AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo observe the changes in the levels of different subtypes of epidermal growth factor receptor （ErbB）， namely ErbB1， ErbB2， ErbB3， and ErbB4， in the spinal dorsal horn of inflammatory pain model rats， and to explore their mechanism of mediating hyperalgesia as well as the intervention mechanism of electroacupuncture at "Zusanli （ST 36）" and "Kunlun （BL 60）". MethodsThe study was divided into five parts. In experiment 1， 14 Sprague Dawley （SD） rats were randomly divided into control and inflammatory pain group （7 rats each group） to observe the pain behavior and the protein expression of different ErbB receptor subtypes in the spinal dorsal horn. In experiment 2， 30 rats were randomly divided into control group 1， inflammatory pain group 1， and low-， medium-， and high-concentration TX1-85-1 groups， with 6 rats in each group， to observe the effect of inhibiting spinal ErbB3 on inflammatory pain. In experiment 3， 12 rats were randomly divided into control virus group and ErbB3 knockdown virus group， with 6 rats in each group， to observe the effect of knocking down ErbB3 in the spinal dorsal horn on inflammatory pain. In experiment 4， 44 rats were randomly divided into control group 2， inflammatory pain group 2， electroacupuncture group， and sham electroacupuncture group， with 11 rats in each group， to observe the effect of electroacupuncture. In experiment 5， 40 rats were randomly divided into control group 3， inflammatory pain group 3， electroacupuncture group 1， and electroacupuncture + NRG1 group， with 10 rats in each group， to observe the effect of activating ErbB3 on electroacupuncture. A rat model of inflammatory pain was established by subcutaneous injection of 100 μl of complete Freund's adjuvant into the sole of the unilateral hind foot of SD rats. Rats in the low-， medium-， and high-concentration TX1-85-1 groups were intrathecally injected with ErbB3 inhibitor TX1-85-1 on day 5 to day 7 after modeling. Rats in the ErbB3 knockdown virus group were injected with ErbB3 knockdown virus packaged with adenovirus vector-based short hairpin RNA （shRNA） into the spinal dorsal horn in situ 3 weeks before modeling. Rats in each electroacupuncture group received electroacupuncture at bilateral "Zusanli （ST 36）" and "Kunlun （BL 60）" from day 1 to day 7 after modeling， with dense-sparse waves at a frequency of 2 Hz/100 Hz and a current of 0.5-1.5 mA for 30 minutes once a day. Rats in the electroacupuncture + NRG1 group were intrathecally injected with ErbB3 ligand recombinant human neuregulin-1 （NRG1） after electroacupuncture intervention from day 5 to day 7 after modeling. The mechanical withdrawal threshold and thermal withdrawal latency of rats were measured on day 1， 3， 5， and 7 after modeling to evaluate behavior， and Western Blot was used to detect the protein and phosphorylation levels of each ErbB subtype in the spinal dorsal horn. ResultsCompared with the control group， rats in the inflammatory pain group showed decreased mechanical withdrawal threshold and thermal withdrawal latency of rats， and increased expression of phosphorylated ErbB3 （p-ErbB3） protein in the spinal dorsal horn on days 1， 3， 5， and 7 after modeling （P＜0.01）. On day 5 and day 7 after modeling， compared with the inflammatory pain group 1， the mecha-nical withdrawal threshold and thermal withdrawal latency of rats in the medium- and high-concentration TX1-85-1 groups increased， and the expression of p-ErbB3 protein decreased （P＜0.05）. On day 1， 3， 5， and 7 after modeling， compared with the control virus group， the mechanical withdrawal threshold and thermal withdrawal latency of rats in the ErbB3 knockdown virus group increased （P＜0.05）. On day 5 and day 7 after modeling， compared with the inflammatory pain group 2 and the sham electroacupuncture group， the mechanical withdrawal threshold and thermal withdrawal latency of rats in the electroacupuncture group increased， and the expression of p-ErbB3 protein decreased （P＜0.05）. On day 5 and day 7 after modeling， compared with the electroacupuncture + NRG1 group， the mechanical withdrawal threshold and thermal withdrawal latency of rats in the electroacupuncture group 1 increased （P＜0.05）. ConclusionThe p-ErbB3 in the spinal dorsal horn involved in hyperalgesia in rats with inflammatory pain， and electroacupuncture at "Zusanli （ST 36）" and "Kunlun （BL 60）" can alleviate inflammatory pain by inhibiting the expression of p-ErbB3 protein in the spinal dorsal horn of rats.

