According to the World Health Organization (WHO) manual, sperm concentration should be measured using an improved Neubauer hemocytometer, while sperm motility should be measured by manual assessment. However, in China, thousands of laboratories do not use the improved Neubauer hemocytometer or method; instead, the Makler counting chamber is one of the most widely used chambers. To study sources of error that could impact the measurement of the apparent concentration and motility of sperm using the Makler counting chamber and to verify its accuracy for clinical application, 67 semen samples from patients attending the Department of Andrology, West China Second University Hospital, Sichuan University (Chengdu, China) between 13 September 2023 and 27 September 2023, were included. Compared with applying the cover glass immediately, delaying the application of the cover glass for 5 s, 10 s, and 30 s resulted in average increases in the sperm concentration of 30.3%, 74.1%, and 107.5%, respectively (all P < 0.0001) and in the progressive motility (PR) of 17.7%, 30.8%, and 39.6%, respectively (all P < 0.0001). However, when the semen specimens were fixed with formaldehyde, a delay in the application of the cover glass for 5 s, 10 s, and 30 s resulted in an average increase in the sperm concentration of 6.7%, 10.8%, and 14.6%, respectively, compared with immediate application of the cover glass. The accumulation of motile sperm due to delays in the application of the cover glass is a significant source of error with the Makler counting chamber and should be avoided.
Humans ; Male ; Sperm Motility/physiology* ; Sperm Count ; Semen Analysis/methods* ; Spermatozoa/physiology* ; Time Factors

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To construct a Z-score regression model for coronary artery diameter based on echocardiographic data from children in Sichuan Province and to establish a Z-score calculation formula. METHODS: A total of 744 healthy children who underwent physical examinations at Sichuan Provincial People's Hospital from January 2020 to December 2022 were selected as the modeling group, while 251 children diagnosed with Kawasaki disease at the same hospital from January 2018 to December 2022 were selected as the validation group. Pearson correlation analysis was conducted to analyze the relationships between coronary artery diameter values and age, height, weight, and body surface area. A regression model was constructed using function transformation to identify the optimal regression model and establish the Z-score calculation formula, which was then validated. RESULTS: The Pearson correlation analysis showed that the correlation coefficients for the diameters of the left main coronary artery, left anterior descending artery, left circumflex artery, and right coronary artery with body surface area were 0.815, 0.793, 0.704, and 0.802, respectively (P<0.05). Among the constructed regression models, the power function regression model demonstrated the best performance and was therefore chosen as the optimal model for establishing the Z-score calculation formula. Based on this Z-score calculation formula, the detection rate of coronary artery lesions was found to be 21.5% (54/251), which was higher than the detection rate based on absolute values of coronary artery diameter. Notably, in the left anterior descending and left circumflex arteries, the detection rate of coronary artery lesions using this Z-score calculation formula was higher than that of previous classic Z-score calculation formulas. CONCLUSIONS The Z-score calculation formula established based on the power function regression model has a higher detection rate for coronary artery lesions, providing a strong reference for clinicians, particularly in assessing coronary artery lesions in children with Kawasaki disease.
Humans ; Male ; Female ; Child, Preschool ; Child ; Coronary Artery Disease/diagnostic imaging* ; Infant ; Mucocutaneous Lymph Node Syndrome ; Regression Analysis ; Coronary Vessels/diagnostic imaging* ; Echocardiography ; Adolescent

Deactivation of the mitochondrial pyruvate dehydrogenase complex (PDC) is important for the metabolic switching of cancer cell from oxidative phosphorylation to aerobic glycolysis. Studies examining PDC activity regulation have mainly focused on the phosphorylation of pyruvate dehydrogenase (E1), leaving other post-translational modifications largely unexplored. Here, we demonstrate that the acetylation of Lys 488 of pyruvate dehydrogenase complex component X (PDHX) commonly occurs in hepatocellular carcinoma, disrupting PDC assembly and contributing to lactate-driven epigenetic control of gene expression. PDHX, an E3-binding protein in the PDC, is acetylated by the p300 at Lys 488, impeding the interaction between PDHX and dihydrolipoyl transacetylase (E2), thereby disrupting PDC assembly to inhibit its activation. PDC disruption results in the conversion of most glucose to lactate, contributing to the aerobic glycolysis and H3K56 lactylation-mediated gene expression, facilitating tumor progression. These findings highlight a previously unrecognized role of PDHX acetylation in regulating PDC assembly and activity, linking PDHX Lys 488 acetylation and histone lactylation during hepatocellular carcinoma progression and providing a potential biomarker and therapeutic target for further development.
Humans ; Acetylation ; Carcinoma, Hepatocellular/genetics* ; Liver Neoplasms/genetics* ; Pyruvate Dehydrogenase Complex/genetics* ; Gene Expression Regulation, Neoplastic ; Animals ; Mice ; Cell Line, Tumor ; Protein Processing, Post-Translational ; Histones/metabolism* ; Disease Progression

