1.Research progress on the role of antigen-presenting cells in xenotransplantation
Kankan SHUI ; Haoran ZHOU ; Ye XU ; Qiulin LUO ; Tengfang LI ; Hedong ZHANG ; Longkai PENG ; Helong DAI
Organ Transplantation 2026;17(1):9-15
Organ transplantation is an effective alternative treatment for patients with end-stage organ failure. However, the shortage of donor organs has limited the widespread application of clinical transplantation. In recent years, breakthroughs in CRISPR-Cas9 gene editing technology have overcome the barrier of hyperacute rejection in xenotransplantation, offering a potential solution to the organ shortage crisis. Rejection remains a critical factor affecting graft survival. Antigen-presenting cells play a vital role in the initiation and progression of rejection and immune regulation in xenotransplantation. Therefore, in-depth investigation into the role of antigen-presenting cells in xenotransplantation is of great significance. This article summarizes the roles and therapeutic strategies of professional antigen-presenting cells, including macrophages, dendritic cells and B cells in xenotransplantation, aiming to provide insights for future research on immune regulation mechanisms in this field.
2.Staged Characteristics of Mitochondrial Energy Metabolism in Chronic Heart Failure with Heart-Yang Deficiency Syndrome and Prescription Intervention from Theory of Reinforcing Yang
Zizheng WU ; Xing CHEN ; Lichong MENG ; Yao ZHANG ; Peng LUO ; Jiahao YE ; Kun LIAN ; Siyuan HU ; Zhixi HU
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(5):129-138
Chronic heart failure (CHF) is a complex clinical syndrome caused by ventricular dysfunction, with mitochondrial energy metabolism disorder being a critical factor in disease progression. Heart-Yang deficiency syndrome, as the core pathogenesis of CHF, persists throughout the disease course. Insufficiency of heart-Yang leads to weakened warming and propelling functions, resulting in the accumulation of phlegm-fluid, blood stasis, and dampness. This eventually causes Qi stagnation with phlegm obstruction and blood stasis with water retention, forming a vicious cycle that exacerbates disease progression. According to the theory of reinforcing Yang, the clinical experience of the traditional Chinese medicine (TCM) master Tang Zuxuan in treating CHF with heart-Yang deficiency syndrome, and achievements from molecular biological studies, this study innovatively proposes an integrated research framework of "TCM syndrome differentiation and staging-mitochondrial metabolism mechanisms-intervention with Yang-reinforcing prescriptions" which is characterized by the integration of traditional Chinese and Western medicine. Heart-Yang deficiency syndrome is classified into mild (Stage Ⅰ-Ⅱ), severe (Stage Ⅲ), and critical (Stage Ⅳ) stages. The study elucidates the precise correlations between the pathogenesis of each stage and mitochondrial metabolism disorders from theoretical, pathophysiological, and therapeutic perspectives. The mild stage is characterized by impaired biogenesis and substrate-utilization imbalance, corresponding to heart-Yang deficiency and phlegm-fluid aggregation. Linggui Zhugantang and similar prescriptions can significantly improve the expression of peroxisome proliferator-activated receptor gamma co-activator-1α(PGC-1α)/silent information regulator 2 homolog 1 (SIRT1) and ATPase activity. The severe stage centers on oxidative stress and structural damage, reflecting Yang deficiency with water overflow and phlegm-blood stasis intermingling. At this stage, Zhenwu Tang and Qiangxin Tang can effectively mitigate oxidative stress damage, increase adenosine triphosphate (ATP) content, and repair mitochondrial structure. The critical stage arises from calcium overload and mitochondrial disintegration, leading to the collapse of Yin-Yang equilibrium. At this stage, Yang-restoring and crisis-resolving prescriptions such as Fuling Sini Tang and Qili Qiangxin capsules can inhibit abnormal opening of the mitochondrial permeability transition pore (MPTP), reduce cardiomyocyte apoptosis rate, and protect mitochondrial function. By summarizing the characteristics of mitochondrial energy metabolism disorders at different stages of CHF, this study explores the application of the theory of reinforcing Yang in treating heart-Yang deficiency syndrome and provides new insights for the clinical diagnosis and treatment of CHF.
