Liver cancer is one of the most common malignant tumors in the digestive system and ranks sixth among newly diagnosed malignant tumors worldwide. Transforming growth factor-β （TGF-β） regulates cell differentiation， proliferation， apoptosis， and other physiological and pathological mechanisms and exerts cancer-suppressive and pro-cancerous dual effects in the process of tumor development. In recent years， with the continuous exploration of the mechanism of liver cancer， it has been found that the conversion of the cancer-suppressive effect into a pro-cancerous effect of this pathway plays a key role in the development of liver cancer. Traditional Chinese medicine （TCM） provides a unique perspective for the classification， diagnosis， and treatment of liver cancer with its comprehensive regulatory effects of multi-components， multi-targets， and multi-pathways. This paper summarized that the cancer-suppressive mechanisms of the TGF-β signaling pathway included promoting cancer cell cycle arrest， apoptosis， autophagy， et al， while the pro-cancerous mechanisms included promoting cancer cell proliferation， invasion and metastasis， immunosuppression， angiogenesis， et al. The TCM compounds intervening this pathway were sorted out， including Jianpi Huayu compound， Fuyang Baoyuan compound， Yipi Yanggan compound， Fuzheng Jiedu compound， compound Astragalus and Salvia， Biejia Jianwan， Dahuang Zhechong pill， and Qingxiang powder. The single TCMs mainly included Schizocapsa plantaginea， Dendrobii Caulis， Gleditsia sinensis， and Dracaena cochinchinensis. The active ingredients of TCM are mainly concentrated on flavonoids， alkaloids， glycosides， phenolics， terpenoids， polysaccharides， and other kinds of compounds. At the same time， it summarized that the liver cancer inhibition mechanism of TCM by regulating this pathway mainly included promoting apoptosis of liver cancer cells， blocking the cell cycle， and inhibiting liver cancer cell proliferation， migration， invasion， angiogenesis， immune escape， etc. The mechanism aims to give full play to the advantages of TCM and precisely regulate the TGF-β signal， thereby exerting positive anti-tumor effects， opening up a new direction for the precise targeted treatment of liver cancer， and providing a scientific basis and a new strategy for the application of TCM in the treatment of liver cancer.

Esophageal cancer is a prevalent malignant tumor of the digestive tract in China, and radical surgery remains the cornerstone of its comprehensive treatment. However, multifactorial challenges such as postoperative gastrointestinal tract reconstruction, traumatic stress, and tumor-related metabolic disturbances render esophageal cancer patients highly susceptible to malnutrition. Perioperative nutritional support therapy plays a crucial role in enhancing surgical safety, improving clinical outcomes, and elevating patients' quality of life by regulating metabolic homeostasis, preserving organ function, and optimizing the immune microenvironment. This article reviews the mechanisms underlying malnutrition in esophageal cancer, methods for nutritional status assessment, and precision intervention pathways based on multi-omics evaluations. The aim is to strengthen clinicians' awareness of standardized perioperative nutritional management for esophageal cancer patients and promote its clinical implementation, thereby facilitating postoperative recovery and improving long-term quality of life.

Objective: To analyze the current burden of autism spectrum disorder (ASD) among children and adolescents in China and globally, and to predict the disease burden from 2024 to 2035, providing a scientific basis for formulating relevant public health policies and intervention measures. Methods: Based on the Global Burden of Disease (GBD) database in 2023, the Joinpoint regression model was used to analyze the changing trends of the disease burden of ASD among children and adolescents in China and globally from 1990 to 2023, and the average annual percent change (AAPC) was calculated. An autoregressive integrated moving average (ARIMA) model was constructed to predict the disease burden trends of ASD among children and adolescents in China and globally from 2024 to 2035. Results: The prevalence and disability adjusted life years (DALYs) rate of ASD among children and adolescents in China increased from 452.69/100 000 and 86.67/100 000 in 1990 to 762.84/100 000 and 148.52/ 100 000 in 2023(AAPC=1.60%, 1.65%, both P <0.01). The prevalence and DALYs rate of ASD among children and adolescents globally increased from 648.49/100 000 and 123.47/100 000 to 862.44/100 000 and 167.16/100 000(AAPC=0.87%, 0.93%, both P <0.01). In 2023, the highest ASD prevalence and DALY rates occurred in children under 5 years old, with China reporting 848.14/100 000 and 166.69/100 000, both below the global averages of 928.80/100 000 and 181.34/100 000. Projections indicated that by 2035, the ASD prevalence and DALY rates in China would rise to 906.83/100 000 and 168.71/100 000, still below the global averages of 938.04/100 000 and 184.49/100 000. Conclusion The disease burden of ASD among children and adolescents in China and globally has generally increased from 1990 to 2023, with a higher risk of disease at younger ages.

