 0.1 mL of ARPE-19 cell suspension transfected with negative control lentivirus. At 1, 2, 3, and 4 wk after PVR modeling, a handheld tonometer was used to measure the intraocular pressure. Moreover, fundus photography and ocular ultrasound examination were performed to detect the retinal proliferation. At 4 wk after modeling, hematoxylin-eosin staining was used to observe the morphological retinal changes, and Western blot was used to determine the protein expressions of ASPP2 and the epithelial-mesenchymal transition(EMT)marker Vimentin in the rabbit retinas.RESULTS:At 1, 2, 3, and 4 wk after modeling, there were no significant changes in intraocular pressure within the experimental and control group of rabbit eyes, either before or after PVR modeling, the success rate of PVR modeling in the experimental group was lower than that in the control group(P<0.05), and the retinal proliferation and structural disorder was less severe in the experimental group. At 4 wk after modeling, the retinal protein expression level of ASPP2 in the experimental group was significantly higher than that in the control group(t=3.193, P=0.033), while the Vimentin protein expression level was significantly lower in the experimental group(t=-3.599, P=0.023).CONCLUSION:ASPP2 may be involved in regulating the process of EMT in retinal pigment epithelial cells, thereby delaying the development and progression of traumatic PVR in rabbit eyes.

Compared to other refractive surgeries, the implantable collamer lens(ICL)implantation procedure has become one of the most popular surgical options in refractive surgery. ICL surgery offers advantages such as reversibility, high-definition visual outcomes, and preservation of the corneal anatomical structure. The V4c model, which features a central port, is currently the most widely used in clinical practice and eliminates the need for peripheral iridotomy during the perioperative period. Although excellent uncorrected visual acuity can be achieved postoperatively, some patients may experience visual disturbances in the early postoperative period, such as halo and glare, which may affect visual comfort particularly under low-light conditions. This article reviews visual quality metrics after ICL V4c implantation, including higher-order aberrations(HOA), modulation transfer function(MTF), and contrast sensitivity(CS), along with influencing factors, and discusses potential relative deficits in postoperative visual quality and their underlying mechanisms.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveBased on whole-animal mass spectrometry imaging technology， spatial metabolomics was used to characterize in situ the metabolic alteration patterns in the lungs and brain of a rat model of lung heat-induced cough and asthma， as well as after treatment with Xiebai San. MethodsNine Sprague-Dawley （SD） rats were randomly divided into a blank group （physiological saline）， a model group （physiological saline）， and a Xiebai San group （9 g·kg^-1）， with three rats in each group. The model group and the Xiebai San group were both induced using lipopolysaccharide-ovalbumin （LPS-OVA） to establish an asthma rat model. After treatment with Xiebai San， the animals were euthanized on day 21 and rapidly frozen in liquid nitrogen to preserve morphology. Whole-animal tissue sections were prepared using a cryomicrotome， and imaging was performed using the Air-flow-assisted Desorption Electrospray Ionization Mass Spectrometry Imaging （AFADESI-MSI） platform. Based on the corresponding optical images， ion data of metabolites from the lung and brain tissues of each group were extracted. Differential metabolites were analyzed using SIMCA and GraphPad Prism 9.0 software. Metabolites were identified using the HMDB （https：//hmdb.ca/） and LipidMAPS^® （https：//www.lipidmaps.org/） databases， and metabolic changes in the lungs and brain were analyzed. ResultsMass spectrometry imaging showed that， after Xiebai San intervention， components such as neoglycyrrhizin and glycyrrhizin from Glycyrrhizae Radix et Rhizoma， as well as palmitamide from Lycii Cortex， were significantly distributed in the lung and brain tissues of rats. Lung analysis indicated that substances with anti-inflammatory effects， such as citric acid， were significantly decreased （P0.01）， while lipid metabolites such as lysophosphatidylethanolamine （LPE 17：1）， LPE （22：4）， and LPE （19：0） （P0.01） were significantly increased， showing a marked inflammatory response in the model group. After Xiebai San intervention， these conditions were notably improved. Analysis of metabolic changes in brain tissue showed that， compared with the blank group， amino acid and fatty acid metabolic pathways in the model group exhibited restricted alterations. Among them， levels of aspartic acid， glutamic acid， fatty acid （FA 18：5）， hydroxy fatty acids （FAHFA 36：0；O）， FA （6：1；O6）， and LPE （18：1） increased， whereas FA （16：0） and FA （20：4） significantly decreased. Administration of Xiebai San improved these metabolic abnormalities in the brain. Systematic analysis of lung and brain metabolic changes in rats with lung heat-induced cough and asthma showed that antioxidant unsaturated phospholipid substances were significantly decreased in the model group， suggesting oxidative stress and inflammation-related lung-brain axis responses after the onset of lung heat-induced cough and asthma. ConclusionUsing whole-animal mass spectrometry imaging combined with spatial metabolomics revealed the in vivo distribution of Xiebai San constituents， characterized the metabolic alterations in the lungs and brain caused by lung heat-induced cough and asthma， and systematically demonstrated the lung-brain axis inflammatory responses and the regulatory effects of Xiebai San. These findings provide valuable information for the study of Chinese medicine in lung heat-induced cough and asthma.

