Objective To investigate the effects of peripheral blood neutrophil infiltration on the polarization regulation of cerebral resident microglia under a permanent ischemic stroke model.Methods Fifty-eight C57BL/6 mice were divided into two groups.One group was sham group,and the other group of mice was subjected to permanent middle cerebral artery occlusion surgery.Mice were euthanized 48 hours,7 days,14 days,and 30 days after surgery for tissue collection.Western blotting was used to detect expression levels of M1 microglia markers CD 16,M2 microglia marker arginase 1(Arg1),inflammatory cytokine interleukin-1 β(IL-1β),and neutrophil marker myeloperoxidase(MPO)in brain tissue.Immunofluorescence histochemical staining was used to assess neutrophil infiltration and M2 microglial distribution around the infarct area in brain sections.In vitro,purified neutrophils were co-cultured with BV2 microglial cells.After lipopolysaccharide stimulation,the phagocytosis of neutrophils by BV2 cells was observed,and the expression levels of CD16 and Arg1 proteins in BV2 cells were detected.Results Western blotting showed that the levels of CD16(P＜0.05),IL-1β(P＜0.001),and MPO(P＜0.05)in brain tissue increased significantly 48 hours and 7 days after surgery,then decreased,with MPO expression returning to normal levels 30 days after surgery.Immunofluorescence showed a significant increase of MPO-positive cells around the infarct area of the mouse cerebral cortex 48 hours after surgery(P＜0.001),followed by a decrease(P＜0.05).The number of ionized calcium binding adapter molecule 1(Iba1)and MPO double-positive cells gradually increased after surgery,and reached their peak at 14 days(P＜0.05).Iba1 and Arg1 double-positive cells also increased significantly 7 days(P＜0.05)and 14 days(P＜0.01)after surgery.In vitro,co-culture experiments showed that after BV2 phagocytosing neutrophils,CD 16(P＜0.05)significantly decreased and Arg1 significantly upregulated(P＜0.05).Conclusion In a permanent ischemic stroke model,microglia transition from M1 to M2 type after phagocytosing neutrophils,and the injured brain area changes from pro-inflammatory state to anti-inflammatory state.

Objective To develop the application technology of finger length ratios in the selection of Muay Thai athletes,and to provide practical guidance for improving the competitive level of Muay Thai.Methods By using the method of snowball sampling and simple random sampling,413 subjects were selected in Bangkok,Thailand,including 84 male Muay Thai professional players,62 female Muay Thai professional players,137 ordinary male college students and 130 female college students.The finger length of the subjects was measured and their finger length ratios was calculated.SPSS 20.0 statistical software was used for discriminant analysis.Results The 2D∶3D,2D∶4D,2D∶5D,3D∶4D and 3D∶5D of male Muay Thai professional players were significantly lower than that in the general male Thai population,and the 2D∶4D,3D∶4D and 3D∶5D of female Muay Thai players were significantly lower than that in the general female Thai population,and the above differences were statistically significant(P＜0.05).Discriminant functions developed using both the full model and stepwise method were statistically significant,demonstrating high accuracy and stability.The correct discrimination rates were higher in the male population than that in the female population.When distinguishing between Muay Thai professional fighters and the general Thai population,the optimal 2D∶4D threshold for males is 0.951,and for females,it was 0.960.Conclusion The discriminant model of Muay Thai professional players and ordinary people based on the ratios of finger length can provide important reference for the selection of Muay Thai athletes.

Objective To investigate the effects of laparoscopic sleeve gastrectomy(LSG)on the cardiac structure and function in obese patients with heart failure(HF)and compare the efficacy of LSG across obese patients with different HF types.Methods This study included 33 obese patients with HF who underwent LSG.The clinical indicators were compared between before operation and 12 months after operation.Repeated measures analysis of variance was employed to evaluate the changes in echocardiographic parameters before operation and 3,6,and 12 months after operation.Patients were allocated into a HF with preserved ejection fraction group(n=17),a HF with mildly reduced ejection fraction group(n=5)and a HF with reduced ejection fraction(HFrEF)group(n=11)based on left ventricular ejection fraction(LVEF)before operation for subgroup analyses of the effects of LSG on the cardiac structure and function of obese patients with HF.The paired samples t-test was conducted to assess the degree of cardiac structural and functional alterations after LSG.Results The 33 patients included 69.7% males,with an average age of(35.3±9.9)years,and a body mass index(BMI)of(51.2±9.8)kg/m².The median follow-up was 9.0(5.0,13.3)months.Compared with the preoperative values,the postoperative BMI(P=0.002),body surface area(BSA)(P=0.009),waist circumference(P=0.010),hip circumference(P=0.031),body fat content(P=0.007),and percentage of patients with cardiac function grades Ⅲ-IV(P<0.001)decreased.At the 12-month follow-up left atrial diameter(P=0.006),right atrial long-axis inner diameter(RAD1)(P<0.001),right atrial short-axis inner diameter(RAD2)(P<0.001),right ventricular inner diameter(P=0.002),interventricular septal thickness at end-diastolic(P=0.002),and left ventricular end-diastolic volumes(P=0.004)and left ventricular end-systolic volumes(P=0.003) all significantly reduced compared with preoperative values.Additionally,left ventricular fractional shortening and LVEF improved(both P<0.001).Subgroup analyses revealed that cardiac structural parameters significantly decreased in the HF with preserved ejection fraction,HF with mildly reduced ejection fraction,and HFrEF subgroups compared with preoperative values.Notably,the HFrEF group demonstrated the best performance in terms of left atrial diameter(P=0.003),left ventricular inner diameter at end-diastole(P=0.008),RAD1(P<0.001),RAD2(P=0.004),right ventricular inner diameter(P=0.019),left ventricular end-diastolic volume(P=0.004)and left ventricular end-systolic volume(P=0.001),cardiac output(P=0.006),tricuspid regurgitation velocity(P=0.002),and pulmonary artery systolic pressure(P=0.001) compared to preoperatively.Postoperative left ventricular fractional shortening(P<0.001,P=0.003,P<0.001)and LVEF(P<0.001,P=0.011,P=0.001)became higher in all the three subgroups than the preoperative values.Conclusions LSG decreased the body weight,BMI,and BSA,improved the cardiac function grade,reversed the enlargement of the left atrium and left ventricle,reduced the right atrium and right ventricle,and enhanced the left ventricular systolic function.It was effective across obese patients with different HF types.Particularly,LSG demonstrates the best performance in improving the structures of both atria and ventricles in obese patients with HFrEF.
Humans ; Male ; Female ; Gastrectomy/methods* ; Heart Failure/complications* ; Adult ; Obesity/physiopathology* ; Laparoscopy ; Middle Aged ; Heart/physiopathology* ; Stroke Volume

