Deactivation of the mitochondrial pyruvate dehydrogenase complex (PDC) is important for the metabolic switching of cancer cell from oxidative phosphorylation to aerobic glycolysis. Studies examining PDC activity regulation have mainly focused on the phosphorylation of pyruvate dehydrogenase (E1), leaving other post-translational modifications largely unexplored. Here, we demonstrate that the acetylation of Lys 488 of pyruvate dehydrogenase complex component X (PDHX) commonly occurs in hepatocellular carcinoma, disrupting PDC assembly and contributing to lactate-driven epigenetic control of gene expression. PDHX, an E3-binding protein in the PDC, is acetylated by the p300 at Lys 488, impeding the interaction between PDHX and dihydrolipoyl transacetylase (E2), thereby disrupting PDC assembly to inhibit its activation. PDC disruption results in the conversion of most glucose to lactate, contributing to the aerobic glycolysis and H3K56 lactylation-mediated gene expression, facilitating tumor progression. These findings highlight a previously unrecognized role of PDHX acetylation in regulating PDC assembly and activity, linking PDHX Lys 488 acetylation and histone lactylation during hepatocellular carcinoma progression and providing a potential biomarker and therapeutic target for further development.
Humans ; Acetylation ; Carcinoma, Hepatocellular/genetics* ; Liver Neoplasms/genetics* ; Pyruvate Dehydrogenase Complex/genetics* ; Gene Expression Regulation, Neoplastic ; Animals ; Mice ; Cell Line, Tumor ; Protein Processing, Post-Translational ; Histones/metabolism* ; Disease Progression

According to the World Health Organization (WHO) manual, sperm concentration should be measured using an improved Neubauer hemocytometer, while sperm motility should be measured by manual assessment. However, in China, thousands of laboratories do not use the improved Neubauer hemocytometer or method; instead, the Makler counting chamber is one of the most widely used chambers. To study sources of error that could impact the measurement of the apparent concentration and motility of sperm using the Makler counting chamber and to verify its accuracy for clinical application, 67 semen samples from patients attending the Department of Andrology, West China Second University Hospital, Sichuan University (Chengdu, China) between 13 September 2023 and 27 September 2023, were included. Compared with applying the cover glass immediately, delaying the application of the cover glass for 5 s, 10 s, and 30 s resulted in average increases in the sperm concentration of 30.3%, 74.1%, and 107.5%, respectively (all P < 0.0001) and in the progressive motility (PR) of 17.7%, 30.8%, and 39.6%, respectively (all P < 0.0001). However, when the semen specimens were fixed with formaldehyde, a delay in the application of the cover glass for 5 s, 10 s, and 30 s resulted in an average increase in the sperm concentration of 6.7%, 10.8%, and 14.6%, respectively, compared with immediate application of the cover glass. The accumulation of motile sperm due to delays in the application of the cover glass is a significant source of error with the Makler counting chamber and should be avoided.
Humans ; Male ; Sperm Motility/physiology* ; Sperm Count ; Semen Analysis/methods* ; Spermatozoa/physiology* ; Time Factors

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To construct a Z-score regression model for coronary artery diameter based on echocardiographic data from children in Sichuan Province and to establish a Z-score calculation formula. METHODS: A total of 744 healthy children who underwent physical examinations at Sichuan Provincial People's Hospital from January 2020 to December 2022 were selected as the modeling group, while 251 children diagnosed with Kawasaki disease at the same hospital from January 2018 to December 2022 were selected as the validation group. Pearson correlation analysis was conducted to analyze the relationships between coronary artery diameter values and age, height, weight, and body surface area. A regression model was constructed using function transformation to identify the optimal regression model and establish the Z-score calculation formula, which was then validated. RESULTS: The Pearson correlation analysis showed that the correlation coefficients for the diameters of the left main coronary artery, left anterior descending artery, left circumflex artery, and right coronary artery with body surface area were 0.815, 0.793, 0.704, and 0.802, respectively (P<0.05). Among the constructed regression models, the power function regression model demonstrated the best performance and was therefore chosen as the optimal model for establishing the Z-score calculation formula. Based on this Z-score calculation formula, the detection rate of coronary artery lesions was found to be 21.5% (54/251), which was higher than the detection rate based on absolute values of coronary artery diameter. Notably, in the left anterior descending and left circumflex arteries, the detection rate of coronary artery lesions using this Z-score calculation formula was higher than that of previous classic Z-score calculation formulas. CONCLUSIONS The Z-score calculation formula established based on the power function regression model has a higher detection rate for coronary artery lesions, providing a strong reference for clinicians, particularly in assessing coronary artery lesions in children with Kawasaki disease.
Humans ; Male ; Female ; Child, Preschool ; Child ; Coronary Artery Disease/diagnostic imaging* ; Infant ; Mucocutaneous Lymph Node Syndrome ; Regression Analysis ; Coronary Vessels/diagnostic imaging* ; Echocardiography ; Adolescent

