Objective: To analyze the epidemiological characteristics and influencing factors of severe fever with thrombocytopenia syndrome (SFTS) in Zhejiang Province from 2019 to 2023, so as to provide the reference for strengthening SFTS prevention and control. Methods: Data on laboratory-confirmed SFTS cases in Zhejiang Province from 2019 to 2023 were collected through the Infectious Disease Reporting Information System of Chinese Disease Prevention and Control Information System. Meteorological data, geographic environment and socioeconomic factors during the same period were collected from the fifth-generation European Centre for Medium-Range Weather Forecasts, Geospatial Data Cloud, and Zhejiang Statistical Yearbook, respectively. Descriptive epidemiological methods were used to analyze the epidemiological characteristics of SFTS from 2019 to 2023, and a Bayesian spatio-temporal model was constructed to analyze the influencing factors of SFTS incidence. Results: A total of 578 SFTS cases were reported in Zhejiang Province from 2019 to 2023, with an annual average incidence of 0.23/105. The peak period was from May to July, accounting for 52.60%. There were 309 males and 269 females, with a male-to-female ratio of 1.15∶1. The cases were mainly aged 50-<80 years, farmers, and in rural areas, accounting for 82.53%, 77.34%, and 75.43%, respectively. Taizhou City and Shaoxing City reported more SFTS cases, while Shaoxing City and Zhoushan City had higher annual average incidences of SFTS. The Bayesian spatio-temporal interaction model showed good goodness of fit. The results showed that mean temperature (RR=1.626, 95%CI: 1.111-2.378) and mean wind speed (RR=1.814, 95%CI: 1.321-2.492) were positively correlated with SFTS risk, while altitude (RR=0.432, 95%CI: 0.230-0.829) and population density (RR=0.443, 95%CI: 0.207-0.964) were negatively correlated with SFTS risk. Conclusions SFTS in Zhejiang Province peaks from May to July. Middle-aged and elderly people and farmers are high-risk populations. Taizhou City, Shaoxing City, and Zhoushan City are high-incidence areas. Mean temperature, mean wind speed, altitude, and population density can all affect the risk of SFTS incidence.

Over the past two decades, genome-wide association study(GWAS) has identified numerous genetic variants and loci associated with heritable diseases. With the gradual maturation and saturation of GWAS methodologies, transcriptome-wide association study(TWAS) offers a novel perspective by linkinggenetic phenotypes to gene expression levels. By integrating TWAS with other multi-omics analyses, researchers can gain a deeper understanding of heritable diseases. This article provides an overview of recent groundbreaking and representative TWAS methods and tools, analyzes their strengths and limitations, and discusses future trends in TWAS development.