Objective To explore the feasibility and safety of ultrasound-guided percutaneous microwave ablation for unresectable pancreatic cancer.Methods Totally 84 patients who underwent ultrasound-guided percutaneous microwave ablation for unresectable pancreatic cancer were enrolled,and the technical success rate,complete ablation rate,complication rate,pain relief rate and survival time,etc.were observed.Results The median age of 84 cases was 61.5 years.Totally 86 tumors,including 44.19％(38/86)at the head/neck and 55.81％(48/86)at the body/tail of pancreas were detected,and a total of 85 ablation sessions were performed with the median ablation energy applied per tumor of 9.90(1.08,21.60)kJ and the complete ablation rate of 42.86％(36/84).The technical success rate was 100％(85/85).Thirty-nine complication events occurred in 25 cases,no ablation-related death.Among 34 patients underwent ablation mainly for pain symptoms,the pain score decreased from(6.22±1.12)points before treatment to(1.94±1.64)points after treatment(P＜0.001).During 6.8(3.3,12.9)months' follow-up,the mean survival time was(8.5±6.7)months,and all 47 patients died due to tumor progression.Conclusion Ultrasound-guided percutaneous microwave ablation was safe and feasible for unresectable pancreatic cancer.

Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.

Aim To investigate the role of FRMD4A in autophagy of placental trophoblast cells in preeclampsia(PE).Methods The placental tissues and clinical data of normal pregnancy and PE were obtained,and the histopathological changes were observed by HE staining.An in vitro model of hypoxia-induced HTR-8/SVneo trophoblast cells was established.The expres-sions of LC3B Ⅱ/Ⅰ and p62 in placental tissues and hypoxic cell models were analyzed by Western blot.The expression of FRMD4A was detected by qRT-PCR,Western blot and immunofluorescence,and the correlation between the expression level of FRMD4A and the clinical characteristics of the subjects was ana-lyzed by Pearson correlation analysis.Hypoxia induced trophoblast cells were transfected with si-FRMD4A,and the expression of LC3 B Ⅱ/Ⅰ and p62 was analyzed by Western blot.Results Compared with the normal group,the expression of LC3B Ⅱ/Ⅰ in PE placental tissues and hypoxia-induced trophoblast models was significantly upregulated,while the expression of p62 was significantly downregulated.Meanwhile,the ex-pression of FRMD4A increased significantly.Moreo-ver,its expression was positively correlated with the maternal systolic blood pressure,diastolic blood pres-sure,and platelet count,but negatively correlated with the neonatal weight(P＜0.01).In addition,hypoxia-induced trophoblast cells transfected with si-FRMD4A showed a significant decrease in LC3B Ⅱ/Ⅰ and an increase in p62 expression.Conclusions The expres-sion of FRMD4A is upregulated in PE placenta and hy-poxia-induced trophoblast cell model.Interfering with it can significantly hinder the autophagy process of trophoblast cells,suggesting that it may serve as a po-tential molecular target to participate in the pathologi-cal process of PE.

According to the World Health Organization (WHO) manual, sperm concentration should be measured using an improved Neubauer hemocytometer, while sperm motility should be measured by manual assessment. However, in China, thousands of laboratories do not use the improved Neubauer hemocytometer or method; instead, the Makler counting chamber is one of the most widely used chambers. To study sources of error that could impact the measurement of the apparent concentration and motility of sperm using the Makler counting chamber and to verify its accuracy for clinical application, 67 semen samples from patients attending the Department of Andrology, West China Second University Hospital, Sichuan University (Chengdu, China) between 13 September 2023 and 27 September 2023, were included. Compared with applying the cover glass immediately, delaying the application of the cover glass for 5 s, 10 s, and 30 s resulted in average increases in the sperm concentration of 30.3%, 74.1%, and 107.5%, respectively (all P < 0.0001) and in the progressive motility (PR) of 17.7%, 30.8%, and 39.6%, respectively (all P < 0.0001). However, when the semen specimens were fixed with formaldehyde, a delay in the application of the cover glass for 5 s, 10 s, and 30 s resulted in an average increase in the sperm concentration of 6.7%, 10.8%, and 14.6%, respectively, compared with immediate application of the cover glass. The accumulation of motile sperm due to delays in the application of the cover glass is a significant source of error with the Makler counting chamber and should be avoided.
Humans ; Male ; Sperm Motility/physiology* ; Sperm Count ; Semen Analysis/methods* ; Spermatozoa/physiology* ; Time Factors

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test