Objective: To analyze the epidemiological characteristics and influencing factors of severe fever with thrombocytopenia syndrome (SFTS) in Zhejiang Province from 2019 to 2023, so as to provide the reference for strengthening SFTS prevention and control. Methods: Data on laboratory-confirmed SFTS cases in Zhejiang Province from 2019 to 2023 were collected through the Infectious Disease Reporting Information System of Chinese Disease Prevention and Control Information System. Meteorological data, geographic environment and socioeconomic factors during the same period were collected from the fifth-generation European Centre for Medium-Range Weather Forecasts, Geospatial Data Cloud, and Zhejiang Statistical Yearbook, respectively. Descriptive epidemiological methods were used to analyze the epidemiological characteristics of SFTS from 2019 to 2023, and a Bayesian spatio-temporal model was constructed to analyze the influencing factors of SFTS incidence. Results: A total of 578 SFTS cases were reported in Zhejiang Province from 2019 to 2023, with an annual average incidence of 0.23/105. The peak period was from May to July, accounting for 52.60%. There were 309 males and 269 females, with a male-to-female ratio of 1.15∶1. The cases were mainly aged 50-<80 years, farmers, and in rural areas, accounting for 82.53%, 77.34%, and 75.43%, respectively. Taizhou City and Shaoxing City reported more SFTS cases, while Shaoxing City and Zhoushan City had higher annual average incidences of SFTS. The Bayesian spatio-temporal interaction model showed good goodness of fit. The results showed that mean temperature (RR=1.626, 95%CI: 1.111-2.378) and mean wind speed (RR=1.814, 95%CI: 1.321-2.492) were positively correlated with SFTS risk, while altitude (RR=0.432, 95%CI: 0.230-0.829) and population density (RR=0.443, 95%CI: 0.207-0.964) were negatively correlated with SFTS risk. Conclusions SFTS in Zhejiang Province peaks from May to July. Middle-aged and elderly people and farmers are high-risk populations. Taizhou City, Shaoxing City, and Zhoushan City are high-incidence areas. Mean temperature, mean wind speed, altitude, and population density can all affect the risk of SFTS incidence.

ObjectiveThis paper aims to observe the role of Danlou tablet in treating coronary heart disease （CHD） with phlegm-stasis intermingling syndrome in minipigs by improving platelet function and explore the potential pharmacological mechanism of Danlou tablet in regulating platelet function by using proteomics technology. MethodsThirty Bama minipigs were randomly divided into a normal control group （6 pigs） and a high-fat diet group （24 pigs）. After 2 weeks of high-fat diet feeding， the high-fat diet group was randomly subdivided into a model group， an atorvastatin group （1 mg·kg^-1）， and Danlou tablet groups （0.6 g·kg^-1 and 0.3 g·kg^-1）. All groups continued to receive a high-fat diet for 8 weeks after the procedure. The normal control group was given a regular diet， underwent only coronary angiography， and did not receive an interventional injury procedure. The model group and each administration group were fed a high-fat diet. Two weeks later， they underwent a coronary angiography injury procedure. After the procedure， drugs were mixed into the feed every morning for 8 consecutive weeks， with the minipigs maintained on a continuous high-fat diet during this period. Quantitative proteomics technology was further used to study platelet proteins， and differential proteins were obtained by screening. Bioinformatics analysis was performed to analyze key regulatory proteins and biological pathways involved in the therapeutic effect of Danlou tablet on CHD with phlegm-stasis intermingling syndrome. ResultsCompared with the normal control group， the model group showed a significant increase in total cholesterol （TC）， triglyceride （TG）， high-density lipoprotein cholesterol （HDL-C）， and low-density lipoprotein cholesterol （LDL-C） of minipigs' serum （P<0.01）， a significant shortening in prothrombin time of （PT） （P<0.01）， a coagulation function index， and an increase in whole blood viscosity （P<0.01） and platelet aggregation rate （P<0.01）. Moreover， the platelet morphology was altered， and the contents of endothelin-1 （ET-1） and nitric oxide （NO） were significantly increased （P<0.01）. Hemodynamic parameters were obviously abnormal， including significantly decreased systolic blood pressure （SBP）， diastolic blood pressure （DBP）， mean