ObjectiveTo investigate the gene expression sequence and molecular mechanisms in the local microenvironment during the subacute to chronic phases (1-28 days) in mouse models of spinal cord compression injury and hemisection spinal cord injury, thereby revealing the molecular characteristics of spinal cord repair and providing a theoretical basis for selecting therapeutic targets for spinal cord injury. MethodsThirty-six 8-9-week-old SPF-grade ICR mice were randomly divided into three groups (n=12 per group): sham-operated control (CTR) group, hemisection spinal cord injury (HSCI) group, and spinal cord compression injury (SCC) group. Mice in the CTR group underwent the same surgical preparation and anesthesia, followed by a dorsal midline incision at the T₉-T₁₀ segment. After layer-by-layer dissection and removal of the corresponding lamina, the spinal cord dura mater was fully exposed and kept intact. The cord was exposed to air for 10 minutes (matching the duration of the compression injury group), during which any instrument contact with the cord was avoided. The incision was then irrigated and sutured. The HSCI group underwent a 70% transection of the T₉ spinal cord segment using micro-instruments to establish a hemisection spinal cord injury model. The SCC group underwent sustained compression of the T₁₀ spinal cord segment for 10 minutes using a self-made compressor (a 30 g solid small iron bar) to establish a spinal cord compression injury model. Motor function recovery was assessed using the modified Basso-Beattie-Bresnahan (BBB) score on postoperative days 1, 3, 7, 14, 21, and 28. On days 7 and 14 post-operation, mice were anesthetized, and the injured spinal cord segments were harvested. The evolution of specific molecular networks in the spinal cord injury mouse models was analyzed via RNA sequencing (RNA-Seq) and enrichment analysis, and the expression of key genes was verified using real time fluorogenic quantitative PCR. ResultsBBB scores indicated that motor function recovery in the SCC group was significantly better than that in the HSCI group, with BBB scores showing a continuously increasing trend and remaining higher than those in the HSCI group over the 4-week period (P <0.001). Gene ontology （GO)and Kyoto Encyclopedia of Genes and Genomes （KEGG） enrichment analyses based on RNA-Seq differentially expressed genes revealed that, compared to the CTR group, genes related to the extracellular matrix were significantly up-regulated (P<0.05), while genes related to axon guidance were significantly down-regulated (P <0.05) in the SCC group on day 7 post-operation. On day 21, genes involved in immune regulation and the retinol signaling pathway were significantly activated in the SCC group (P<0.05). In contrast, in the HSCI group, genes associated with inflammation and immune response were significantly up-regulated (P<0.001), while genes related to neuronal differentiation and synapse formation were significantly down-regulated (P <0.001) on day 7. On day 21, genes related to cell-matrix junctions and N-methyl-D-aspartate receptors were significantly up-regulated (P<0.001) in the HSCI group. Furthermore, compared to the SCC group, the HSCI group exhibited different pathway enrichment characteristics in GO and KEGG analyses on days 7 and 21 post-injury. On day 7, genes involved in the NOD-like receptor signaling pathway and the complement and coagulation cascades were significantly up-regulated in the HSCI group (P<0.001). On day 21, genes related to the extracellular matrix-receptor interaction and the neuroactive ligand-receptor interaction pathways were significantly activated (P<0.001). Finally, real time fluorogenic quantitative PCR validation results were highly consistent with the RNA-Seq results, further confirming the differential expression trends of key genes between the SCC and HSCI groups. ConclusionThe SCC and HSCI injury models may drive distinct repair pathways: the preservation of some axons in the SCC model predisposes it toward tissue repair, whereas the HSCI model requires the coordination of more complex molecular networks to achieve a new equilibrium. This finding further deepens the understanding of the heterogeneous regulatory mechanisms underlying spinal cord injury.

ObjectiveTaking Aurantii Fructus Immaturus juice（AFI）-processed Atractylodis Macrocephalae Rhizoma（AMR） as an example， this study aims to systematically compare the volatile and non-volatile components of AMR and its processed products， investigate the key differential components， evaluate their anti-inflammatory activities， and elucidate the synergistic mechanism of processing. MethodsThe chemical compositions of volatile and non-volatile components in AMR and AFI-processed AMR were systematically characterized using gas chromatography-mass spectrometry（GC-MS） and ultra-performance liquid chromatography-quadrupole-time-of-flight mass spectrometry（UPLC-Q-TOF-MS）， with relative mass fractions and response values determined separately. Volatile components were identified through searches in the National Institute of Standards and Technology（NIST）17 database， comparison with retention index（RI） and fragmentation pattern matching. Non-volatile components were identified by searching Waters Traditional Chinese Medicine （TCM） spectral library， in conjunction with PubChem and MassBank， characteristic fragmentation patterns and response values were also used to support identification. Differential components were screened using principal component analysis（PCA）， orthogonal partial least squares-discriminant analysis（OPLS-DA）， with variable importance in the projection（VIP） value >1. Components with high log₂fold change（FC） among major differential groups were selected as those exhibiting significant changes before and after processing. The anti-inflammatory activity of the differential compounds was evaluated by assessing their effects on nitric oxide（NO） production in a lipopolysaccharide（LPS）-induced RAW264.7 macrophage model. Enzyme-linked immunosorbent assay（ELISA） was used to detect the effects of the differential components on tumor necrosis factor（TNF）-α， interleukin（IL）-1β， IL-6， and monocyte chemotactic protein（MCP）-1 levels， and immunofluorescence（IF） was employed to assess their effects on nuclear transcription factor（NF）-κB p65 translocation， thereby elucidating the underlying molecular mechanisms. ResultsA total of 36 compounds were identified in the volatile components of AMR and AFI-processed AMR， among which， sesquiterpenes and monoterpenes were significantly increased after processing. In the non-volatile components， 36 compounds were identified， and the main differential components were flavonoids， sesquiterpenoids， and triterpenoids. Flavonoids were the primary differential components distinguishing AMR from its processed products， representing compounds directly introduced during processing. Five compounds， including atractylenolide Ⅲ， tangeritin， nobiletin， hesperidin and narirutin， were selected as representatives of three classes based on their most prominent differential expression among different compound types for subsequent anti-inflammatory activity studies. The results showed that 100 μmol·L^-1 tangerine and narirutin could significantly inhibit LPS-induced NO production（P<0.01） in a concentration-dependent manner. Tangeritin was able to significantly inhibit the levels of TNF-α and MCP-1 secreted by RAW264.7（P<0.05）， while narirutin significantly inhibited the levels of TNF-α， IL-1β， MCP-1 and IL-6（P<0.01）. IF revealed that both tangeritin and narirutin significantly blocked the translocation of NF-κB p65 from the cytoplasm to the nucleus. ConclusionAFI-processed AMR significantly alters the chemical composition profile of AMR， and the newly introduced flavonoid components during processing may be key to its enhanced anti-inflammatory effects.

