According to the World Health Organization (WHO) manual, sperm concentration should be measured using an improved Neubauer hemocytometer, while sperm motility should be measured by manual assessment. However, in China, thousands of laboratories do not use the improved Neubauer hemocytometer or method; instead, the Makler counting chamber is one of the most widely used chambers. To study sources of error that could impact the measurement of the apparent concentration and motility of sperm using the Makler counting chamber and to verify its accuracy for clinical application, 67 semen samples from patients attending the Department of Andrology, West China Second University Hospital, Sichuan University (Chengdu, China) between 13 September 2023 and 27 September 2023, were included. Compared with applying the cover glass immediately, delaying the application of the cover glass for 5 s, 10 s, and 30 s resulted in average increases in the sperm concentration of 30.3%, 74.1%, and 107.5%, respectively (all P < 0.0001) and in the progressive motility (PR) of 17.7%, 30.8%, and 39.6%, respectively (all P < 0.0001). However, when the semen specimens were fixed with formaldehyde, a delay in the application of the cover glass for 5 s, 10 s, and 30 s resulted in an average increase in the sperm concentration of 6.7%, 10.8%, and 14.6%, respectively, compared with immediate application of the cover glass. The accumulation of motile sperm due to delays in the application of the cover glass is a significant source of error with the Makler counting chamber and should be avoided.
Humans ; Male ; Sperm Motility/physiology* ; Sperm Count ; Semen Analysis/methods* ; Spermatozoa/physiology* ; Time Factors

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To construct a Z-score regression model for coronary artery diameter based on echocardiographic data from children in Sichuan Province and to establish a Z-score calculation formula. METHODS: A total of 744 healthy children who underwent physical examinations at Sichuan Provincial People's Hospital from January 2020 to December 2022 were selected as the modeling group, while 251 children diagnosed with Kawasaki disease at the same hospital from January 2018 to December 2022 were selected as the validation group. Pearson correlation analysis was conducted to analyze the relationships between coronary artery diameter values and age, height, weight, and body surface area. A regression model was constructed using function transformation to identify the optimal regression model and establish the Z-score calculation formula, which was then validated. RESULTS: The Pearson correlation analysis showed that the correlation coefficients for the diameters of the left main coronary artery, left anterior descending artery, left circumflex artery, and right coronary artery with body surface area were 0.815, 0.793, 0.704, and 0.802, respectively (P<0.05). Among the constructed regression models, the power function regression model demonstrated the best performance and was therefore chosen as the optimal model for establishing the Z-score calculation formula. Based on this Z-score calculation formula, the detection rate of coronary artery lesions was found to be 21.5% (54/251), which was higher than the detection rate based on absolute values of coronary artery diameter. Notably, in the left anterior descending and left circumflex arteries, the detection rate of coronary artery lesions using this Z-score calculation formula was higher than that of previous classic Z-score calculation formulas. CONCLUSIONS The Z-score calculation formula established based on the power function regression model has a higher detection rate for coronary artery lesions, providing a strong reference for clinicians, particularly in assessing coronary artery lesions in children with Kawasaki disease.
Humans ; Male ; Female ; Child, Preschool ; Child ; Coronary Artery Disease/diagnostic imaging* ; Infant ; Mucocutaneous Lymph Node Syndrome ; Regression Analysis ; Coronary Vessels/diagnostic imaging* ; Echocardiography ; Adolescent

Deactivation of the mitochondrial pyruvate dehydrogenase complex (PDC) is important for the metabolic switching of cancer cell from oxidative phosphorylation to aerobic glycolysis. Studies examining PDC activity regulation have mainly focused on the phosphorylation of pyruvate dehydrogenase (E1), leaving other post-translational modifications largely unexplored. Here, we demonstrate that the acetylation of Lys 488 of pyruvate dehydrogenase complex component X (PDHX) commonly occurs in hepatocellular carcinoma, disrupting PDC assembly and contributing to lactate-driven epigenetic control of gene expression. PDHX, an E3-binding protein in the PDC, is acetylated by the p300 at Lys 488, impeding the interaction between PDHX and dihydrolipoyl transacetylase (E2), thereby disrupting PDC assembly to inhibit its activation. PDC disruption results in the conversion of most glucose to lactate, contributing to the aerobic glycolysis and H3K56 lactylation-mediated gene expression, facilitating tumor progression. These findings highlight a previously unrecognized role of PDHX acetylation in regulating PDC assembly and activity, linking PDHX Lys 488 acetylation and histone lactylation during hepatocellular carcinoma progression and providing a potential biomarker and therapeutic target for further development.
Humans ; Acetylation ; Carcinoma, Hepatocellular/genetics* ; Liver Neoplasms/genetics* ; Pyruvate Dehydrogenase Complex/genetics* ; Gene Expression Regulation, Neoplastic ; Animals ; Mice ; Cell Line, Tumor ; Protein Processing, Post-Translational ; Histones/metabolism* ; Disease Progression