3.Reporting Status of Clinical Practice Guideline Protocols: A Systematic Analysis
Huayu ZHANG ; Xufei LUO ; Hui LIU ; Qi ZHOU ; Yishan QIN ; Ye WANG ; Yuanyuan YAO ; Haodong LI ; Xiaohui WANG ; Yaolong CHEN
Medical Journal of Peking Union Medical College Hospital 2026;17(1):255-262
To systematically analyzed the reporting status of core elements in publicly available clinical practice guideline(hereafter referred to as "guideline") protocols published domestically and internationally over the past decade, identified existing problems, and provided evidence to inform the standardized writing and publication of future guideline protocols. A systematic search was conducted in Chinese and English databases for clinical practice guideline protocols published during the past ten years. The basic characteristics and reporting of core elements—including registration information, conflict of interest management, evidence grading, development process and timeline planning, as well as dissemination and implementation—were extracted and analyzed. Chi-square tests were performed to explore associations between protocol characteristics and the reporting of core elements. A total of 94 guideline protocols were included, of which 67 were in Chinese(71.28%) and 27 were in English(28.72%). Overall, 82.98% of the guideline protocols were registered, 92.55% reported management of conflicts of interest, 97.87% reported evidence searching, 88.30% reported evidence grading, and 89.36% described dissemination and implementation strategies. However, only 55.32% reported the guideline development process, and merely 23.40% reported timeline planning. Further analysis indicated that the reporting of registration, evidence searching, development process, and timeline planning was associated with year of publication. Differences were observed between domestic and international guidelines in reporting registration, conflict of interest management, development process, time planning, and dissemination and implementation. Guidelines intended for development exhibited higher reporting rates for registration, development process, and dissemination and implementation compared to those planned for updating or adaptation. Although current guideline protocols demonstrate relatively adequate reporting of methodological elements, deficiencies remain in development process and timeline planning. Future efforts should focus on promoting the publication and standardized reporting of guideline protocols, enhancing the international recognition of registration platforms, and strengthening the development process and timeline planning to advance the scientific rigor and transparency of guideline development.
4.Relationship between NLR and Hcy and the risk of coronary artery lesion progression in patients with hypertension
Jibiao LIN ; Ling YE ; Ruiying LUO ; Zirong FANG
Journal of Public Health and Preventive Medicine 2026;37(1):121-125
Objective To investigate the relationship of neutrophil to lymphocyte ratio (NLR) and homocysteine (Hcy) with risk of coronary artery lesion progression in patients with hypertension. Methods The data of 306 patients with hypertension who received coronary angiography from January 2020 to January 2025 were included for retrospective investigation. The patients were divided into a non-progression group (175 cases) and a progression group (131 cases) based on the 6-month Gensini progression rate. The relationship between NLR and Hcy and coronary artery lesion progression was analyzed. Results Binary logistic regression analysis was applied to control confounding factors. After adjusting for confounding factors using Model1, Model2, and Model3, it was found that NLR and Hcy at admission were independently associated with the progression of coronary artery lesion in hypertensive patients [adjusted OR (95% CI) = 1.77 (1.48-2.11), 4.26 (2.71-6.69), P<0.001]. Receiver operating characteristic (ROC) curve revealed that the area under the curve of the combination of Hcy and NLR was 0.814 in predicting the progression of coronary artery lesion in hypertensive patients, which was higher than that of Hcy or NLR (Z/P=5.328, 2.077/<0.05). Conclusion Cardiovascular disease risk factors NLR and Hcy are independently associated with coronary artery lesion progression in patients with hypertension. Early detection of NLR and Hcy is helpful to predict the progression of coronary artery lesion.
