1.Analysis of influencing factors for maternal intentions to vaccinate age appropriate girls against human papillomavirus
QIU Xiaofei, KANG Xiao, ZHUANG Wenwen, GAO Riyue, ZHANG Delei, SHAO Yanyan, LI Xuedan, YANG Feng
Chinese Journal of School Health 2025;46(4):519-523
Objective:
To investigate the intentions of mothers of ageappropriate girls in Qingdao to vaccinate their daughters against human papillomavirus (HPV), so as to provide theoretical guidance for targeted health education in the future.
Methods:
A multistage random sampling method was adopted to conduct a crosssectional study among 2 244 mothers of girls aged 12-14 years in Qingdao from March to December 2023. The Mann-Whitney U test was used for group comparisons, and Logistic regression was performed to analyze the factors that influenced maternal intention to vaccinate their ageappropriate daughters against HPV.
Results:
Among the surveyed mothers, 89.22% (n=2 002) intended to vaccinate their daughters against HPV, and 68.58% (n=1 539) had fully vaccinated or had plans to complete it for themselves. The knowledge score of mothers intended to vaccinate their daughters was 10 (8, 11). The multivariate Logistic regression analysis showed that mothers aged >45 years (OR=0.19), those with an annual family income of 60 000-<150 000 yuan (OR=0.65), 150 000-<300 000 yuan (OR=0.58), 300 000-500 000 yuan (OR=0.22), and those with higher knowledge scores (OR=0.90) were more likely to vaccinate their daughters (P<0.05). Mothers with a junior college or undergraduate degree (OR=1.66), those who never or occasionally screened for HPV (OR=1.58), those who were intended to be vaccinated, not planning to complete the fullcourse vaccination, or overaged and unvaccinated (OR=7.13), those who were not concerned about their daughters HPV infection (OR=2.54), and those whose daughters were not in adolescence (OR=1.93) were less intended to vaccinate their daughters (P<0.05). The primary reasons for vaccine hesitancy were vaccine safety concerns (65.06%), followed by the belief of mothers that "the children is to young, and can be vaccinated when they are older" (13.25%).
Conclusions
Mothers of eligible girls in Qingdao have relatively higher intentions to vaccinate their daughters against HPV, and willingness is influenced by factors such as the mothers vaccination status, knowledge level, and daughters development stage. It is recommended to strengthen targeted health education, improve the cognitive level and acceptance of mother, and increase the vaccination rate of HPV vaccines.
2.Advance in correlation between ITGA2 gene and disease
Yuan HOU ; Yanyan LIANG ; Wanyu FENG ; Ruhan YI ; Hua ZHU
International Journal of Pediatrics 2025;52(5):334-337
The integrin alpha 2(ITGA2)gene locates on chromosome 5q11.2,encodes the α 2 subunit of the integrin family.The α 2 subunit is found on many cell surfaces.The α 2 subunit plays an important role in the regulation of platelet aggregation,cell migration,cell proliferation and angiogenesis.Through a wide range of studies conducted in recent years,researchers have discovered that this gene is linked to some diseases,such as rheumatoid arthritis,pediatric sickle cell disease,Kawasaki disease,malignant tumor and biliary atresia.These studies have contributed to the early identification of diseases associated with this gene and the exploration of diagnostic and therapeutic solutions for them.This article reviews the advancements in research concerning the association of ITGA2 gene with various diseases.
3.Advances in IP-10 and its genetic polymorphisms in relation to Kawasaki disease
Meng WANG ; Yanyan LIANG ; Wanyu FENG ; Xuewen SU ; Hua ZHU
International Journal of Pediatrics 2025;52(6):405-409
Kawasaki disease(KD)is an acute systemic vasculitis primarily affecting small- and medium-sized arteries in children,with widespread inflammation as the major pathological hallmark. A subset of patients with KD exhibit resistance to high-dose intravenous immunoglobulin(IVIG)therapy,which significantly increases the risk of developing severe cardiovascular complications,particularly coronary artery lesions(CAL). Interferon gamma-inducible protein 10(IP-10),a chemokine,exerts its biological functions by binding to its specific receptor,chemokine receptor 3(CXCR3). In the relevant research on KD,the association between IP-10 and IP-10 gene polymorphism with KD has garnered significant attention from both domestic and international researchers. This article reviews the recent research progress on the relationship between IP-10,its gene polymorphism and KD,with the aim of providing references for the pathogenesis,prevention,treatment and prognosis of KD.