Objective To investigate the effects of laparoscopic sleeve gastrectomy(LSG)on the cardiac structure and function in obese patients with heart failure(HF)and compare the efficacy of LSG across obese patients with different HF types.Methods This study included 33 obese patients with HF who underwent LSG.The clinical indicators were compared between before operation and 12 months after operation.Repeated measures analysis of variance was employed to evaluate the changes in echocardiographic parameters before operation and 3,6,and 12 months after operation.Patients were allocated into a HF with preserved ejection fraction group(n=17),a HF with mildly reduced ejection fraction group(n=5)and a HF with reduced ejection fraction(HFrEF)group(n=11)based on left ventricular ejection fraction(LVEF)before operation for subgroup analyses of the effects of LSG on the cardiac structure and function of obese patients with HF.The paired samples t-test was conducted to assess the degree of cardiac structural and functional alterations after LSG.Results The 33 patients included 69.7% males,with an average age of(35.3±9.9)years,and a body mass index(BMI)of(51.2±9.8)kg/m².The median follow-up was 9.0(5.0,13.3)months.Compared with the preoperative values,the postoperative BMI(P=0.002),body surface area(BSA)(P=0.009),waist circumference(P=0.010),hip circumference(P=0.031),body fat content(P=0.007),and percentage of patients with cardiac function grades Ⅲ-IV(P<0.001)decreased.At the 12-month follow-up left atrial diameter(P=0.006),right atrial long-axis inner diameter(RAD1)(P<0.001),right atrial short-axis inner diameter(RAD2)(P<0.001),right ventricular inner diameter(P=0.002),interventricular septal thickness at end-diastolic(P=0.002),and left ventricular end-diastolic volumes(P=0.004)and left ventricular end-systolic volumes(P=0.003) all significantly reduced compared with preoperative values.Additionally,left ventricular fractional shortening and LVEF improved(both P<0.001).Subgroup analyses revealed that cardiac structural parameters significantly decreased in the HF with preserved ejection fraction,HF with mildly reduced ejection fraction,and HFrEF subgroups compared with preoperative values.Notably,the HFrEF group demonstrated the best performance in terms of left atrial diameter(P=0.003),left ventricular inner diameter at end-diastole(P=0.008),RAD1(P<0.001),RAD2(P=0.004),right ventricular inner diameter(P=0.019),left ventricular end-diastolic volume(P=0.004)and left ventricular end-systolic volume(P=0.001),cardiac output(P=0.006),tricuspid regurgitation velocity(P=0.002),and pulmonary artery systolic pressure(P=0.001) compared to preoperatively.Postoperative left ventricular fractional shortening(P<0.001,P=0.003,P<0.001)and LVEF(P<0.001,P=0.011,P=0.001)became higher in all the three subgroups than the preoperative values.Conclusions LSG decreased the body weight,BMI,and BSA,improved the cardiac function grade,reversed the enlargement of the left atrium and left ventricle,reduced the right atrium and right ventricle,and enhanced the left ventricular systolic function.It was effective across obese patients with different HF types.Particularly,LSG demonstrates the best performance in improving the structures of both atria and ventricles in obese patients with HFrEF.
Humans ; Male ; Female ; Gastrectomy/methods* ; Heart Failure/complications* ; Adult ; Obesity/physiopathology* ; Laparoscopy ; Middle Aged ; Heart/physiopathology* ; Stroke Volume

Objective·To analyze the epidemiological characteristics of risk factors for cardiovascular diseases and malignant tumors based on the Shanghai community elderly cohort.Methods·The study subjects were selected from the Shanghai community elderly cohort established from February to August 2019,with a total of 17 948 people.The study subjects were divided into 4 groups according to self-reported presence or absence of tumors and/or cardiovascular diseases during the baseline survey:tumor-free and non-cardiovascular disease group,single cardiovascular disease group,single tumor group and tumor cardiovascular disease co-occurrence group.The differences among the four groups of subjects were collected and compared in terms of demographic characteristics and physiological indicators,daily living habits(smoking,drinking tea,drinking coffee,drinking carbonated drink,drinking alcohol,sedentary time,physical activity level and sleep quality),past medical history,psychological status(depression and anxiety)and dietary compliance.Results·Among the study subjects,60.1%of tumor patients were complicated with cardiovascular diseases.The differences among the four groups of subjects in age,gender,educational level,pre-retirement occupation,waist circumference,hip circumference and body mass index were statistically significant(all P<0.05).Compared with the tumor-free and non-cardiovascular disease group,the single cardiovascular disease group,single tumor group and tumor cardiovascular disease co-occurrence group all exhibited lower proportions of smoking and high physical activity levels(all P<0.05),and higher proportion of sedentary time exceeding 4 h/d and poor sleep quality(all P<0.05);the proportion of subjects with past medical histories including hyperlipidemia,peripheral vascular disease,endocrine system disease,respiratory system disease,urinary system disease and digestive system disease of the single cardiovascular disease group and the tumor cardiovascular disease co-occurrence group was higher(all P<0.05),and the proportion of subjects with depression and anxiety was also higher(all P<0.05).Furthermore,compared with the tumor-free and non-cardiovascular disease group,the single cardiovascular disease group had lower compliance rates of poultry,fish,fruit and liquid milk(all P<0.05).Among the four groups,only the compliance rate of vegetable intake exceeded 50%,while the compliance rates of poultry,fish,fruit,liquid milk and tubers were all below 20%.Conclusion·In the elderly population of Shanghai communities,over half of malignant tumor patients are concomitant with cardiovascular diseases.Unhealthy daily habits are prevalent among those with cardiovascular diseases,tumors and tumor-cardiovascular disease co-occurrence.The intake of many foods in the elderly of the community do not reach the levels recommended by Chinese Dietary Guidelines.