arterial pressure （MAP）， left ventricular systolic pressure （LVSP）， and left ventricular maximal positive dp/dt （LV+dp/dt_max） （P<0.01）. Left ventricular maximal negative dp/dt （LV-dp/dt_max） was significantly increased （P<0.01）. Besides， there were myocardial cell hypertrophy， obvious edematous degeneration， massive interstitial inflammatory cell infiltration， high degree of fibrosis， and coronary endothelial atherosclerosis. TC and TG levels in minipigs' serum were significantly reduced in Danlou tablet groups with 0.6 g·kg^-1 and 0.3 g·kg^-1 （P<0.05， P<0.01）， compared with those in the model group. LDL-C was decreased in the Danlou tablet group with 0.6 g·kg^-1 （P<0.05）. The whole blood viscosity under low and high shear conditions was significantly reduced in the Danlou tablet group with 0.6 g·kg^-1 （P<0.05）. In groups with all doses of Danlou tablet， maximum aggregation rate （MAR） and average aggregation rate （AAR） were significantly decreased （P<0.05， P<0.01）， and platelets' morphological changes such as pseudopodia extension were reduced. ET-1 levels in the serum were significantly reduced. In the Danlou tablet group with 0.6 g·kg^-1， NO level in the serum was reduced （P<0.05）. In groups with all doses of Danlou tablet， DBP and MAP were significantly increased （P<0.05）. In the Danlou tablet group with 0.6 g·kg^-1， LVSP and LV+dp/dt_max were significantly increased （P<0.05， P<0.01）， and LV-dp/dt_max was significantly decreased （P<0.05）. In groups with all doses of Danlou tablet， edematous degeneration in myocardial tissue was milder， and coronary artery lesion degree was significantly alleviated. Compared with the normal control group， there were 94 differentially expressed proteins in the model group， including 81 up-regulated and 13 down-regulated proteins. Compared with the model group， the Danlou tablet group with 0.6 g·kg^-1 showed 174 differentially expressed proteins， including 100 up-regulated and 74 down-regulated proteins. A total of 30 proteins were reversed after Danlou tablet intervention. Bioinformatics analysis revealed that its pharmacological mechanism may exert anti-platelet activation， aggregation， and adhesion effects through biological pathways such as regulation of actin cytoskeleton， platelet activation pathway， Fcγ receptor-mediated phagocytosis， as well as proteins such as growth factor receptor-bound protein 2 （GRB2）， Ras-related C3 botulinum toxin substrate 2 （RAC2）， RAC1， and heat shock protein 90 alpha family class A member 1 （HSP90AA1）. ConclusionDanlou tablet can effectively reduce platelet activation and aggregation， exerting a good therapeutic effect on CHD with phlegm-stasis intermingling syndrome in minipigs. Its pharmacological mechanism may involve regulating biological pathways such as actin cytoskeleton and platelet activation pathway， as well as proteins like GRB2， RAC2， RAC1， and HSP90AA1， thereby exerting a pharmacological effect in anti-platelet activation， aggregation， and adhesion.

Aromatic Chinese medicinal essential oils are volatile oils extracted from aromatic Chinese herbs， which can prevent and treat respiratory infectious diseases through multiple synergistic mechanisms including pathogen inhibition， immune regulation， and inflammatory response regulation. Essential oils are primarily used externally on the body to prevent infections and alleviate symptoms through methods like inhalation， smearing， topical application， bathing， gargling or as a suppository. They can also be utilized in the environment for disinfection and air purification， through methods like diffusion， vaporization， or spraying. The external application of essential oils extracted from Chinese aromatic herbs has the advantages of convenience， quick absorption， and simultaneous influence on both the body and mind. However， there are still challenges and deficiencies in aspects such as the positioning of functions， indications， safety， and the research on the mechanism of action. It has been proposed to combine the theory of aromatic Chinese medicinals with the characteristics of essential oils， and formulate prescriptions of Chinese medicinal essential oils under the principles of traditional Chinese medicine syndrome differentiation， and prevent and treat respiratory infectious diseases efficiently， accurately， and safely， thereby expanding the clinical application of aromatic Chinese medicinals and the preventive theory of traditional Chinese medicine.