4.Changing resistance profiles of Haemophilus influenzae and Moraxella catarrhalis isolates in hospitals across China:results from the CHINET Antimicrobial Resistance Surveillance Program,2015-2021
Hui FAN ; Chunhong SHAO ; Jia WANG ; Yang YANG ; Fupin HU ; Demei ZHU ; Yunsheng CHEN ; Qing MENG ; Hong ZHANG ; Chun WANG ; Fang DONG ; Wenqi SONG ; Kaizhen WEN ; Yirong ZHANG ; Chuanqing WANG ; Pan FU ; Chao ZHUO ; Danhong SU ; Jiangwei KE ; Shuping ZHOU ; Hua ZHANG ; Fangfang HU ; Mei KANG ; Chao HE ; Hua YU ; Xiangning HUANG ; Yingchun XU ; Xiaojiang ZHANG ; Wenen LIU ; Yanming LI ; Lei ZHU ; Jinhua MENG ; Shifu WANG ; Bin SHAN ; Yan DU ; Wei JIA ; Gang LI ; Jiao FENG ; Ping GONG ; Miao SONG ; Lianhua WEI ; Xin WANG ; Ruizhong WANG ; Hua FANG ; Sufang GUO ; Yanyan WANG ; Dawen GUO ; Jinying ZHAO ; Lixia ZHANG ; Juan MA ; Han SHEN ; Wanqing ZHOU ; Ruyi GUO ; Yan ZHU ; Jinsong WU ; Yuemei LU ; Yuxing NI ; Jingrong SUN ; Xiaobo MA ; Yanqing ZHENG ; Yunsong YU ; Jie LIN ; Ziyong SUN ; Zhongju CHEN ; Zhidong HU ; Jin LI ; Fengbo ZHANG ; Ping JI ; Yunjian HU ; Xiaoman AI ; Jinju DUAN ; Jianbang KANG ; Xuefei HU ; Xuesong XU ; Chao YAN ; Yi LI ; Shanmei WANG ; Hongqin GU ; Yuanhong XU ; Ying HUANG ; Yunzhuo CHU ; Sufei TIAN ; Jihong LI ; Bixia YU ; Cunshan KOU ; Jilu SHEN ; Wenhui HUANG ; Xiuli YANG ; Likang ZHU ; Lin JIANG ; Wen HE ; Chunlei YUE
Chinese Journal of Infection and Chemotherapy 2025;25(1):30-38
Objective To investigate the distribution and antimicrobial resistance profiles of clinically isolated Haemophilus influenzae and Moraxella catarrhalis in hospitals across China from 2015 to 2021,and provide evidence for rational use of antimicrobial agents.Methods Data of H.influenzae and M.catarrhalis strains isolated from 2015 to 2021 in CHINET program were collected for analysis,and antimicrobial susceptibility testing was performed by disc diffusion method or automated systems according to the uniform protocol of CHINET.The results were interpreted according to the CLSI breakpoints in 2022.Beta-lactamases was detected by using nitrocefin disk.Results From 2015 to 2021,a total of 43 642 strains of Haemophilus species were isolated,accounting for 2.91%of the total clinical isolates and 4.07%of Gram-negative bacteria in CHINET program.Among the 40 437 strains of H.influenzae,66.89%were isolated from children and 33.11%were isolated from adults.More than 90%of the H.influenzae strains were isolated from respiratory tract specimens.The prevalence of β-lactamase was 53.79%in H.influenzae strains.The H.influenzae strains isolated from children showed higher resistance rate than the strains isolated from adults.Overall,779 strains of H.influenzae did not produce β-lactamase but were resistant to ampicillin(BLNAR).Beta-lactamase-producing strains showed significantly higher resistance rates to these antimicrobial agents than the β-lactamase-nonproducing strains.Of the 16 191 M.catarrhalis strains,80.06%were isolated from children and 19.94%isolated from adults.M.catarrhalis strains were mostly susceptible to both amoxicillin-clavulanic acid and cefuroxime,evidenced by resistance rate lower than 2.0%.Conclusions The emergence of antibiotic-resistant H.influenzae due to β-lactamase production poses a challenge for clinical anti-infective treatment.Therefore,it is very important to implement antibiotic resistance surveillance for H.influenzae and guide rational antibiotic use.All local clinical microbiology laboratories should actively improve antibiotic susceptibility testing and strengthen antibiotic resistance surveillance for H.influenzae.