Objective To investigate the effects of laparoscopic sleeve gastrectomy(LSG)on the cardiac structure and function in obese patients with heart failure(HF)and compare the efficacy of LSG across obese patients with different HF types.Methods This study included 33 obese patients with HF who underwent LSG.The clinical indicators were compared between before operation and 12 months after operation.Repeated measures analysis of variance was employed to evaluate the changes in echocardiographic parameters before operation and 3,6,and 12 months after operation.Patients were allocated into a HF with preserved ejection fraction group(n=17),a HF with mildly reduced ejection fraction group(n=5)and a HF with reduced ejection fraction(HFrEF)group(n=11)based on left ventricular ejection fraction(LVEF)before operation for subgroup analyses of the effects of LSG on the cardiac structure and function of obese patients with HF.The paired samples t-test was conducted to assess the degree of cardiac structural and functional alterations after LSG.Results The 33 patients included 69.7% males,with an average age of(35.3±9.9)years,and a body mass index(BMI)of(51.2±9.8)kg/m².The median follow-up was 9.0(5.0,13.3)months.Compared with the preoperative values,the postoperative BMI(P=0.002),body surface area(BSA)(P=0.009),waist circumference(P=0.010),hip circumference(P=0.031),body fat content(P=0.007),and percentage of patients with cardiac function grades Ⅲ-IV(P<0.001)decreased.At the 12-month follow-up left atrial diameter(P=0.006),right atrial long-axis inner diameter(RAD1)(P<0.001),right atrial short-axis inner diameter(RAD2)(P<0.001),right ventricular inner diameter(P=0.002),interventricular septal thickness at end-diastolic(P=0.002),and left ventricular end-diastolic volumes(P=0.004)and left ventricular end-systolic volumes(P=0.003) all significantly reduced compared with preoperative values.Additionally,left ventricular fractional shortening and LVEF improved(both P<0.001).Subgroup analyses revealed that cardiac structural parameters significantly decreased in the HF with preserved ejection fraction,HF with mildly reduced ejection fraction,and HFrEF subgroups compared with preoperative values.Notably,the HFrEF group demonstrated the best performance in terms of left atrial diameter(P=0.003),left ventricular inner diameter at end-diastole(P=0.008),RAD1(P<0.001),RAD2(P=0.004),right ventricular inner diameter(P=0.019),left ventricular end-diastolic volume(P=0.004)and left ventricular end-systolic volume(P=0.001),cardiac output(P=0.006),tricuspid regurgitation velocity(P=0.002),and pulmonary artery systolic pressure(P=0.001) compared to preoperatively.Postoperative left ventricular fractional shortening(P<0.001,P=0.003,P<0.001)and LVEF(P<0.001,P=0.011,P=0.001)became higher in all the three subgroups than the preoperative values.Conclusions LSG decreased the body weight,BMI,and BSA,improved the cardiac function grade,reversed the enlargement of the left atrium and left ventricle,reduced the right atrium and right ventricle,and enhanced the left ventricular systolic function.It was effective across obese patients with different HF types.Particularly,LSG demonstrates the best performance in improving the structures of both atria and ventricles in obese patients with HFrEF.
Humans ; Male ; Female ; Gastrectomy/methods* ; Heart Failure/complications* ; Adult ; Obesity/physiopathology* ; Laparoscopy ; Middle Aged ; Heart/physiopathology* ; Stroke Volume

Objective To investigate the effects of peripheral blood neutrophil infiltration on the polarization regulation of cerebral resident microglia under a permanent ischemic stroke model.Methods Fifty-eight C57BL/6 mice were divided into two groups.One group was sham group,and the other group of mice was subjected to permanent middle cerebral artery occlusion surgery.Mice were euthanized 48 hours,7 days,14 days,and 30 days after surgery for tissue collection.Western blotting was used to detect expression levels of M1 microglia markers CD 16,M2 microglia marker arginase 1(Arg1),inflammatory cytokine interleukin-1 β(IL-1β),and neutrophil marker myeloperoxidase(MPO)in brain tissue.Immunofluorescence histochemical staining was used to assess neutrophil infiltration and M2 microglial distribution around the infarct area in brain sections.In vitro,purified neutrophils were co-cultured with BV2 microglial cells.After lipopolysaccharide stimulation,the phagocytosis of neutrophils by BV2 cells was observed,and the expression levels of CD16 and Arg1 proteins in BV2 cells were detected.Results Western blotting showed that the levels of CD16(P＜0.05),IL-1β(P＜0.001),and MPO(P＜0.05)in brain tissue increased significantly 48 hours and 7 days after surgery,then decreased,with MPO expression returning to normal levels 30 days after surgery.Immunofluorescence showed a significant increase of MPO-positive cells around the infarct area of the mouse cerebral cortex 48 hours after surgery(P＜0.001),followed by a decrease(P＜0.05).The number of ionized calcium binding adapter molecule 1(Iba1)and MPO double-positive cells gradually increased after surgery,and reached their peak at 14 days(P＜0.05).Iba1 and Arg1 double-positive cells also increased significantly 7 days(P＜0.05)and 14 days(P＜0.01)after surgery.In vitro,co-culture experiments showed that after BV2 phagocytosing neutrophils,CD 16(P＜0.05)significantly decreased and Arg1 significantly upregulated(P＜0.05).Conclusion In a permanent ischemic stroke model,microglia transition from M1 to M2 type after phagocytosing neutrophils,and the injured brain area changes from pro-inflammatory state to anti-inflammatory state.