5.Key Information Research on Famous Classical Formula Shegan Mahuangtang
Cheng LUO ; Yuanhang YE ; Bo NING ; Fei WANG
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(6):180-188
Shegan Mahuangtang was a famous classical formula for treating asthma and is included in the the Catalogue of Ancient Famous Classical Formulas(The Second Batch). By means of bibliometrics, this study conducts a textual research and analysis on the key information of its formula origin, composition, drug origins, processing, dosage, decocting methods, efficacy, and clinical application. According to research, Shegan Mahuangtang was first recorded in Synopsis of the Golden Chamber and is the ancestral formula for treating cold asthma, which has been used to this day. Suggestions for the drug origins in Shegan Mahuangtang is as follows:Shegan is selected from the dried rhizomes of Belamcanda chinensis(Iridaceae), Mahuang is selected from the dried herbaceous stems of Ephedra sinica(Ephedraceae), Shengjiang is selected from the fresh rhizomes of Zingiber officinale(Zingiberaceae), Xixin is selected from the dried roots and rhizomes of Asarum heterotropoides var. mandshuricum, A. sieboldii var. seoulense or A. sieboldii(Aristolochiaceae), Ziwan is selected from the dried roots and rhizomes of Aster tataricus(Compositae), Kuandonghua is selected from the dried flower buds of Tussilago farfara(Compositae), Nanwuweizi is selected from the dried mature fruits of Schisandra sphenanthera(Magnoliaceae), Dazao is selected from the dried mature fruit of Ziziphus jujuba(Rhamnaceae), and Banxia, a plant of the Araceae family, is selected as the processed products of dried tubers from Pinellia ternata. The recommended dosage is 41.4 g of Shegan, Xixin, Ziwan and Kuandonghua, 55.2 g of Mahuang and Shengjiang, 37.5 g of Nanwuweizi, 21 g of Dazao, 34.5 g of Banxia. The decoction method is to boil Mahuang first in 2.4 L of water, remove the froth on the top, and add the rest of the herbs and decoct them together, and then boil them to 600 mL, and then take it at warm temperature, 200 mL each time, 3 times a day. In terms of clinical application, Shegan Mahuangtang is most commonly used for respiratory system diseases, especially in the treatment of adult or pediatric bronchial asthma and cough variant asthma. Phlegm sound in the throat is the core symptom of Shegan Mahuangtang in clinical practice, and the core pathogenesis is "cold fluid stagnated in the lungs". By excavating and sorting out the ancient and modern literature of Shegan Mahuangtang, key information is confirmed, which can provide literature reference for the modern clinical application and new drug development of this famous classical formula.
6.Finite element analysis of various root shield thicknesses in maxillary central incisor socket-shield technique
Guangneng CHEN ; Siyang LUO ; Mei WANG ; Bin YE ; Jiawen CHEN ; Yin LIU ; Yuwen ZUO ; Xianyu HE ; Jiajin SHEN ; Minxian MA
Chinese Journal of Tissue Engineering Research 2025;29(10):2052-2060
BACKGROUND:Socket-shield technique can effectively maintain labial soft and hard tissues,but the incidence of postoperative complications such as exposure and displacement of root shield is relatively high.It is speculated that the root shield may be exposed and displaced due to excessive load after long-term function of dental implants. OBJECTIVE:Through three-dimensional finite element analysis,we aim to study the influence of varying root shield thicknesses on the stress distribution,equivalent stress peaks,and displacement in the root shield,periodontal ligaments,implant,and surrounding alveolar bone under normal occlusal loading.We also attempt to analyze the correlation between the thickness of the root shield and occurrence of mechanical events such as root shield exposure,displacement,and fracture. METHODS:Cone-beam CT data of a patient who met the indication standard of socket-shield technique for maxillary central incisor were retrieved from database.Reverse engineering techniques were used to build models of the maxillary bone and root shield,while forward engineering was used to create models for the implant components based on their parameters.Models depicting various root shield thicknesses(0.5,1.0,1.5,and 2.0 mm)were created using Solidworks 2022 software.ANSYS Workbench 2021 software was then used to simulate and analyze the effects of varying root shield thicknesses on stress distribution,equivalent stress peaks,and displacement of the root shields,periodontal ligaments,implants,and surrounding alveolar bone under normal occlusion. RESULTS AND CONCLUSION:(1)In all root shield models,the stress was concentrated on the palatal cervical side,both sides of the edges and the lower edge of the labial side.As the thickness of the root shield increased,the equivalent stress peak and displacement showed a decreasing trend.The 0.5 mm thickness model produced a stress concentration of 176.20 MPa,which exceeded the yield strength(150 MPa)of tooth tissue.(2)The periodontal ligament stress in each group was concentrated in the neck margin and upper region.With the increase of root shield thickness,the equivalent stress peak and displacement of periodontal ligament showed a decreasing trend.(3)Implant stress in all models was concentrated in the neck of the implant and the joint of the implant-repair abutment,and the labial side was more concentrated than the palatal side.With the increase of root shield thickness,the equivalent stress peak of the implant in the model showed an increasing trend.(4)In each group of models,stress of cortical bone concentrated around the neck of the implant and the periphery of the root shield,and the labial side was more concentrated than the palatal side.With the increase of the thickness of the root shield,the equivalent stress peak around the root shield decreased;the peak value of the equivalent stress of the bone around the neck of the implant showed an increasing trend.In the model,the stress of cancellous bone was mainly concentrated around the neck of the lip of the implant,the top of the thread,the root tip and the lower margin of the root shield,and the labial side was more concentrated than the palatal side.With the increase of the thickness of the root shield,the peak value of the equivalent stress of the bone around the root shield in the model showed a decreasing trend.The minimum principal stress of cortical bone in each group of models was concentrated around the neck of the implant,exhibiting a fan-shaped distribution.As the thickness of the root shield increased,the minimum principal stress of cortical bone showed an increasing trend.(5)These results indicate that different thicknesses of the root shield have different biomechanical effects.The root shield with a thickness of 0.5 mm is easy to fracture.For patients with sufficient bone width,the root shield with a thickness of 2.0 mm is an option to reduce the risk of complications such as root shield exposure,fracture,and displacement.Meanwhile,it should be taken into account to protect the periodontal ligament in the preparation process,and rounding treatments ought to be carried out on both sides and the lower edge of the root shield.