5.Analysis of clinical characteristics and etiologies of hospitalized patients with spike-and-wave activation in sleep
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Applied Clinical Pediatrics 2025;40(6):426-433
Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.
6.Predictive value of systemic immune inflammation index combined with stress response index for postoperative urinary tract infection in patients with complex kidney stones
Feng WEI ; Guangjun ZHOU ; Shuanghui LI ; Yanyan WANG ; Zhijie JI
Chinese Journal of Immunology 2025;41(10):2482-2487
Objective:To explore the predictive value of systemic immune inflammation index combined with stress response index for postoperative urinary tract infection in patients with complicated kidney stones.Methods:From June 2021 to June 2023,97 patients who underwent treatment for urinary tract infection after complex kidney stone operation in Cangzhou Hospital of Integrated Traditional and Western Medicine were selected as infected group,and 87 patients who did not develop urinary tract infection after complex kidney stone operation were selected as uninfected group.Systemic immunoinflammatory index(SII),neutrophils,lympho-cyte,platelet,malondialdehyde(MDA),superoxide dismutase(SOD),catalase(CAT)levels were detected.Multivariate Logistic regression analysis was performed to analyze risk factors of postoperative urinary tract infection,and ROC curve was drawn to analyze the predictive value of SII,MDA,SOD and CAT alone and combined detection for postoperative urinary tract infection in patients with complex kidney stones.Results:Compared with uninfected group,levels of SII,neutrophils and MDA were increased in infected group,while levels of SOD and CAT were decreased(P<0.05).Levels of lymphocytes and platelets were decreased,the difference was not statistically significant(P>0.05).Multivariate Logistic regression analysis showed that presence of urinary tract history,opera-tion time≥100 min,urinary catheter retention time≥7 d,presence of preoperative urinary tract infection,stone load≥1 000 mm2,combined renal dysfunction,and preoperative blood glucose≥6.15 mmol/L were main risk factors for postoperative urinary tract infection in patients with complex kidney stones.ROC curve showed that combined detection was significantly more effective than single detec-tion of SII,MDA,SOD and CAT in the diagnosis of postoperative urinary tract infection in patients with precomplex kidney stones.Conclusion:Patients with urinary tract infection after complicated kidney stones have increased SII and MDA,decreased SOD and CAT levels,and the abnormal increased or decreased expression level are the predictors of risk of urinary tract infection after compli-cated kidney stones,which may be related with the diagnosis,development and prognosis of the disease.
7.Clinical efficacy and safety of a domestic calcipotriol/betamethasone dipropionate ointment in the treatment of stable plaque psoriasis: a multicenter, randomized, double-blind, controlled study
Lixin XIA ; Guang XIANG ; Qingchun DIAO ; Kun HUANG ; Shoumin ZHANG ; Shanshan LI ; Yumei LI ; Zhiqiang SONG ; Qing SUN ; Xiumin YANG ; Meng PAN ; Yuling SHI ; Shuping GUO ; Huiping WANG ; Tiechi LEI ; Xiaoyong ZHOU ; Songmei GENG ; Suchun HOU ; Juan SU ; Yong CUI ; Rixin CHEN ; Yanyan FENG ; Hongxia FENG ; Rushan XIA ; Zudong MENG ; Fang YIN ; Jingjing WANG ; Xinghua GAO
Chinese Journal of Dermatology 2025;58(11):1020-1026
Objective:To evaluate the clinical equivalence between a domestic calcipotriol/betamethasone dipropionate ointment and the originator product in the treatment of stable plaque psoriasis.Methods:A multicenter, randomized, double-blind, three-arm, parallel-group, active- and placebo-controlled study was conducted, and 449 patients aged 18 - 65 years with stable plaque psoriasis were enrolled from 25 hospitals (such as the First Affiliated Hospital of China Medical University). Eligible patients had a baseline physician's global assessment (PGA) score of ≥ 3 points, baseline body surface area (BSA) involvement of 5% - 30%, and a