BACKGROUND:Ferroptosis is a mode of programmed cell death distinct from apoptosis,necrosis,and other novel cellular deaths,which occurs mainly due to accumulated lipid peroxidation.Ferroptosis has been shown to be involved in the pathological process following subarachnoid hemorrhage.Baicalein,serving as an adept sequestered of iron,evinces its prowess by quelling lipid peroxidative cascades.Nonetheless,the enigma lingers as to whether baicalein possesses the capacity to ameliorate neuronal ferroptosis,elicited in the wake of early brain injury after subarachnoid hemorrhage. OBJECTIVE:To investigate the effect and mechanism of baicalein on neuronal ferroptosis after subarachnoid hemorrhage. METHODS:Primary neuronal cells were extracted from C57BL/6L fetal mice at 16-17 days of gestation.Hemoglobin was used to stimulate primary neuronal cells to simulate an in vitro subarachnoid hemorrhage model.The viability of primary neuronal cells treated with baicalein at concentrations of 5,15,25,50,and 100 μmol/L for 24 hours was detected by CCK-8 assay to determine the optimal concentration of baicalein.Primary neuronal cells were divided into control group,hemoglobin group,and hemoglobin+baicalein group.The levels of reactive oxygen species and malondialdehyde in cells were detected by kits.The mRNA expressions of ferroptosis-related markers PTGS2,SLC7A11,and glutathione peroxidase 4 were detected by RT-PCR.The primary neuronal cells were further divided into control group,SLC7A11 inhibitor Erastin group,hemoglobin group,hemoglobin+baicalein group,and hemoglobin+baicalein+Erastin group.The expression of the ferroptosis related markers SLC7A11 and glutathione peroxidase 4 was detected by western blot assay. RESULTS AND CONCLUSION:(1)Baicalein(25 μmol/L)was selected as the following experimental concentration.(2)Compared with the hemoglobin group,the level of malondialdehyde and the level of reactive oxygen species were significantly decreased(P<0.05)in the hemoglobin+baicalein group.(3)Compared with the hemoglobin group,the mRNA expression of PTGS2 significantly decreased,and the mRNA expression of SLC7A11 and glutathione peroxidase 4 significantly increased(P<0.000 1)in the hemoglobin+baicalein group.(4)SLC7A11 inhibitor Erastin could reverse the baicalin-improved ferroptosis effect to a certain extent(P<0.05).(5)The results showed that baicalein could alleviate the ferroptosis of neuronal cells after subarachnoid hemorrhage through the SLC7A11/GPX4 pathway.

BACKGROUND:Several observational studies have found a close relationship between thyroid function levels and sarcopenia,but the causal relationship between thyroid function levels and the onset of sarcopenia is not yet clear. OBJECTIVE:To investigate the causal relationship between thyroid function levels and sarcopenia using a two sample Mendelian randomization method. METHODS:A two sample Mendelian randomization analysis was conducted using genome-wide association study data on thyrotropin,free triiodothyronine,free tetraiodothyronine,subclinical hyperthyroidism,subclinical hypothyroidism,and four related phenotypes of sarcopenia-lefthand grip strength,right hand grip strength,limb lean mass,and gait speed.The inverse-variance weighted method,weighted median method,simple mode method,weighted median estimator method,and MR Egger regression method were used as analysis methods,while heterogeneity test,pleiotropy test,MR-PRESSO,leave-one-out method,funnel plot and other methods were used for sensitivity analysis. RESULTS AND CONCLUSION:Elevated levels of thyroid-stimulating hormone increased left-(β=0.02,SE=0.01,P=0.01)and right-handed grip strength(β=0.02,SE=0.01,P=0.01),an increase in free triiodothyronine decreased left-(β=-0.06,SE=0.02,P=9.5×10-5)and right-handed grip strength(β=-0.07,SE=0.02,P=9.3×10-5),and subclinical hyperthyroidism decreased gait speed(β=-4.4×10-3,SE=1.7×10-3,P=0.01).The sensitivity analysis results were basically consistent with the main analysis results.To conclude,an increase in thyroid-stimulating hormone is a protective factor for sarcopenia,and elevation of free triiodothyronine and subclinical hyperthyroidism may increase the risk of sarcopenia.