7.Chinese Medicine Regulates Ferroptosis to Treat Lung Cancer: A Review
Cheng LUO ; Yuanhang YE ; Bo NING ; Jia KE
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(2):268-278
This article provides a systematic review of the research progress in the mechanisms related to lung cancer and ferroptosis, ferroptosis-related lung cancer biomarkers and gene mutation targets, and ferroptosis-targeted regulation of Chinese medicine in treating lung cancer in the past five years, providing a feasible and effective basis for the prevention and treatment of lung cancer with Chinese medicine and the development of new drugs. According to the available studies, ferroptosis is widely suppressed in lung cancer, while the specific regulatory mechanisms have not been fully elucidated. The suppression is related to lipid metabolism, iron metabolism, cystine/glutamate antiporter system Xc- (System Xc-)/glutathione (GSH)/glutathione peroxidase 4 (GPX4), ferroptosis suppressor protein 1 (FSP1)/coenzyme Q10 (CoQ10)/nicotinamide adenine dinucleotide phosphate [NAD(P)H], long non-coding RNA (lncRNA), nuclear factor E2-related factor 2 (Nrf2), and p53. In modern times, traditional Chinese medicine is widely used in the comprehensive treatment of lung cancer, and it has gradually become a hot research topic due to its obvious advantages of anti-tumor activity, high efficacy, and low toxicity. Traditional Chinese medicine plays an important role in the treatment of lung cancer. Studies have shown that the active components, extracts, and prescriptions of Chinese medicine can induce ferroptosis in lung cancer cells through targeted regulation of iron metabolism, lipid metabolism, and p53, Nrf2, LncRNA, and GPX4 pathways to inhibit the growth and proliferation of lung cancer, thus exerting anti-tumor effects. Therefore, regulating ferroptosis is expected to become a new direction for preventing lung cancer. Basic research has shown that Chinese medicine can regulate ferroptosis via multiple targets and pathways in the treatment of lung cancer. At present, Chinese medicine demonstrates great research prospects in regulating ferroptosis to treat lung cancer, which, howeve, still faces challenges to achieve clinical transformation.
8.Role of SWI/SNF Chromatin Remodeling Complex in Tumor Drug Resistance
Gui-Zhen ZHU ; Qiao YE ; Yuan LUO ; Jie PENG ; Lu WANG ; Zhao-Ting YANG ; Feng-Sen DUAN ; Bing-Qian GUO ; Zhu-Song MEI ; Guang-Yun WANG
Progress in Biochemistry and Biophysics 2025;52(1):20-31
Tumor drug resistance is an important problem in the failure of chemotherapy and targeted drug therapy, which is a complex process involving chromatin remodeling. SWI/SNF is one of the most studied ATP-dependent chromatin remodeling complexes in tumorigenesis, which plays an important role in the coordination of chromatin structural stability, gene expression, and post-translation modification. However, its mechanism in tumor drug resistance has not been systematically combed. SWI/SNF can be divided into 3 types according to its subunit composition: BAF, PBAF, and ncBAF. These 3 subtypes all contain two mutually exclusive ATPase catalytic subunits (SMARCA2 or SMARCA4), core subunits (SMARCC1 and SMARCD1), and regulatory subunits (ARID1A, PBRM1, and ACTB, etc.), which can control gene expression by regulating chromatin structure. The change of SWI/SNF complex subunits is one of the important factors of tumor drug resistance and progress. SMARCA4 and ARID1A are the most widely studied subunits in tumor drug resistance. Low expression of SMARCA4 can lead to the deletion of the transcription inhibitor of the BCL2L1 gene in mantle cell lymphoma, which will result in transcription up-regulation and significant resistance to the combination therapy of ibrutinib and venetoclax. Low expression of SMARCA4 and high expression of SMARCA2 can activate the FGFR1-pERK1/2 signaling pathway in ovarian high-grade serous carcinoma cells, which induces the overexpression of anti-apoptosis gene BCL2 and results in carboplatin resistance. SMARCA4 deletion can up-regulate epithelial-mesenchymal transition (EMT) by activating YAP1 gene expression in triple-negative