In this paper， by referring to ancient and modern literature， the textual research of Inulae Flos has been conducted to clarify the name， origin， production area， quality evaluation， harvesting， processing and others， so as to provide reference and basis for the development and utilization of famous classical formulas containing this herb. After textual research， it could be verified that the medicinal use of Inulae Flos was first recorded in Shennong Bencaojing of the Han dynasty. In successive dynasties， Xuanfuhua has been taken as the official name， and it also has other alternative names such as Jinfeicao， Daogeng and Jinqianhua. The period before the Song and Yuan dynasties， the main origin of Inulae Flos was the Asteraceae plant Inula japonica， and from the Ming and Qing dynasties to the present， I. japonica and I. britannica are the primary source. In addition to the dominant basal species， there are also regional species such as I. linariifolia， I. helianthus-aquatili， and I. hupehensis. The earliest recorded production areas in ancient times were Henan， Hubei and other places， and the literature records that it has been distributed throughout the country since modern times. The medicinal part is its flower， the harvesting and processing method recorded in the past dynasties is mainly harvested in the fifth and ninth lunar months， and dried in the sun， and the modern harvesting is mostly harvested in summer and autumn when the flowers bloom， in order to remove impurities， dry in the shade or dry in the sun. In addition， the roots， whole herbs and aerial parts are used as medicinal materials. In ancient times， there were no records about the quality of Inulae Flos， and in modern times， it is generally believed that the quality of complete flower structure， small receptacles， large blooms， yellow petals， long filaments， many fluffs， no fragments， and no branches is better. Ancient processing methods primarily involved cleaning， steaming， and sun-drying， supplemented by techniques such as boiling， roasting， burning， simmering， stir-frying， and honey-processing. Modern processing focuses mainly on cleaning the stems and leaves before use. Regarding the medicinal properties， ancient texts describe it as salty and sweet in taste， slightly warm in nature， and mildly toxic. Modern studies characterize it as bitter， pungent， and salty in taste， with a slightly warm nature. Its therapeutic effects remain consistent across eras， including descending Qi， resolving phlegm， promoting diuresis， and stopping vomiting. Based on the research results， it is recommended that when developing famous classical formulas containing Inulae Flos， either I. japonica or I. britannica should be used as the medicinal source. Processing methods should follow formula requirements， where no processing instructions are specified， the raw products may be used after cleaning.

