1.Effect of needle-knife release on the median nerve and transverse carpal ligament in rabbits with carpal tunnel syndrome.
Yunnan LI ; Qiaoyin ZHOU ; Shen LUO ; Weilin LIN ; Xinyao HUANG ; Ying CAO
Journal of Southern Medical University 2025;45(11):2358-2364
OBJECTIVES:
To investigate the effect of needle knife release on median nerve (MN) and transverse carpal ligament (TCL) morphology and function and expression levels of inflammatory factors in rabbit models of carpal tunnel syndrome (CTS). Methods Thirty adult New Zealand rabbits were randomized equally into control group, CTS model group, ultrasound-guided needle knife release group, needle knife release group without ultrasound guidance, and sham treatment groups. In all but the control group, the rabbits were subjected to CTS modeling by 10% glucose solution injection into the carpal tunnel once a week for 4 consecutive weeks, followed by interventions with a single treatment session. At 3 days and 30 days after the interventions, 3 rabbits from each group were selected for ultrasound measurement of TCL and MN thickness, electrophysiological testing, ultrasound elastography, and inflammatory cytokine level assessment.
RESULTS:
In the rabbit models of CTS, ultrasound-guided needle knife release significantly reduced the thickness of TCL and MN and improved sensory nerve conduction velocity at both 3 and 30 days after the intervention. Elastography of the TCL showed markedly softened intra-carpal tissues after ultrasound-guided needle knife release and achieved superior outcomes over those in the other groups. The treatment also significantly reduced IL-17 levels and lowered IL-6 and PGE2 expression at 30 days after the intervention.
CONCLUSIONS
Needle knife release of the TCL reduces thickness of the MN and TCL, enhances median nerve function, alleviates intrascatic tissue stiffness, and downregulates inflammatory factors in the carpal tunnel in rabbit models of CTS, and ultrasound guidance further enhances its therapeutic efficacy.
Animals
;
Rabbits
;
Carpal Tunnel Syndrome/surgery*
;
Median Nerve/physiopathology*
;
Disease Models, Animal
2.Fluid shear promotes apoptosis of glomerular endothelial cells by activation of Piezo 1
Menglin LUO ; Feng ZHENG ; Xinyao JI ; Caihong QI ; Yuheng XIAO ; Changchun NIU
Basic & Clinical Medicine 2024;44(9):1236-1242
Objective To investigate the effect of fluid shear(FS)on apoptosis of glomerular epithelial cells(GECs)and the role of Piezo 1 protein in it.Methods GECs(glomerular epithelial cells)of SD rat were cul-tured.Fluid shear stimulation was simulated by a Flexcell-T5000 tensiometer.Apoptosis level was detected by flow cytometry.The expression of Piezo 1 proteins in GECs was detected by immunofluorescence staining.The activating of Piezo 1 channels by fluid shear was observed using Ca2+indicator(Cal-590 AM).The effect of Piezo 1 on apop-tosis in GECs was analyzed after modulating the function or expression of Piezo 1 protein using the chemical activa-tor Yoda1,the inhibitor GsMtx 4 was regulated by lentivirus Lv-shPiezo 1.Results Compared with the blank controlgroup,apoptosis increased in the fluid shear group(P<0.05).The rate of apoptosis increased with the enhancing of fluid shear strength;Piezo 1 was commonly expressed in GECs.Fluid shear activated Piezo 1 chan-nel and enhanced expression of Piezo 1.The agonist Yoda1 promoted the apoptosis of GECs GsMtx 4 inhibited the apoptosis induced by fluid shear.Lv-shPiezo 1 knocked down the expression of Piezo 1 in GECs and the apoptosis rate of GECs in the knockdown group was reduced as compared to that in the control group and Lv-Ctrl group(P<0.05).Conclusions Fluid shear may promote apoptosis of GECs by activation of Piezo 1 and by enhancing expression of Piezo 1.
3.Comparison of the Quality of Sheep Bile from Different Regions Based on UHPLC-ELSD Fingerprint and Multi-component Content Determination Combined with Antioxidant Activity
Xuxiang ZHOU ; Qianqian ZHU ; Dandan ZHANG ; Xinyao LUO ; Dan LIU ; Min ZHANG ; Xiaochuan YE
Chinese Journal of Modern Applied Pharmacy 2024;41(8):1066-1074
OBJECTIVE
To establish UHPLC-ELSD fingerprint and multi-component content determination methods, compare the differences in sheep bile from different regions, and conduct antioxidant activity research to provide a basis for the in-depth development and utilization of sheep bile.