Molar-incisor hypomineralization (MIH) is a developmental defect of enamel that is characterized primarily by abnormal enamel mineralization affecting the first permanent molars and permanent incisors. Due to insufficient mineralization, teeth affected by MIH are prone to post-eruptive breakdown and caries, potentially leading to sequelae such as tooth sensitivity and occlusal problems. The diagnosis of MIH is primarily based on relevant perinatal and infantile medical history, the characteristic distribution of affected teeth, and the morphological features of the enamel defects. Based on the extent and severity of the enamel defect, MIH is classified as mild or severe. Diagnosis and treatment strategies emphasize early screening, diagnosis, and intervention, prioritizing prevention, providing symptomatic care, and implementing regular recall assessments. Mild MIH predominantly manifests as demineralized enamel opacities or discoloration, typically without significant enamel breakdown. Treatment focuses on caries prevention and aesthetic restoration, employing techniques such as remineralization, micro-abrasion, resin infiltration, bleaching, fluoride application, and fissure sealants. Severe MIH typically presents with extensive enamel opacities accompanied by substantial enamel breakdown and may be complicated by caries and tooth sensitivity. Management primarily involves restoring the structural defects or, for teeth that cannot be preserved, extraction followed by orthodontic treatment. Comprehensive management often requires a multimodal approach integrating various therapeutic modalities to restore both the function and aesthetics of the affected teeth and overall dentition. This article provides a review of advancements in diagnosis and the treatment strategies for MIH, offering a reference for clinical practice.

From June 2002 to December 2023, there were 5 patients with criss-cross hearts admitted to the General Hospital of Northern Theater Command, including 3 males and 2 females, aged 1.5 to 25 years, and weighing 13-49 kg. There were 5 patients of atrioventricular position, 3 patients of right ventricular loop, 2 patients of left ventricular loop, 3 patients of normal atrioventricular connection, and 2 patients of inconsistent connection. Combined intracardiac malformations: 1 patient of simple ventricular septal defect combined with pulmonary hypertension, 1 patient of corrected transposition of the great arteries combined with ventricular septal defect, atrial septal defect, and pulmonary artery stenosis, 1 patient of corrected transposition of the great arteries combined with ventricular septal defect, atrial septal defect, and left atrioventricular valve insufficiency, and 2 patients of right ventricular double outlet combined with ventricular septal defect and pulmonary artery stenosis. The surgical methods included 2 patients of intracardiac anatomical correction, 1 patient of bidirectional vena cava pulmonary artery anastomosis, and 2 patients of total extracardiac ductal cava pulmonary artery anastomosis. All 5 patients were discharged smoothly.

AIM: To explore the risk factors of macular edema in patients with diabetes cataract after surgery, and provide reference for postoperative prevention and treatment.METHODS: A total of 55 diabetes cataract patients(55 eyes)with macular edema after phacoemulsification surgery at the ophthalmology department of Jiaozhou Central Hospital of Qingdao from January 2022 to January 2024 were selected as edema group. In addition, 59 patients(59 eyes)with diabetes cataract who received the same surgical treatment but did not develop macular edema were treated as control group, and the relationship between interferon-induced protein-10(IP-10), macrophage chemotactic protein-1(MCP-1), vascular endothelial growth factor(VEGF)and postoperative macular edema was analyzed.RESULTS:Age, diabetes course, best corrected visual acuity(BCVA), glycated hemoglobin(HbA1c), creatinine, levels of IP-10, MCP-1 and VEGF in aqueous humor in the edema group were higher than those in the control group(all P<0.05). The risk factors for postoperative macular edema in patients with diabetes cataract were prolonged duration of diabetes, BCVA, increased HbA1c, increased creatinine and IP-10 in aqueous fluid, increased MCP-1 and increased VEGF(all P<0.05).CONCLUSION:Macular edema after surgical treatment in diabetes cataract patients is associated with prolonged duration of diabetes, BCVA, HbA1c, creatinine, IP-10, MCP-1, and VEGF, and clinical interventions should be given in advance.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