ObjectiveBased on whole-animal mass spectrometry imaging technology， spatial metabolomics was used to characterize in situ the metabolic alteration patterns in the lungs and brain of a rat model of lung heat-induced cough and asthma， as well as after treatment with Xiebai San. MethodsNine Sprague-Dawley （SD） rats were randomly divided into a blank group （physiological saline）， a model group （physiological saline）， and a Xiebai San group （9 g·kg^-1）， with three rats in each group. The model group and the Xiebai San group were both induced using lipopolysaccharide-ovalbumin （LPS-OVA） to establish an asthma rat model. After treatment with Xiebai San， the animals were euthanized on day 21 and rapidly frozen in liquid nitrogen to preserve morphology. Whole-animal tissue sections were prepared using a cryomicrotome， and imaging was performed using the Air-flow-assisted Desorption Electrospray Ionization Mass Spectrometry Imaging （AFADESI-MSI） platform. Based on the corresponding optical images， ion data of metabolites from the lung and brain tissues of each group were extracted. Differential metabolites were analyzed using SIMCA and GraphPad Prism 9.0 software. Metabolites were identified using the HMDB （https：//hmdb.ca/） and LipidMAPS^® （https：//www.lipidmaps.org/） databases， and metabolic changes in the lungs and brain were analyzed. ResultsMass spectrometry imaging showed that， after Xiebai San intervention， components such as neoglycyrrhizin and glycyrrhizin from Glycyrrhizae Radix et Rhizoma， as well as palmitamide from Lycii Cortex， were significantly distributed in the lung and brain tissues of rats. Lung analysis indicated that substances with anti-inflammatory effects， such as citric acid， were significantly decreased （P0.01）， while lipid metabolites such as lysophosphatidylethanolamine （LPE 17：1）， LPE （22：4）， and LPE （19：0） （P0.01） were significantly increased， showing a marked inflammatory response in the model group. After Xiebai San intervention， these conditions were notably improved. Analysis of metabolic changes in brain tissue showed that， compared with the blank group， amino acid and fatty acid metabolic pathways in the model group exhibited restricted alterations. Among them， levels of aspartic acid， glutamic acid， fatty acid （FA 18：5）， hydroxy fatty acids （FAHFA 36：0；O）， FA （6：1；O6）， and LPE （18：1） increased， whereas FA （16：0） and FA （20：4） significantly decreased. Administration of Xiebai San improved these metabolic abnormalities in the brain. Systematic analysis of lung and brain metabolic changes in rats with lung heat-induced cough and asthma showed that antioxidant unsaturated phospholipid substances were significantly decreased in the model group， suggesting oxidative stress and inflammation-related lung-brain axis responses after the onset of lung heat-induced cough and asthma. ConclusionUsing whole-animal mass spectrometry imaging combined with spatial metabolomics revealed the in vivo distribution of Xiebai San constituents， characterized the metabolic alterations in the lungs and brain caused by lung heat-induced cough and asthma， and systematically demonstrated the lung-brain axis inflammatory responses and the regulatory effects of Xiebai San. These findings provide valuable information for the study of Chinese medicine in lung heat-induced cough and asthma.

In this paper， by referring to ancient and modern literature， the textual research of Inulae Flos has been conducted to clarify the name， origin， production area， quality evaluation， harvesting， processing and others， so as to provide reference and basis for the development and utilization of famous classical formulas containing this herb. After textual research， it could be verified that the medicinal use of Inulae Flos was first recorded in Shennong Bencaojing of the Han dynasty. In successive dynasties， Xuanfuhua has been taken as the official name， and it also has other alternative names such as Jinfeicao， Daogeng and Jinqianhua. The period before the Song and Yuan dynasties， the main origin of Inulae Flos was the Asteraceae plant Inula japonica， and from the Ming and Qing dynasties to the present， I. japonica and I. britannica are the primary source. In addition to the dominant basal species， there are also regional species such as I. linariifolia， I. helianthus-aquatili， and I. hupehensis. The earliest recorded production areas in ancient times were Henan， Hubei and other places， and the literature records that it has been distributed throughout the country since modern times. The medicinal part is its flower， the harvesting and processing method recorded in the past dynasties is mainly harvested in the fifth and ninth lunar months， and dried in the sun， and the modern harvesting is mostly harvested in summer and autumn when the flowers bloom， in order to remove impurities， dry in the shade or dry in the sun. In addition， the roots， whole herbs and aerial parts are used as medicinal materials. In ancient times， there were no records about the quality of Inulae Flos， and in modern times， it is generally believed that the quality of complete flower structure， small receptacles， large blooms， yellow petals， long filaments， many fluffs， no fragments， and no branches is better. Ancient processing methods primarily involved cleaning， steaming， and sun-drying， supplemented by techniques such as boiling， roasting， burning， simmering， stir-frying， and honey-processing. Modern processing focuses mainly on cleaning the stems and leaves before use. Regarding the medicinal properties， ancient texts describe it as salty and sweet in taste， slightly warm in nature， and mildly toxic. Modern studies characterize it as bitter， pungent， and salty in taste， with a slightly warm nature. Its therapeutic effects remain consistent across eras， including descending Qi， resolving phlegm， promoting diuresis， and stopping vomiting. Based on the research results， it is recommended that when developing famous classical formulas containing Inulae Flos， either I. japonica or I. britannica should be used as the medicinal source. Processing methods should follow formula requirements， where no processing instructions are specified， the raw products may be used after cleaning.