METHODS
Used UHPLC-ELSD method to establish 21 batches of bile fingerprints of sheep from different origins and conduct similarity analysis. Measured the content of 6 components, DPPH and ABTS free radical scavenging ability, iron ion reduction ability, and conducted entropy weighted TOPSIS and grey correlation analysis.
RESULTS
A total of 11 common peaks were identified in the fingerprint spectra of 21 batches of sheep bile. Through comparison with the control sample, 6 components were identified, including taurocholic acid(TCA), glycocholic acid(GCA), taurochenodeoxycholic acid(TCDCA), tauroursodeoxycholic acid(TDCA), glycodeoxycholic acid(GDCA), and cholic acid(CA). Except for 4 batches of samples, the similarity of the fingerprint spectra was greater than 0.90. The total content range of 6 components in the freeze-dried powder of 21 batches of sheep bile was 55.34% to 86.08%. The highest content of taurocholic acid ranged from 34.74% to 60.86%, indicating significant differences in the content of the six components in samples from different regions. Sheep bile from different regions had antioxidant activity, and there were also certain differences. The results of entropy weighted TOPSIS analysis using six component contents as variables showed that the top ten scoring groups were S2, S18, S16, S9, S8, S21, S1, S10, S20, and S15, indicating good quality and slightly better bile quality from sheep in the northern region. The grey correlation analysis results between the content of 6 components and 3 antioxidant indicators showed that all 6 components were correlated with each antioxidant indicator, and TCA, TDCA, and TCDCA had the highest correlation, which might be important components for sheep bile to exert antioxidant effects.
CONCLUSION
The use of entropy weighted TOPSIS and grey correlation analysis methods can effectively analyze the quality differences and antioxidant active components of sheep bile from different regions, providing scientific basis for its quality evaluation.
4.Screening the effective components in treating dampness stagnancy due to spleen deficiency syndrome and elucidating the potential mechanism of Poria water extract.
Huijun LI ; Dandan ZHANG ; Tianhe WANG ; Xinyao LUO ; Heyuan XIA ; Xiang PAN ; Sijie HAN ; Pengtao YOU ; Qiong WEI ; Dan LIU ; Zhongmei ZOU ; Xiaochuan YE
Chinese Journal of Natural Medicines (English Ed.) 2023;21(2):83-98
Poria is an important medicine for inducing diuresis to drain dampness from the middle energizer. However, the specific effective components and the potential mechanism of Poria remain largely unknown. To identify the effective components and the mechanism of Poria water extract (PWE) to treat dampness stagnancy due to spleen deficiency syndrome (DSSD), a rat model of DSSD was established through weight-loaded forced swimming, intragastric ice-water stimulation, humid living environment, and alternate-day fasting for 21 days. After 14 days of treatment with PWE, the results indicated that PWE increased fecal moisture percentage, urine output, D-xylose level and weight; amylase, albumin, and total protein levels; and the swimming time of rats with DSSD to different extents. Eleven highly related components were screened out using the spectrum-effect relationship and LC-MS. Mechanistic studies revealed that PWE significantly increased the expression of serum motilin (MTL), gastrin (GAS), ADCY5/6, p-PKAα/β/γ cat, and phosphorylated cAMP-response element binding protein in the stomach, and AQP3 expression in the colon. Moreover, it decreased the levels of serum ADH, the expression of AQP3 and AQP4 in the stomach, AQP1 and AQP3 in the duodenum, and AQP4 in the colon. PWE induced diuresis to drain dampness in rats with DSSD. Eleven main effective components were identified in PWE. They exerted therapeutic effect by regulating the AC-cAMP-AQP signaling pathway in the stomach, MTL and GAS levels in the serum, AQP1 and AQP3 expression in the duodenum, and AQP3 and AQP4 expression in the colon.