ObjectiveThis paper aims to investigate and evaluate the staged efficacy and safety of the representative empirical prescription of the “Zhu Ke Jiao” theory， Qijia Rougan prescription， combined with entecavir in the treatment of hepatic fibrosis in chronic hepatitis B. MethodsA multicenter randomized controlled clinical study was conducted， and 101 patients diagnosed with chronic hepatitis B-related hepatic fibrosis （CHB-HF） who met the diagnosis and inclusion criteria were randomly assigned to an observation group （Qijia Rougan prescription + entecavir） and a control group （entecavir）. The treatment duration was 24 weeks. Liver stiffness measurement （LSM）， fibrosis-4 index （FIB-4）， portal vein diameter， hepatitis B serology， biochemical indicators， hepatic fibrosis markers in serum ［hyaluronic acid （HA）， laminin （LN）， procollagen Ⅲ peptide （PⅢP）， and type Ⅳ collagen （Ⅳ-C）］， and traditional Chinese medicine syndrome scores were used as efficacy evaluation indicators. Efficacy assessments and explorations of different staged subgroups of Qijia Rougan prescription were conducted according to LSM values based on the Metavir pathological staging standard. ResultsA total of 98 cases were included for statistical analysis， with 49 cases in the observation group and 49 in the control group. The general data of the patients in both groups were comparable. Compared with the same group before treatment， the observation group showed a significant reduction in LSM and FIB-4 （P<0.01）， as well as notable improvements in LN， Ⅳ-C， and various TCM syndrome scores （P<0.05， P<0.01）. When compared to the control group after treatment， the observation group demonstrated significant improvements in LSM， FIB-4， and various TCM syndrome score indicators （P<0.05， P<0.01）， indicating that the observation group performed better than the control group. Subgroup analysis of the regression of hepatic fibrosis stages showed that compared to the same group before treatment， the observation group had better improvement in regression of stages F2 and F3 （P<0.05）. When compared to the control group after treatment， the observation group exhibited superior improvement in regression of stage F3 （P<0.05）. No adverse events occurred in either group during the treatment period. ConclusionCompared with entecavir alone， the combination of Qijia Rougan prescription and entecavir significantly improves the degree of hepatic fibrosis and clinical TCM symptoms in patients. The optimal intervention period is primarily during stage F3， which is a potential “interception” point of the “Zhu Ke Jiao” theory.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo observe the changes in the levels of different subtypes of epidermal growth factor receptor （ErbB）， namely ErbB1， ErbB2， ErbB3， and ErbB4， in the spinal dorsal horn of inflammatory pain model rats， and to explore their mechanism of mediating hyperalgesia as well as the intervention mechanism of electroacupuncture at "Zusanli （ST 36）" and "Kunlun （BL 60）". MethodsThe study was divided into five parts. In experiment 1， 14 Sprague Dawley （SD） rats were randomly divided into control and inflammatory pain group （7 rats each group） to observe the pain behavior and the protein expression of different ErbB receptor subtypes in the spinal dorsal horn. In experiment 2， 30 rats were randomly divided into control group 1， inflammatory pain group 1， and low-， medium-， and high-concentration TX1-85-1 groups， with 6 rats in each group， to observe the effect of inhibiting spinal ErbB3 on inflammatory pain. In experiment 3， 12 rats were randomly divided into control virus group and ErbB3 knockdown virus group， with 6 rats in each group， to observe the effect of knocking down ErbB3 in the spinal dorsal horn on inflammatory pain. In experiment 4， 44 rats were randomly divided into control group 2， inflammatory pain group 2， electroacupuncture group， and sham electroacupuncture group， with 11 rats in each group， to observe the effect of electroacupuncture. In experiment 5， 40 rats were randomly divided into control group 3， inflammatory pain group 3， electroacupuncture group 1， and electroacupuncture + NRG1 group， with 10 rats in each group， to observe the effect of activating ErbB3 on electroacupuncture. A rat model of inflammatory pain was established by subcutaneous injection of 100 μl of complete Freund's adjuvant into the sole of the unilateral hind foot of SD rats. Rats in the low-， medium-， and high-concentration TX1-85-1 groups were intrathecally injected with ErbB3 inhibitor TX1-85-1 on day 5 to day 7 after modeling. Rats in the ErbB3 knockdown virus group were injected with ErbB3 