Objective To investigate the effects of laparoscopic sleeve gastrectomy(LSG)on the cardiac structure and function in obese patients with heart failure(HF)and compare the efficacy of LSG across obese patients with different HF types.Methods This study included 33 obese patients with HF who underwent LSG.The clinical indicators were compared between before operation and 12 months after operation.Repeated measures analysis of variance was employed to evaluate the changes in echocardiographic parameters before operation and 3,6,and 12 months after operation.Patients were allocated into a HF with preserved ejection fraction group(n=17),a HF with mildly reduced ejection fraction group(n=5)and a HF with reduced ejection fraction(HFrEF)group(n=11)based on left ventricular ejection fraction(LVEF)before operation for subgroup analyses of the effects of LSG on the cardiac structure and function of obese patients with HF.The paired samples t-test was conducted to assess the degree of cardiac structural and functional alterations after LSG.Results The 33 patients included 69.7% males,with an average age of(35.3±9.9)years,and a body mass index(BMI)of(51.2±9.8)kg/m².The median follow-up was 9.0(5.0,13.3)months.Compared with the preoperative values,the postoperative BMI(P=0.002),body surface area(BSA)(P=0.009),waist circumference(P=0.010),hip circumference(P=0.031),body fat content(P=0.007),and percentage of patients with cardiac function grades Ⅲ-IV(P<0.001)decreased.At the 12-month follow-up left atrial diameter(P=0.006),right atrial long-axis inner diameter(RAD1)(P<0.001),right atrial short-axis inner diameter(RAD2)(P<0.001),right ventricular inner diameter(P=0.002),interventricular septal thickness at end-diastolic(P=0.002),and left ventricular end-diastolic volumes(P=0.004)and left ventricular end-systolic volumes(P=0.003) all significantly reduced compared with preoperative values.Additionally,left ventricular fractional shortening and LVEF improved(both P<0.001).Subgroup analyses revealed that cardiac structural parameters significantly decreased in the HF with preserved ejection fraction,HF with mildly reduced ejection fraction,and HFrEF subgroups compared with preoperative values.Notably,the HFrEF group demonstrated the best performance in terms of left atrial diameter(P=0.003),left ventricular inner diameter at end-diastole(P=0.008),RAD1(P<0.001),RAD2(P=0.004),right ventricular inner diameter(P=0.019),left ventricular end-diastolic volume(P=0.004)and left ventricular end-systolic volume(P=0.001),cardiac output(P=0.006),tricuspid regurgitation velocity(P=0.002),and pulmonary artery systolic pressure(P=0.001) compared to preoperatively.Postoperative left ventricular fractional shortening(P<0.001,P=0.003,P<0.001)and LVEF(P<0.001,P=0.011,P=0.001)became higher in all the three subgroups than the preoperative values.Conclusions LSG decreased the body weight,BMI,and BSA,improved the cardiac function grade,reversed the enlargement of the left atrium and left ventricle,reduced the right atrium and right ventricle,and enhanced the left ventricular systolic function.It was effective across obese patients with different HF types.Particularly,LSG demonstrates the best performance in improving the structures of both atria and ventricles in obese patients with HFrEF.
Humans ; Male ; Female ; Gastrectomy/methods* ; Heart Failure/complications* ; Adult ; Obesity/physiopathology* ; Laparoscopy ; Middle Aged ; Heart/physiopathology* ; Stroke Volume

Objective To explore the feasibility and safety of ultrasound-guided percutaneous microwave ablation for unresectable pancreatic cancer.Methods Totally 84 patients who underwent ultrasound-guided percutaneous microwave ablation for unresectable pancreatic cancer were enrolled,and the technical success rate,complete ablation rate,complication rate,pain relief rate and survival time,etc.were observed.Results The median age of 84 cases was 61.5 years.Totally 86 tumors,including 44.19％(38/86)at the head/neck and 55.81％(48/86)at the body/tail of pancreas were detected,and a total of 85 ablation sessions were performed with the median ablation energy applied per tumor of 9.90(1.08,21.60)kJ and the complete ablation rate of 42.86％(36/84).The technical success rate was 100％(85/85).Thirty-nine complication events occurred in 25 cases,no ablation-related death.Among 34 patients underwent ablation mainly for pain symptoms,the pain score decreased from(6.22±1.12)points before treatment to(1.94±1.64)points after treatment(P＜0.001).During 6.8(3.3,12.9)months' follow-up,the mean survival time was(8.5±6.7)months,and all 47 patients died due to tumor progression.Conclusion Ultrasound-guided percutaneous microwave ablation was safe and feasible for unresectable pancreatic cancer.

Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.

Objective:To compare the effects of propofol and dexmedetomidine for sedation on the outcome in mechanically ventilated patients with severe pulmonary infection.Methods:Patients with severe pulmonary infection (Clinical Pulmonary Infection Score >7) requiring mechanical ventilation from the Medical Information Mart for Intensive Care Ⅳ database between 2008 and 2020 were selected and divided into propofol group and dexmedetomidine group based on the sedative agent used. The primary outcome was all-cause in-hospital mortality, and secondary outcomes included 90-day all-cause mortality and duration of mechanical ventilation. Inverse probability of treatment weighting (IPTW) was used to adjust for baseline confounders, and logistic regression and linear regression were applied to analyze the effects of the two sedative drugs on the outcomes of mechanically ventilated patients with pulmonary infection. Kaplan-Meier survival curves were used to analyze survival outcomes.Results:A total of 6 204 critically ill patients with pulmonary infection requiring mechanical ventilation were included, with 3 439 cases in propofol group and 2 765 cases in dexmedetomidine group. The baseline characteristics between the two groups were well balanced (standardized mean difference < 0.1) after IPTW adjustment. In the IPTW-adjusted cohort, the in-hospital all-cause mortality and 90-day all-cause mortality were significantly lower in dexmedetomidine group than in propofol group (439.2[18.7%] vs 563.6[24.1%], 618.0[26.3%] vs 733.6[31.3%], P<0.001), the results of Further Kaplan-Meier survival curve analysis showed that the 90-day all-cause mortality was significantly lower in dexmedetomidine group than in propofol group ( P<0.01). Conclusions:Compared with propofol, dexmedetomidine can decrease the mortality rate and improve the prognosis in mechanically ventilated patients with severe pulmonary infection when used for sedation.