target lesion psoriasis area and severity index (TL-PASI) for plaque elevation of ≥ 3 points. Participants were randomly assigned in a 2:2:1 ratio to the test group ( n = 179), reference group ( n = 180), and placebo group ( n = 90), and applied the domestic calcipotriol/betamethasone dipropionate ointment, originator product, and ointment base respectively, once daily in the evening for 4 weeks. Efficacy and safety were assessed at weeks 1, 2, and 4. The primary efficacy endpoints were the treatment success rates and clinical success rates in each group at week 4. The per-protocol set (PPS) was used for the primary efficacy analysis, and the intention-to-treat (ITT) set for supplementary efficacy analysis. Equivalence between the test and reference preparations was tested using the Cochran-Mantel-Haenszel method adjusted for randomization strata. Superiority of the test and reference preparations over the placebo was also tested. Measurement data were compared among the 3 groups using analysis of variance or non-parametric tests, while treatment success rates, clinical success rates, and incidence rates of adverse reactions were compared using the chi-square test. Results:The ITT, PPS, and safety sets included 447, 420, and 448 patients, respectively. In the ITT set, patients were aged 43.6 ± 12.8 years, including 320 (71.6%) males and 127 (28.4%) females, and the disease duration was 11.21 ± 9.05 years; 316 (70.7%) had a PGA score of 3 points and 131 (29.3%) had a PGA score of 4 - 5 points. No significant differences in the baseline characteristics (including age, sex, disease duration and disease severity) were observed among the 3 groups (all P > 0.05). Based on the PPS analysis, the treatment success rates were 57.9% (99/171) in the test group, 50.3% (86/171) in the reference group, and 7.7% (6/78) in the placebo group, and the clinical success rates were 57.9% (99/171), 50.3% (86/171), and 10.3% (8/78), respectively; both the test and reference groups were superior to the placebo group in both treatment and clinical success rates (all P < 0.001) ; the rate differences for treatment success (90% confidence interval [ CI]: -1.3% - 16.4%) and clinical success (90% CI: -1.3% - 16.3%) between the test and reference groups were entirely within the pre-defined equivalence margin (-20% - 20%). Subgroup analyses by baseline PGA scores: for patients with a baseline PGA score of 3 points, the treatment success rates in the test, reference, and placebo groups were 60.8% (73/120), 52.1% (62/119), and 11.1% (6/54), respectively, and the corresponding clinical success rates were 61.7% (74/120), 53.8% (64/119), and 13% (7/54), respectively; the test and reference groups did not differ significantly in treatment or clinical success rates (both P > 0.05), but both showed higher success rates than the placebo group (all P < 0.001) ; the results of statistical comparisons among the 3 groups in patients with a baseline PGA score of 4 - 5 points were consistent with those observed in patients with a baseline PGA score of 3 points. The percentage reductions in PGA and TL-PASI scores from baseline to weeks 1, 2, and 4 showed significant differences among the 3 groups, which were significantly higher in the test and reference groups than in the placebo group (all P < 0.001), but did not differ between the test and reference groups (all P > 0.05). The primary adverse reactions were local skin reactions, such as pruritus, pain, and erythema. The incidence rates of adverse reactions were 8.9% (16/179) in the test group, 7.3% (13/179) in the reference group, and 7.8% (7/90) in the placebo group, with no significant difference among the 3 groups ( P > 0.05) . Conclusions:The domestic calcipotriol/betamethasone dipropionate ointment demonstrated clinical equivalence to the originator product in the treatment of stable plaque psoriasis, and the two agents exhibited comparable efficacy for patients with varying degrees of disease severity, and were comparable in the speed and degree of clinical improvement, with similar favorable safety profiles.