Animals
;
Rats
;
Poria
;
Spleen
;
Albumins
;
Chromatography, Liquid
;
Cyclic AMP Response Element-Binding Protein
5.Expert Consensus on Clinical Diseases Responding Specifically to Traditional Chinese Medicine: Sjögren's Syndrome
Jing LUO ; Yuan XU ; Xinyao ZHOU ; Mengtao LI ; Xiujuan HOU ; Hailong WANG ; Hua CHEN ; Qin ZHANG ; Yan GENG ; Jinxia ZHAO ; Yi ZHAO ; Miansong ZHAO ; Jiabo WANG ; Yong WANG ; Xiaoxiao ZHANG ; Qingwen TAO
Chinese Journal of Experimental Traditional Medical Formulae 2023;29(8):73-79
Sjögren's syndrome (SS), a disorder of immune system, is one of the dominant diseases treated by traditional Chinese medicine (TCM). China Association of Chinese Medicine organized experts in the field of TCM and western medicine rheumatology and pharmacology to discuss the advantages and optimal regimens of TCM for the treatment of SS. The experts generally agreed on the low early diagnosis rate of SS and the lack of targeted therapeutic drugs. In addition, autoimmune abnormality is the key factor in the occurrence of SS and deficiency of both Qi and Yin is the core pathogenesis. SS has unique tongue manifestations, which is expected to allow for the early diagnosis and treatment with integrated traditional Chinese and western medicine. TCM has advantages in treating SS in terms of alleviating clinical symptoms and systemic involvement, individualized treatment, relieving sleep and mood disorders, preventing the occurrence in the early stage, and enhancing the effectiveness and reducing toxicity in the treatment by integrated TCM and western medicine. In general, TCM has advantages in different stages of SS. Internal and external use of TCM, acupuncture, and acupotome are all available options. The optimal regimens should be determined on the basis of pattern identification, stage of disease, and the advantages of TCM. Clinical characteristics and biomarkers of SS should be studied to classify patients, so as to design precision evidence-based TCM regimens for SS. On the basis of unique tongue manifestations of SS, models for early diagnosis and poor prognosis identification of SS should also be established to achieve early prevention and treatment and to improve the prognosis. In the future, we should vigorously carry out high-quality evidence-based medical research on the treatment of SS by TCM and integrated traditional Chinese and western medicine and develop relevant guidelines to optimize and standardize current diagnosis and treatment, thereby laying a basis for clarifying and explaining the advantages of TCM in treating SS.
6.Akinesia deformation sequence in a fetus suspected by prenatal ultrasound and confirmed after mid-term termination
Xinyao LUO ; Qiuyang GU ; Xinxiu LIU ; Jianhua LI ; Liyan HUANG ; Xiaohua HUANG ; Shengnan WU ; Jingping YANG ; Meihua TAN
Chinese Journal of Perinatal Medicine 2022;25(3):218-221
We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.
7.Establishment of UPLC Fingerprint of Poria cocos Aqueous Extract and Study on Its Spectrum-effect Relationship with Sedative and Hypnotic Effect
Tianhe WANG ; Huijun LI ; Dandan ZHANG ; Xinyao LUO ; Heyuan XIA ; Sijie HAN ; Xiang PAN ; Ming WAN ; Xiaochuan YE
China Pharmacy 2021;32(5):564-570
OBJECTIVE:To establis h the UPLC fingerprint of Poria co cos aqueous extract ,and to investigate its relationship with sedative and hypnotic effect. METHODS :Ten batches of P. cocos from different areas were extracted with water to obtain the aqueous extract. UPLC method was adopted. The determination was performed on Waters HSS-C 18 column with mobile phase consisted of 0.1% phosphoric acid solution-acetonitrile-methanol (gradient elution ) at the flow rate of 0.4-0.2 mL/min. The detection wavelengths were set at 210 and 242 nm. The column temperature was 40 ℃,and sample size was 2 μL. The fingerprints of 10 batches of P. cocos aqueous extracts were established by using the Similarity Evaluation System of TCM Fingerprint (2012A version),and the common peaks were identified. The sedative and hypnotic effects of 10 batches of P. cocos aqueous extracts from different areas under the synergistic action of pentobarbital sodium were investigated by taking the sleeping rate ,sleep latency and sleep duration of mice as the single efficacy index. After data transformation of single efficacy index and total efficacy (single indexes calculated by analytic hierarchy process ),grey correlation analysis was used to analyze the correlation between the common peaks in