BACKGROUND:Extracellular vesicles are secreted into the extracellular milieu by a wide range of cell types,including tumor cells,under different physiological and pathophysiological conditions,where a wide range of biological signals and cell-to-cell signaling exists.Tumor-derived extracellular vesicles may exacerbate cancer progression,survival,invasion,and promote angiogenesis. OBJECTIVE:To review the research progress of extracellular vesicles in the diagnosis and treatment of oral squamous cell carcinoma. METHODS:Literature search was performed by the first author in PubMed,WanFang,CNKI and other databases with the keywords"EVs,oral squamous cell carcinoma,diagnosis and treatment,biopsy,tissue engineering"in Chinese and English.Finally,63 articles were included for analysis. RESULTS AND CONCLUSION:(1)In oral squamous carcinoma saliva biopsies,extracellular vesicles play a crucial role in the progression of oral squamous cell carcinoma by acting as an information transfer tool between tumor cells and the surrounding microenvironment,carrying a wide range of biomolecules including soluble proteins,lipids,DNA,and RNA.These tiny vesicles not only play a key role in tumor growth and spread,but also provide important information about the biological properties of the tumor.(2)Saliva biopsy,as a non-invasive diagnostic method,can open up new possibilities for early diagnosis and targeted treatment of oral squamous cell carcinoma by analyzing the extracellular vesicles therein.(3)It has been found that bioactive molecules,such as microRNAs(miRNAs)and specific proteins,contained within extracellular vesicles can serve as biomarkers for oral squamous carcinoma and improve the accuracy of early diagnosis.Specific proteins in extracellular vesicles such as EHD2,CAVIN1,PF4V1,and CXCL7 show potential as novel predictive biomarkers.(4)In addition,this paper highlights the potential application of extracellular vesicles in the treatment of oral squamous carcinoma.Through engineering modifications,extracellular vesicles can serve as a new generation of nanoscale drug delivery systems to enhance the efficiency and specificity of targeted tumor therapy.(5)Future studies will further explore the effect and mechanism of extracellular vesicles in oral squamous cell carcinoma,which is expected to improve patients'survival and quality of life.

Objective To compare the imaging characteristics and surgical methods of pulmonary nodules in the external 1/3 group and internal 2/3 group. Methods A retrospective analysis of clinical data from patients who underwent thoracoscopic preoperative CT-guided lung nodule localization at the Department of Radiology, the First Affiliated Hospital of Xiamen University from September 2020 to April 2022 was conducted. Results A total of 215 patients were enrolled (247 pulmonary nodules), including 70 males and 145 females, with a median age of 48 years. Based on the location of the nodules under CT guidance, those located in the external 1/3 area of the lung were classified into an external 1/3 group, while those located in the middle 1/3 and inner 1/3 areas were classified into an internal 2/3 group. There was no statistical difference between the two groups in terms of general clinical data, nature of pulmonary nodules, distribution of pulmonary nodules in lobes, localization time, or localization complications (P>0.05). However, there were statistical differences in the distance of pulmonary nodules from the pleura [0.6 (0.0-1.9) cm vs. 1.8 (0.0-4.5) cm, P<0.001], size of pulmonary nodules [0.7 (0.2-1.8) cm vs. 1.0 (0.2-2.0) cm, P<0.001], and surgical methods (P=0.002). In the external 1/3 group, 92.1% of nodules underwent thoracoscopic wedge resection, while fewer patients underwent other procedures; in the internal 2/3 group, 77.1% of nodules underwent thoracoscopic wedge resection, and 19.3% underwent segmentectomy. Conclusion The diameter of pulmonary nodules, the distance of pulmonary nodules from the pleura, and surgical methods differ between the external 1/3 group and internal 2/3 group. Thoracic surgeons can develop more precise surgical plans based on the location and size of pulmonary nodules.

Aromatic inhalation therapy is a key traditional Chinese medicine （TCM） approach for preventing respiratory infectious diseases. Its foundational theory， "aromatics acting on the spleen"， is deeply rooted in TCM principles and supported by modern medical research. The theory posits that the aromatic properties of medicinals primarily act on the spleen， and the aromatic inhalation therapy achieved its protective effects by modulation of the spleen and spleen channel to enhance the regulation of wei qi， striae and interstices. In TCM， the spleen is considered the mother of the lungs， with the function of nurturing lung； it is also seen as the source of wei qi， responsible for external defense； and the root of healthy qi， forming the foundation of acquired （postnatal） constitution. Thus， preventive strategies for respiratory infectious diseases focus on strengthening the spleen. From a modern medical perspective， the spleen's role in regulating lung immune responses， the shared immune functions of the respiratory and gastrointestinal mucosa， and the spleen's overall immune modulation provide scientific evidence for using aromatic inhalation therapy to prevent respiratory infections. Additionally， aromatic inhalation therapy offers several advantages， including direct action， rapid onset， minimal side effects， controllable risks， convenience， and ease of dissemination， making it a practical and effective preventive measure for respiratory infectious diseases.