8.Effect of esketamine on caspase-11-mediated non-canonical pathway pyroptosis in sepsis-induced acute lung injury in rats
Yunfei BAO ; Zhihao FENG ; Yanyan NIU ; Qing HU ; Haijie LIU ; Hongbo ZHANG ; Jianling LI
Chinese Journal of Anesthesiology 2025;45(3):364-368
Objective:To evaluate the effect of esketamine on caspase-11-mediated non-canonical pathway pyroptosis in sepsis-induced acute lung injury in rats.Methods:Eighteen SPF healthy Sprague-Dawley rats, aged 8-12 weeks, weighing 280-320 g, were divided into 3 groups ( n=6 each) using a random number table method: sham operation group (Sham group), cecal ligation and puncture (CLP) group and CLP+ esketamine group (CLP+ ES group). Sepsis was induced by CLP in anesthetized animals. Esketamine 10 mg/kg was injected via the tail vein immediately after development of the model, and the equal volume of normal saline was injected via the tail vein in the other two groups. At 24 h after development of the model, the rats were sacrificed under anesthesia, and the lung tissues and blood samples were taken. The wet to dry lung weight ratio (W/D ratio) was calculated, and the pathological changes were observed and the lung injury was scored. The expression of caspase-11, gasdermin D-N (GSDMD-N), phosphorylated phosphatidylinositol 3-kinase (p-PI3K) and phosphorylated protein kinase B (p-AKT) was detected by Western blot. The expression of caspase-11 and GSDMD-N mRNA was detected by quantitative real-time polymerase chain reaction. The serum concentration of interleukin-1β (IL-1β) was determined by enzyme-linked immunosorbent assay. Results:Compared with Sham group, the lung injury score and W/D ratio were significantly increased, the expression of caspase-11 and GSDMD-N protein and mRNA was up-regulated, the expression of p-PI3K and p-AKT was down-regulated, and the concentration of IL-1β was increased in CLP group ( P<0.05). Compared with CLP group, the lung injury score and W/D ratio were significantly decreased, the expression of caspase-11 and GSDMD-N protein and mRNA was down-regulated, the expression of p-PI3K and p-AKT was up-regulated, and the concentration of IL-1β was decreased in CLP+ ES group ( P<0.05). Conclusions:The mechanism by which esketamine alleviates sepsis-induced acute lung injury may be related to the inhibition of caspase-11-mediated non-canonical pathway pyroptosis in rats.
9.Exploring the Antidepressant Mechanisms of Citron and Bergamot Based on Network Pharmacology and BDNF/TrkB/CREB Signaling Pathways
Meiqing SONG ; Qian YANG ; Qiming ZHONG ; Yanyan NIU ; Liguo TONG ; Jianyue XING ; Mali FENG ; Lili JIA
World Science and Technology-Modernization of Traditional Chinese Medicine 2025;27(4):1136-1149
Objective Using network pharmacology research methods and animal pharmacology experiments,explore the mechanism of antidepressant effects of traditional Chinese medicine Citron and Bergamot.Methods Using the Traditional Chinese Medicine System Pharmacology Database and Analysis Platform(TCMSP),ETCM,Symmap,Swiss Target Prediction,and Uniprot data platforms,screen the active ingredients and corresponding gene targets of Citron and Bergamot.Obtain depression gene targets using OMIM,TTD,and Cenecards data platforms.Using Venny 2.1 online software,draw Venn diagrams of the intersection of active ingredients and gene targets.Draw network diagrams between drugs,active ingredients,targets,and diseases using Cytoscape 3.7.2 software.Construct a protein-protein interaction(PPI)network diagram using the STRING data platform for intersecting genes.Using the Metascape data platform,perform gene ontology(GO)function and Kyoto Encyclopedia of Genesand and Genomes(KEGG)pathway enrichment analysis.A rat depression model was established using chronic unpredictable mild stress(CUMS)combined with solitary care,and animal experiments were conducted to verify the BDNF/TrkB/CREB signaling pathway obtained from network pharmacology research.Results The research results of network pharmacology methods show that there are 57 antidepressant active ingredients in Citron,65 antidepressant active ingredients in Bergamot,and important active ingredients include Acetic acid,3,4,7-trimethoxycoumarin and Citric acid,etc.Through the data platform,2717 depression targets and 430 intersection targets were identified.Through PPI network analysis,key gene targets for antidepressant effects in Citron and Bergamot were identified,including TP53,Protein kinase B1,CREB-binding protein,Brain derived neurotrophic factor,etc.Through KEGG analysis,it was found that important signaling pathways include pathways in cancer,PI3K-Akt signaling pathway,Neurotrophin signaling pathway,etc.By observing the neurotrophic factor BDNF/TrkB/CREB signaling pathway in depressed rats,the results showed that the medium dose groups of Citron and Bergamot could significantly increase serum BDNF content(P<0.05),and each treatment group could improve the damage of hippocampal neurons in rats.The high and medium dose groups of Citron and Bergamot significantly increased the expression of BDNF protein in the hippocampal CA1 region(P<0.05,P<0.01).Except for the low-dose group,which showed no difference in TrkB mRNA gene expression,all other treatment groups significantly increased the mRNA gene expression levels of hippocampal BDNF,TrkB and CREB(P<0.01).The medium dose group of Citron and Bergamot increased the expression of BDNF protein in the hippocampus(P<0.01),while the medium and low dose groups significantly increased the relative expression of TrkB protein in the hippocampus(P<0.05).The medium dose group showed an increasing trend in the relative expression of CREB protein.Conclusion Traditional Chinese medicine Citron and Bergamot have therapeutic effects on depression models in rats,and the mechanism of action may be related to the BDNF/TrkB/CREB signaling pathway.