Objective: To explore the iodine nutrition status of children in Wuhan from 2019 to 2023, and to evaluate the effect of iodine deficiency disorders control in focus groups in Wuhan, so as to provide a basis for consolidating elimination of iodine deficiency disorders. Methods: A total of 13 000 non boarding primary school students aged 8-10 were selected from 13 districts of Wuhan by stratified random sampling method.Household salt samples were collected to measure salt iodine content, random urine samples were analyzed for urinary iodine concentration. And B ultrasound was used to measure thyroid volume in students. The median of salt iodine, coverage rate of iodized salt, consumption rate of qualified iodized salt, median of urinary iodine, and the goiter rate were calculated. And Mann-Whitney U- test, Kruskal-Wallis H- test and Chi-square test were applied to compare between groups. Chi-square trend test was used to analyze the changing trends of coverage rate of iodized salt, consumption rate of qualified iodized salt and goiter rate among children in Wuhan. Results: The median of iodine content of children s household salt was 23.8 (21.7, 26.1) mg/kg, and the coverage rate of iodized salt was 98.7%, and the consumption rate of qualified iodized salt was 94.5 %. The consumption rates of qualified iodized salt showed an overall upward trend from 2019 to 2023 ( χ 2 trend =5.57， P <0.05). The median of urinary iodine of children was 220.1 (136.7, 326.0) μg/L,and boys had higher median of urinary iodine than girls [228.3(143.2, 336.0),210.2(129.1, 315.7) μg/L] ( Z =6.60, P <0.01). The median of urinary iodine of children in suburbs was higher than those in urban areas [236.3 (150.7, 342.2) , 207.1 (124.5, 309.8) μg/L]( Z =11.00, P <0.01). A total of 4 600 children were examined for thyroid volume, and the range of goiter rates were 1.1% to 3.4%, with an average goiter rate of 2.5%, which showed an overall downward trend from 2019 to 2023 ( χ 2 trend =5.11, P <0.05). Conclusions The iodine nutrition is sufficient and iodine nutrition status is good among children in Wuhan. It should continue to carry out monitoring and evaluation of children s iodine nutrition, guide the public to supplement iodine scientifically,so as to maintain the appropriate level of iodine for children.

Callicarpa is an important medicinal plant in China, which has hemostatic, antibacterial, and antioxidant pharmacological effects, and the efficacy of astringing and arresting bleeding, clearing heat and detoxification, activating blood, and resolving stasis is outstanding. At the same time, Callicarpa can be used as an ornamental plant because of its gorgeous flowers and fruits. Callicarpa has good market development prospects, but the long seed reproduction cycle directly limits the large demand for seedlings in its industrial development. Asexual reproduction technology is the basis for the industrialization development of Callicarpa, which is helpful in producing high-quality seedlings and medicinal materials. Although Chinese and foreign scholars have achieved remarkable results in the study of asexual reproduction of Callicarpa, there is no report on the large-scale production of seedlings of Callicarpa. Integrating and improving its asexual reproduction technology can promote the development and utilization of Callicarpa, improve its medicinal value, and create significant economic benefits. Therefore, the authors reviewed the effects of cutting, season, plant growth regulators, substrates, environment, and management measures on the cutting of Callicarpa and the research progress of tissue culture propagation affected by explants, basic media, exogenous additives, subculture cycles, culture conditions, and transplanting substrates. The mechanism of adventitious root formation was reviewed at the cellular, physiological, and biochemical levels, so as to put forward the problems and corresponding solutions in the study of asexual propagation technology and regulatory mechanism of Callicarpa and point out the future research directions. The study aims to provide a reference for in-depth research on the asexual propagation technology of Callicarpa and the commercial production of its high-quality seedlings.
Reproduction, Asexual ; Plants, Medicinal/physiology* ; Seedlings/growth & development* ; Tissue Culture Techniques