ObjectiveTo observe the changes in the levels of different subtypes of epidermal growth factor receptor （ErbB）， namely ErbB1， ErbB2， ErbB3， and ErbB4， in the spinal dorsal horn of inflammatory pain model rats， and to explore their mechanism of mediating hyperalgesia as well as the intervention mechanism of electroacupuncture at "Zusanli （ST 36）" and "Kunlun （BL 60）". MethodsThe study was divided into five parts. In experiment 1， 14 Sprague Dawley （SD） rats were randomly divided into control and inflammatory pain group （7 rats each group） to observe the pain behavior and the protein expression of different ErbB receptor subtypes in the spinal dorsal horn. In experiment 2， 30 rats were randomly divided into control group 1， inflammatory pain group 1， and low-， medium-， and high-concentration TX1-85-1 groups， with 6 rats in each group， to observe the effect of inhibiting spinal ErbB3 on inflammatory pain. In experiment 3， 12 rats were randomly divided into control virus group and ErbB3 knockdown virus group， with 6 rats in each group， to observe the effect of knocking down ErbB3 in the spinal dorsal horn on inflammatory pain. In experiment 4， 44 rats were randomly divided into control group 2， inflammatory pain group 2， electroacupuncture group， and sham electroacupuncture group， with 11 rats in each group， to observe the effect of electroacupuncture. In experiment 5， 40 rats were randomly divided into control group 3， inflammatory pain group 3， electroacupuncture group 1， and electroacupuncture + NRG1 group， with 10 rats in each group， to observe the effect of activating ErbB3 on electroacupuncture. A rat model of inflammatory pain was established by subcutaneous injection of 100 μl of complete Freund's adjuvant into the sole of the unilateral hind foot of SD rats. Rats in the low-， medium-， and high-concentration TX1-85-1 groups were intrathecally injected with ErbB3 inhibitor TX1-85-1 on day 5 to day 7 after modeling. Rats in the ErbB3 knockdown virus group were injected with ErbB3 knockdown virus packaged with adenovirus vector-based short hairpin RNA （shRNA） into the spinal dorsal horn in situ 3 weeks before modeling. Rats in each electroacupuncture group received electroacupuncture at bilateral "Zusanli （ST 36）" and "Kunlun （BL 60）" from day 1 to day 7 after modeling， with dense-sparse waves at a frequency of 2 Hz/100 Hz and a current of 0.5-1.5 mA for 30 minutes once a day. Rats in the electroacupuncture + NRG1 group were intrathecally injected with ErbB3 ligand recombinant human neuregulin-1 （NRG1） after electroacupuncture intervention from day 5 to day 7 after modeling. The mechanical withdrawal threshold and thermal withdrawal latency of rats were measured on day 1， 3， 5， and 7 after modeling to evaluate behavior， and Western Blot was used to detect the protein and phosphorylation levels of each ErbB subtype in the spinal dorsal horn. ResultsCompared with the control group， rats in the inflammatory pain group showed decreased mechanical withdrawal threshold and thermal withdrawal latency of rats， and increased expression of phosphorylated ErbB3 （p-ErbB3） protein in the spinal dorsal horn on days 1， 3， 5， and 7 after modeling （P＜0.01）. On day 5 and day 7 after modeling， compared with the inflammatory pain group 1， the mecha-nical withdrawal threshold and thermal withdrawal latency of rats in the medium- and high-concentration TX1-85-1 groups increased， and the expression of p-ErbB3 protein decreased （P＜0.05）. On day 1， 3， 5， and 7 after modeling， compared with the control virus group， the mechanical withdrawal threshold and thermal withdrawal latency of rats in the ErbB3 knockdown virus group increased （P＜0.05）. On day 5 and day 7 after modeling， compared with the inflammatory pain group 2 and the sham electroacupuncture group， the mechanical withdrawal threshold and thermal withdrawal latency of rats in the electroacupuncture group increased， and the expression of p-ErbB3 protein decreased （P＜0.05）. On day 5 and day 7 after modeling， compared with the electroacupuncture + NRG1 group， the mechanical withdrawal threshold and thermal withdrawal latency of rats in the electroacupuncture group 1 increased （P＜0.05）. ConclusionThe p-ErbB3 in the spinal dorsal horn involved in hyperalgesia in rats with inflammatory pain， and electroacupuncture at "Zusanli （ST 36）" and "Kunlun （BL 60）" can alleviate inflammatory pain by inhibiting the expression of p-ErbB3 protein in the spinal dorsal horn of rats.