10.Cloning and expression of PPE65 encoded by the Mycobacterium tuberculosis Rv3621c gene in Escherichia coli,and its effects on proliferation and TGF-β expression of BEAS-2B cells
Juncheng HUANG ; Xinwen BO ; Jing LI ; Xuke CHEN ; Jiaxin ZHAO ; Yanyan ZHANG ; Xinwei FENG ; Yan SUN ; Zhengrong WANG ; Meng QI
Chinese Journal of Zoonoses 2025;41(10):1025-1033
This study was aimed at preliminarily investigating the molecular biological functions of the PPE65 protein from Myco-bacterium tuberculosis,and providing foundational data for tuberculosis prevention and control.The basic biological properties of the PPE65 gene-encoded protein were predicted with bioinformatics tools.Sequence information for the Mycobacterium tuberculosis Rv3621c gene and PPE65 protein was retrieved from the NCBI database.The Rv3621c gene was amplified through PCR with the H37Rv genome as a template,then cloned into the pET22b(+)expression vector.The recombinant pET22b(+)-PPE65 plasmid was transformed into Escherichia coli BL21(DE3)competent cells for IPTG-induced expression.Solubility analysis,purification,and identification of the recombinant PPE65 protein were performed.BEAS-2B cells were treated with various concentrations of PPE65 protein for 24 h,and cell proliferation was assessed with CCK-8 assays.PPE65 was found to be composed of 413 amino acids and to have a molecular formula of C????H????N???O???S??,a relative molecular mass of 40 679.88,a theoretical isoelectric point of 4.60,an ali-phatic index of 81.94,and an average hydrophilicity value of 0.319,thus indicating a stable hydrophobic protein lacking signal pep-tides or transmembrane domains.Secondary structure analysis revealed 53.03%α-helix(Hh),2.66%β-sheet(Ee),and 44.31%ran-dom coil(Cc).Bioinformatics predictions identified 38 B-cell epitopes and 22 CTL/Th-cell epitopes.The full-length PPE65 gene(1 308 bp)was confirmed through double restriction enzyme digestion and sequencing,thereby validating the correct construction of the pET22b(+)-PPE65 recombinant plasmid.SDS-PAGE analysis demonstrated that the recombinant protein was found in inclusion bodies,and a single band at 43.7 kDa was observed after purification.Western blotting revealed specific binding to mouse-derived His monoclonal antibodies,thereby confirming successful expression of the PPE65 protein.BEAS-2B cells treated with a PPE65 protein concentration gradient(2.5-20 μg/mL)exhibited a dose-dependent increase in cell number.Compared with those in the PBS control group,TGF-β relative expression levels were significantly higher in all treatment groups(t2.5=4.893,P<0.001,t5.0=4.640,P<0.05,t10=7.535,P<0.05,t20=16.44,P<0.000 1).This study elucidated the structural characteristics of the PPE65 protein,successfully obtained the recombinant protein through prokaryotic expression and purification,and demonstrated its ability to promote BEAS-2B cell proliferation.The underlying mechanism might involve suppression of TGF-β/S mad signaling pathway activation.These findings provide a theoretical basis for understanding the role and regulatory mechanisms of PPE65 during M.tuberculosis infection.


Result Analysis
Print
Save
E-mail