knockdown virus packaged with adenovirus vector-based short hairpin RNA （shRNA） into the spinal dorsal horn in situ 3 weeks before modeling. Rats in each electroacupuncture group received electroacupuncture at bilateral "Zusanli （ST 36）" and "Kunlun （BL 60）" from day 1 to day 7 after modeling， with dense-sparse waves at a frequency of 2 Hz/100 Hz and a current of 0.5-1.5 mA for 30 minutes once a day. Rats in the electroacupuncture + NRG1 group were intrathecally injected with ErbB3 ligand recombinant human neuregulin-1 （NRG1） after electroacupuncture intervention from day 5 to day 7 after modeling. The mechanical withdrawal threshold and thermal withdrawal latency of rats were measured on day 1， 3， 5， and 7 after modeling to evaluate behavior， and Western Blot was used to detect the protein and phosphorylation levels of each ErbB subtype in the spinal dorsal horn. ResultsCompared with the control group， rats in the inflammatory pain group showed decreased mechanical withdrawal threshold and thermal withdrawal latency of rats， and increased expression of phosphorylated ErbB3 （p-ErbB3） protein in the spinal dorsal horn on days 1， 3， 5， and 7 after modeling （P＜0.01）. On day 5 and day 7 after modeling， compared with the inflammatory pain group 1， the mecha-nical withdrawal threshold and thermal withdrawal latency of rats in the medium- and high-concentration TX1-85-1 groups increased， and the expression of p-ErbB3 protein decreased （P＜0.05）. On day 1， 3， 5， and 7 after modeling， compared with the control virus group， the mechanical withdrawal threshold and thermal withdrawal latency of rats in the ErbB3 knockdown virus group increased （P＜0.05）. On day 5 and day 7 after modeling， compared with the inflammatory pain group 2 and the sham electroacupuncture group， the mechanical withdrawal threshold and thermal withdrawal latency of rats in the electroacupuncture group increased， and the expression of p-ErbB3 protein decreased （P＜0.05）. On day 5 and day 7 after modeling， compared with the electroacupuncture + NRG1 group， the mechanical withdrawal threshold and thermal withdrawal latency of rats in the electroacupuncture group 1 increased （P＜0.05）. ConclusionThe p-ErbB3 in the spinal dorsal horn involved in hyperalgesia in rats with inflammatory pain， and electroacupuncture at "Zusanli （ST 36）" and "Kunlun （BL 60）" can alleviate inflammatory pain by inhibiting the expression of p-ErbB3 protein in the spinal dorsal horn of rats.

Objective: To analyze the epidemiological characteristics and influencing factors of severe fever with thrombocytopenia syndrome (SFTS) in Zhejiang Province from 2019 to 2023, so as to provide the reference for strengthening SFTS prevention and control. Methods: Data on laboratory-confirmed SFTS cases in Zhejiang Province from 2019 to 2023 were collected through the Infectious Disease Reporting Information System of Chinese Disease Prevention and Control Information System. Meteorological data, geographic environment and socioeconomic factors during the same period were collected from the fifth-generation European Centre for Medium-Range Weather Forecasts, Geospatial Data Cloud, and Zhejiang Statistical Yearbook, respectively. Descriptive epidemiological methods were used to analyze the epidemiological characteristics of SFTS from 2019 to 2023, and a Bayesian spatio-temporal model was constructed to analyze the influencing factors of SFTS incidence. Results: A total of 578 SFTS cases were reported in Zhejiang Province from 2019 to 2023, with an annual average incidence of 0.23/105. The peak period was from May to July, accounting for 52.60%. There were 309 males and 269 females, with a male-to-female ratio of 1.15∶1. The cases were mainly aged 50-<80 years, farmers, and in rural areas, accounting for 82.53%, 77.34%, and 75.43%, respectively. Taizhou City and Shaoxing City reported more SFTS cases, while Shaoxing City and Zhoushan City had higher annual average incidences of SFTS. The Bayesian spatio-temporal interaction model showed good goodness of fit. The results showed that mean temperature (RR=1.626, 95%CI: 1.111-2.378) and mean wind speed (RR=1.814, 95%CI: 1.321-2.492) were positively correlated with SFTS risk, while altitude (RR=0.432, 95%CI: 0.230-0.829) and population density (RR=0.443, 95%CI: 0.207-0.964) were negatively correlated with SFTS risk. Conclusions SFTS in Zhejiang Province peaks from May to July. Middle-aged and elderly people and farmers are high-risk populations. Taizhou City, Shaoxing City, and Zhoushan City are high-incidence areas. Mean temperature, mean wind speed, altitude, and population density can all affect the risk of SFTS incidence.