breast cancer. It can also reduce the expression of Ca2+ channel IP3R3 in ovarian and lung cancer, resulting in the transfer of Ca2+ needed to induce apoptosis from endoplasmic reticulum to mitochondria damage. Thus, these two tumors are resistant to cisplatin. It has been found that verteporfin can overcome the drug resistance induced by SMARCA4 deletion. However, this inhibitor has not been applied in clinical practice. Therefore, it is a promising research direction to develop SWI/SNF ATPase targeted drugs with high oral bioavailability to treat patients with tumor resistance induced by low expression or deletion of SMARCA4. ARID1A deletion can activate the expression of ANXA1 protein in HER2+ breast cancer cells or down-regulate the expression of progesterone receptor B protein in endometrial cancer cells. The drug resistance of these two tumor cells to trastuzumab or progesterone is induced by activating AKT pathway. ARID1A deletion in ovarian cancer can increase the expression of MRP2 protein and make it resistant to carboplatin and paclitaxel. ARID1A deletion also can up-regulate the phosphorylation levels of EGFR, ErbB2, and RAF1 oncogene proteins.The ErbB and VEGF pathway are activated and EMT is increased. As a result, lung adenocarcinoma is resistant to epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs). Although great progress has been made in the research on the mechanism of SWI/SNF complex inducing tumor drug resistance, most of the research is still at the protein level. It is necessary to comprehensively and deeply explore the detailed mechanism of drug resistance from gene, transcription, protein, and metabolite levels by using multi-omics techniques, which can provide sufficient theoretical basis for the diagnosis and treatment of poor tumor prognosis caused by mutation or abnormal expression of SWI/SNF subunits in clinical practice.
9.Body fat distribution and semen quality in 4304 Chinese sperm donors.
Si-Han LIANG ; Qi-Ling WANG ; Dan LI ; Gui-Fang YE ; Ying-Xin LI ; Wei ZHOU ; Rui-Jun XU ; Xin-Yi DENG ; Lu LUO ; Si-Rong WANG ; Xin-Zong ZHANG ; Yue-Wei LIU
Asian Journal of Andrology 2025;27(4):524-530
Extensive studies have identified potential adverse effects on semen quality of obesity, based on body mass index, but the association between body fat distribution, a more relevant indicator for obesity, and semen quality remains less clear. We conducted a longitudinal study of 4304 sperm donors from the Guangdong Provincial Human Sperm Bank (Guangzhou, China) during 2017-2021. A body composition analyzer was used to measure total and local body fat percentage for each participant. Generalized estimating equations were employed to assess the association between body fat percentage and sperm count, motility, and morphology. We estimated that each 10% increase in total body fat percentage (estimated change [95% confidence interval, 95% CI]) was significantly associated with a 0.18 × 10 6 (0.09 × 10 6 -0.27 × 10 6 ) ml and 12.21 × 10 6 (4.52 × 10 6 -19.91 × 10 6 ) reduction in semen volume and total sperm count, respectively. Categorical analyses and exposure-response curves showed that the association of body fat distribution with semen volume and total sperm count was stronger at higher body fat percentages. In addition, the association still held among normal weight and overweight participants. We observed similar associations for upper limb, trunk, and lower limb body fact distributions. In conclusion, we found that a higher body fat distribution was significantly associated with lower semen quality (especially semen volume) even in men with a normal weight. These findings provide useful clues in exploring body fat as a risk factor for semen quality decline and add to evidence for improving semen quality for those who are expected to conceive.
Humans
;
Male
;
Adult
;
Semen Analysis
;
China
;
Body Fat Distribution
;
Longitudinal Studies
;
Sperm Count
;
Sperm Motility
;
Body Mass Index
;
Tissue Donors
;
Obesity/complications*
;
Spermatozoa
;
Young Adult
;
Middle Aged
;
East Asian People
10.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test


Result Analysis
Print
Save
E-mail