Objective To develop the application technology of finger length ratios in the selection of Muay Thai athletes,and to provide practical guidance for improving the competitive level of Muay Thai.Methods By using the method of snowball sampling and simple random sampling,413 subjects were selected in Bangkok,Thailand,including 84 male Muay Thai professional players,62 female Muay Thai professional players,137 ordinary male college students and 130 female college students.The finger length of the subjects was measured and their finger length ratios was calculated.SPSS 20.0 statistical software was used for discriminant analysis.Results The 2D∶3D,2D∶4D,2D∶5D,3D∶4D and 3D∶5D of male Muay Thai professional players were significantly lower than that in the general male Thai population,and the 2D∶4D,3D∶4D and 3D∶5D of female Muay Thai players were significantly lower than that in the general female Thai population,and the above differences were statistically significant(P＜0.05).Discriminant functions developed using both the full model and stepwise method were statistically significant,demonstrating high accuracy and stability.The correct discrimination rates were higher in the male population than that in the female population.When distinguishing between Muay Thai professional fighters and the general Thai population,the optimal 2D∶4D threshold for males is 0.951,and for females,it was 0.960.Conclusion The discriminant model of Muay Thai professional players and ordinary people based on the ratios of finger length can provide important reference for the selection of Muay Thai athletes.

Aim To investigate the targeting mechanism of miR-23b on PINKl/Parkin pathway in transdifferentiation of NRK-52E cellsinduced by TGF-β1, and to elucidate the intervention mechanism of Qingshen granules drug-containing serum on NRK-52E cell transdifferentiation. Methods Ultra-high performance liquid chromatography ( UPLC ) fingerprinting method was used to analyze Qingshen granules. The NRK-52E transdifferentiation model induced by TGF-β1 was constructed. The NRK-52E cells were divided into simulated no-load control group, miR-23b-5p simulated group, inhibitor no-load control group, and miR-23b-5p inhibitor group, after transfection with siRNA, and the effect of miR-23b-5p on PINK1 expression was ob-served. The NRK-52E cells were then divided into normal group, TGF-(31 group, Qingshen granule group, miR-23 b-mimic group, miR-23 b-mimic group, and miR-23b-mimic + Qingshen granule group. Western blot was used to detect the expression of Pinkl, Parkin, LC3 n, Beclin-1, P62 and a-SMA proteins, and RT- PCR was used to detect the expression of miR-23 b-5p, Pinkl, Parkin, Beclin-1 and a-SMA mRNA in NRK- 52E cells. Dual-Luciferase Reporter gene experiment was used to detect the targeting relationship between miR-23b-5p and PINKL Results UPLC fingerprinting method found 11 active components in Qingshen granules. After overexpression of miR-23b-5p, the expression of PINkl mRNA significantly increased (P < 0. 05). And after silencing of miR-23 b-5 p expression, the expression of PINkl mRNA also significantly decreased (P < 0. 05 ). Dual-Luciferase Reporter Assay showed that Rno-miR-23b-5p could significantly down- regulate the luciferase activity of Rno-PINKl-WT (P < 0. 05 ), but could not down-regulate the luciferase activity of mutant Rno-PINKl -mut ( P > 0. 05 ). The experimental results showed that the expressions of miR- 23b-5p, Pinkl, Parkin, Beclin-1, LC3 II and LC3 II/ I ratio in TGF-β1 group were significantly lower than those in normal group, but the expressions of P62 and a-SMA were significantly higher than those in normal group ( P <0.05). The expressions of miR-23 b-5 p, Pinkl, Parkin, Beclin-1, LC3 II and LC3 11/ I ratio in Qingshen granule group and miR-23 b-mimic group were significantly higher than those in TGF-β1 group, and the expressions of P62 and a-SMA were significantly lower than those in TGF-β1 group (P < 0. 05 ). The performance of miR-23 b-mimic + Qingshen granule group was better than that of miR-23 b-mimic group (P < 0. 05 ). Conclusions Qingshen granules can up- regulate the expression of miR-23b-5p in NRK-52E cellsand inhibit the transdifferentiation process of NRK- 52E cells by enhancing the mitochondrial autophagy activity mediated by PINKl/Parkin pathway.