ObjectiveThis paper aims to observe the role of Danlou tablet in treating coronary heart disease （CHD） with phlegm-stasis intermingling syndrome in minipigs by improving platelet function and explore the potential pharmacological mechanism of Danlou tablet in regulating platelet function by using proteomics technology. MethodsThirty Bama minipigs were randomly divided into a normal control group （6 pigs） and a high-fat diet group （24 pigs）. After 2 weeks of high-fat diet feeding， the high-fat diet group was randomly subdivided into a model group， an atorvastatin group （1 mg·kg^-1）， and Danlou tablet groups （0.6 g·kg^-1 and 0.3 g·kg^-1）. All groups continued to receive a high-fat diet for 8 weeks after the procedure. The normal control group was given a regular diet， underwent only coronary angiography， and did not receive an interventional injury procedure. The model group and each administration group were fed a high-fat diet. Two weeks later， they underwent a coronary angiography injury procedure. After the procedure， drugs were mixed into the feed every morning for 8 consecutive weeks， with the minipigs maintained on a continuous high-fat diet during this period. Quantitative proteomics technology was further used to study platelet proteins， and differential proteins were obtained by screening. Bioinformatics analysis was performed to analyze key regulatory proteins and biological pathways involved in the therapeutic effect of Danlou tablet on CHD with phlegm-stasis intermingling syndrome. ResultsCompared with the normal control group， the model group showed a significant increase in total cholesterol （TC）， triglyceride （TG）， high-density lipoprotein cholesterol （HDL-C）， and low-density lipoprotein cholesterol （LDL-C） of minipigs' serum （P<0.01）， a significant shortening in prothrombin time of （PT） （P<0.01）， a coagulation function index， and an increase in whole blood viscosity （P<0.01） and platelet aggregation rate （P<0.01）. Moreover， the platelet morphology was altered， and the contents of endothelin-1 （ET-1） and nitric oxide （NO） were significantly increased （P<0.01）. Hemodynamic parameters were obviously abnormal， including significantly decreased systolic blood pressure （SBP）， diastolic blood pressure （DBP）， mean arterial pressure （MAP）， left ventricular systolic pressure （LVSP）， and left ventricular maximal positive dp/dt （LV+dp/dt_max） （P<0.01）. Left ventricular maximal negative dp/dt （LV-dp/dt_max） was significantly increased （P<0.01）. Besides， there were myocardial cell hypertrophy， obvious edematous degeneration， massive interstitial inflammatory cell infiltration， high degree of fibrosis， and coronary endothelial atherosclerosis. TC and TG levels in minipigs' serum were significantly reduced in Danlou tablet groups with 0.6 g·kg^-1 and 0.3 g·kg^-1 （P<0.05， P<0.01）， compared with those in the model group. LDL-C was decreased in the Danlou tablet group with 0.6 g·kg^-1 （P<0.05）. The whole blood viscosity under low and high shear conditions was significantly reduced in the Danlou tablet group with 0.6 g·kg^-1 （P<0.05）. In groups with all doses of Danlou tablet， maximum aggregation rate （MAR） and average aggregation rate （AAR） were significantly decreased （P<0.05， P<0.01）， and platelets' morphological changes such as pseudopodia extension were reduced. ET-1 levels in the serum were significantly reduced. In the Danlou tablet group with 0.6 g·kg^-1， NO level in the serum was reduced （P<0.05）. In groups with all doses of Danlou tablet， DBP and MAP were significantly increased （P<0.05）. In the Danlou tablet group with 0.6 g·kg^-1， LVSP and LV+dp/dt_max were significantly increased （P<0.05， P<0.01）， and LV-dp/dt_max was significantly decreased （P<0.05）. In groups with all doses of Danlou tablet， edematous degeneration in myocardial tissue was milder， and coronary artery lesion degree was significantly alleviated. Compared with the normal control group， there were 94 differentially expressed proteins in the model group， including 81 up-regulated and 13 down-regulated proteins. Compared with the model group， the Danlou tablet group with 0.6 g·kg^-1 showed 174 differentially expressed proteins， including 100 up-regulated and 74 down-regulated proteins. A total of 30 proteins were reversed after Danlou tablet intervention. Bioinformatics analysis revealed that its pharmacological mechanism may exert anti-platelet activation， aggregation， and adhesion effects through biological pathways such as regulation of actin cytoskeleton， platelet activation pathway， Fcγ receptor-mediated phagocytosis， as well as proteins such as growth factor receptor-bound protein 2 （GRB2）， Ras-related C3 botulinum toxin substrate 2 （RAC2）， RAC1， and heat shock protein 90 alpha family class A member 1 （HSP90AA1）. ConclusionDanlou tablet can effectively reduce platelet activation and aggregation， exerting a good therapeutic effect on CHD with phlegm-stasis intermingling syndrome in minipigs. Its pharmacological mechanism may involve regulating biological pathways such as actin cytoskeleton and platelet activation pathway， as well as proteins like GRB2， RAC2， RAC1， and HSP90AA1， thereby exerting a pharmacological effect in anti-platelet activation， aggregation， and adhesion.