Objective To investigate disease characteristics and hospitalization costs of children with Mycoplasma Pneumoniae pneumonia(MPP)admitted to Shanghai municipal medical hospitals from 2019 to 2023.Methods Depending on the Shanghai Municipal Hospital Pediatric Alliance,we retrospectively investigated community acquired MPP pediatric patients hospitalized in 22 municipal hospitals with pediatric qualifications(including 4 children's hospitals)in Shanghai from Jan 2019 to Dec 2023.We collected the patients'diagnosis codes,gender,age,length of hospital stay,hospitalization costs,and whether they progressed to severe Mycoplasma pneumoniae pneumonia(SMPP).Results From 2019 to 2023,a total of 29 045 hospitalized children with MPP were treated,with 6 035 cases(20.8%)identified as SMPP in the 22 hospitals.Trend analysis revealed a rising trend with years in the proportion of SMPP patients(χ2trend=365.498,P<0.001).Among the 4 children's hospitals,there were 18 710 cases with MPP,including 4 078 cases(21.8%)of SMPP.The proportion of SMPP patients also showed an increasing trend with years(χ2trend=14.548,P<0.001),and the proportion in 2023(23.0%)was higher than that in previous years with statistical significance.There were statistical differences in the seasonal distribution of MPP cases between different years,with higher proportions in summer and autumn overall.The age distribution of hospitalized MPP children varied among different years,with school-age children accounting for the majority(56.8%)in 2023.There was no difference in the distribution of severe cases between different genders,but there were differences in the proportion of severe cases among different age groups in different years,with a gradual increase in severe cases among children aged 1 to 3 years(χ2trend=191.567,P<0.001).The average length of hospital stay for MPP during the epidemic was higher than that during non-epidemic periods,and there were statistically significant differences in the average length of hospital stay between different years(P<0.001).The individual hospitalization costs during the epidemic were higher than in other years,and there were statistically significant differences in individual hospitalization costs between different years(P<0.001).The total hospitalization costs were still higher in 2019 and 2023.The individual hospitalization costs for SMPP were higher than for non-SMPP cases.Conclusion MPP outbreaks occurred in Shanghai in 2019 and 2023,with the higher proportions in summer and autumn overall.Compared to previous years,the number of hospitalized MPP children in Shanghai was higher in 2023,with a higher proportion of SMPP cases,especially among children under 3 years old.The individual per capita hospitalization expenses for SMPP cases were higher than for non-SMPP cases.

Objective:To explore the effects of type D personality on mild cognitive dysfunction (MCI) in patients with coronary heart disease and the multiple mediating roles of dietary inflammation index (DII) and systemic immune inflammation index (SII) between type D personality and MCI.Methods:A cross-sectional study was used. A total of 321 patients diagnosed with coronary heart disease by coronary angiography in the Second Affiliated Hospital of Harbin Medical University from May 2022 to March 2023 were selected as the study objects by convenient sampling method. General Information Questionnaire, Type-D Personality Scale-14, Montreal Cognitive Assessment, and Semi-Quantitative Food Frequency Questionnaire were employed for data collection. DII and SII were used to evaluate dietary inflammatory potential and systemic inflammatory status, respectively. Structural equation modeling was utilized to analyze the mediating effectsamong type D personality, DII, SII and MCI.Results:A total of 306 valid questionnaires were collected. Among the 306 patients, there were 215 males (70.3%) and 91 females (29.7%), aged 27-70 (59.24 ± 9.16) years old. The structural equation model showed that type D personality could directly influence MCI (effect size = - 1.098, 95% CI - 1.869 - - 0.327), and could also mediate the occurrence of MCI in coronary heart disease patients through the single mediation of DII (effect size = - 0.374, 95% CI - 0.644 - - 0.128) and SII (effect size = - 0.450, 95% CI - 0.806 - - 0.132), as well as the chain mediation of DII and SII (effect size = - 0.146, 95% CI - 0.293 - - 0.027). Conclusions:Type D personality, DII and SII can affect the occurrence of MCI in CHD patients, and DII and SII play multiple mediating roles between type D personality and MCI in patients with coronary heart disease. Clinical and community nurses can improve the unhealthy dietary behavior, reduce the level of inflammation and delay the occurrence and development of MCI by early screening of type D personality in patients with coronary heart disease.