Objective: To analyze the relationship of gross motor skills and perceptual motor abilities with physical activity levels in preschool children in a Beijing kindergarten, so as to provide a reference for promoting the development of motor competence. Methods: From September 2018 to March 2021, preschoolers aged 4-5 years were selected using convenience sampling method from an urban kindergarten in Beijing. The Test of Gross Motor Development-Third Version(TGMD-3) was used to assess basic preschoolers s gross motor skills ( n =152). The Pictorial Scale of Perceived Movement Skill Competence(PMSC) was used to evaluate perceptual motor skills ( n =151). Accelerometers (Actigraph GT3X) were used to record physical activity levels ( n =52). Data were analyzed using one way analysis of variance (ANOVA) and Pearson correlation coefficients. Results: The mean scores for gross motor skills and perceptual motor abilities were (38.76±13.48) and (35.49±6.50), respectively. The moderate to vigorous physical activity(MVPA) level was(52.60±27.44) minutes per day. No statistically significant correlations were found between gross motor skills, perceptual motor abilities MVPA among boys, girls or the overall group ( r =-0.20 to 0.25, all P >0.05). However, Boys locomotor skills, overall children s locomotor skills, and boys gross motor skills were all positively correlated with MVPA( r =0.34-0.45, all P <0.05). Conclusion There is a correlation between locomotor skills and physical activity levels in 4 to 5-year-old children.

Objective:To explore the clinical characteristics, diagnosis and treatment strategies, and prognosis of pulmonary embolism (PE) complicating childhood rheumatic diseases.Methods:A retrospective case series study was performed on the demographic data, laboratory indicators, imaging features, treatment regimens, and follow-up data of 8 children with rheumatic diseases complicated by PE who were admitted to the Department of Rheumatology and Immunology, Capital Center for Children′s Health, Capital Medical University from January 2014 to October 2023.Results:Among the 8 children, there were 4 boys and 4 girls, with an age of 12.0 (7.5, 13.0) years. Among the primary diseases, there were 3 cases of systemic lupus erythematosus, 2 cases of Beh?et′s disease, 2 cases of Takayasu arteritis, and 1 case of antiphospholipid syndrome. All children developed PE during the active phase of the primary disease. PE was detected at the onset of the primary disease in 3 cases, and the median time from the diagnosis of the primary disease to the development of PE was 10.0 (6.0, 25.0) months in the remaining 5 cases. Fever was present in all 8 children, 4 cases were accompanied by chest tightness, dyspnea, etc., and 2 cases only presented with fever. Laboratory examinations revealed the following results: erythrocyte sedimentation rate was 42.0 (17.0, 78.0) mm/1 h, high-sensitivity C-reactive protein was 12.7 (2.6, 78.7) mg/L, white blood cell count was 9.6 (7.2, 18.7)×10 9/L; D-dimer was 2.3 (0.9, 6.2) mg/L; and hemoglobin was (109±16) g/L.Imaging examinations revealed that 5 cases had involvement of the bilateral lower pulmonary arteries, 5 cases had peripheral embolism, and 3 cases had central PE. Complications included 3 cases of deep vein thrombosis, 2 cases of intracranial venous sinus thrombosis, and 1 case of mild pulmonary hypertension.In terms of treatment, 7 cases received anticoagulation with heparin followed by warfarin. Immunomodulation was mainly based on glucocorticoids combined with immunosuppressants, and 4 cases were combined with biological agents. The follow-up time of 4.17 (1.75, 7.17) years, the time for complete absorption of PE was 10.5 (6.0, 18.0) months; all 8 children had no target events, with no recurrence or chronic thromboembolic pulmonary hypertension, and the pulmonary artery remodeling was good. Conclusions:PE complicating childhood rheumatic diseases is closely related to the activity of the primary disease. The clinical manifestations are insidious, with fever as the main symptom. Imaging examination is the key to diagnosis.Early adoption of heparin followed by warfarin anticoagulation and glucocorticoids combined with immunosuppressants and (or) biological agents to control the primary disease can achieve a favorable prognosis.