fingerprint of P. cocos aqueous extract and the single efficacy index and total efficacy. RESULTS :There were 24 common peaks in 10 batches of aqueous extract of P. cocos , and 11 components were identified , i.e. 16 α-hydroxydehydrotrametenolic acid (peak 6),16α-hydroxytrametendic acid (peak 7),poricoic acid B (peak 9),dehydrotumulosic acid(peak 10),poricoic acid A (peak 12),polyporenic acid C (peak 15),3-O-acetyl-16α-hydroxydehydrotrametenolic acid (peak 17),dehydropachymic acid (peak 20),pachymic acid (peak 21),dehydrotrametenolic acid (peak 22),dehydroeburicoic acid (peak 24). Grey correlation analysis showed ,the correlation between 24 peaks and sleep duration was greater than 0.6(0.611 5- 0.811 8);the correlation between 24 peaks and sleep latency was greater than 0.6(0.605 9-0.790 4),except for peaks 14,24 and 2;the correlation of 24 peaks between sleeping rate was greater than 0.6(0.606 4-0.721 6),except for peaks 23,19,17 and 5; the correlation of 24 peaks between total efficacy was greater than 0.6(0.619 0-0.781 2),except for peaks 2,5,19. The top 10 chromatographic peaks related to the total efficacy were peak 15(polyporenic acid C ),peak 16,peak 8,peak 11,peak 12 (poricoic acid A ), peak 1, peak 7 (16 α-hydroxytrametendicacid), peak 3, peak 9 (poricoic acid B ) and peak 20 (dehydropachymic acid ). CONCLUSIONS :UPLC fingerprint of P. cocos aqueous extract was established and 11 components were identified. Ten components such as polyporus acid C are closely related to the total efficacy of sedation and hypnosis ,which preliminarily reveal the material basis of the sedative and hypnotic effect of P. cocos .
8.Study on Repair ,Anti-inflammation and Analgesia Effects of Compound Crocodile Oil Burn Ointment on Super- ficial Second-degree Burned Skin
Xiang PAN ; Sijie HAN ; Kezhuo CHEN ; Zhenglei LI ; Dandan ZHANG ; Xinyao LUO ; Huijun LI ; Heyuan XIA ; Tianhe WANG ; Xiaochuan YE
China Pharmacy 2021;32(20):2467-2472
OBJECTIVE:To study the repa ir,anti-inflammatory and analgesic effects of Compound crocodile oil burn ointment on superficial second-degree burned skin. METHODS :The heated weight was attached to the right depilated skin of guinea pigs for 4 s to induce the model of superficial second-degree burn. After modeling ,guinea pigs were randomly divided into model group , Jingwanhong ointment group (positive control ),formula Ⅰ,Ⅱ and Ⅲ groups of Compound crocodile oil burn ointment (volume fraction 1.5%,3%,4.5%,hereinafter),with 8 guinea pigs in each group. Except for model group ,other groups were smeared with 0.7 g/guinea pigs twice a day for 14 consecutive days. The wound healing was recorded every day ,the healing rate of wound was calculated. HE staining was used to observe the histopathological changes of the wound. The serum levels of EGF ,VEGF, SOD,MDA,TNF-α and IL-1 were detected by ELISA. Eighty Kunming mice were divided into 2 groups,and then sub-grouped into model group ,Jingwanhong ointment group (positive control ),formula Ⅰ and Ⅲ groups of Compound crocodile oil burn ointment,with 10 mice in each group. Then xylene auricle swelling method and acetic acid writhing method were used to investigate the anti-inflammatory and analgesic effects of Compound crocodile oil burn ointment. RESULTS :In the burn repair experiment,after intervention of Compound crocodile oil burn ointment ,the wound area of guinea pigs gradually decreased ,and on the 14th day ,the wound had healed greatly ,and the wound healing rate increased significantly (P<0.01);serum levels of EGF and SOD were increased significantly (P<0.01),while the levels of VEGF ,MDA,TNF-α and IL-1 were decreased significantly(P<0.05 or P<0.01). The thick new epidermal layer was found in wound tissue ,and the connective tissue and neovascularization in the dermis increased significantly. In the anti-inflammatory and analgesic experiment ,after intervention of Compound crocodile oil burn ointment ,the degree of ear swelling and the times of writhing decreased significantly (P<0.05 or P<0.01). CONCLUSIONS :Compound crocodile oil burn ointment shows good skin repair ,anti-inflammatory and analgesic efficacy;the mechanism may be associated with increasing the serum levels of EGF and SOD and reducing the levels of VEGF , MDA,TNF-α,IL-1.
9.Content Determination and Cluster Analysis of 7 Kinds of Triterpenes in Poria cocos from Different Habitats
Ming WAN ; Chao HUANG ; Yuying YANG ; Xinyao LUO ; Xiaochuan YE ; Ying DING ; Qiong DONG ; Shuhe CHEN
China Pharmacy 2020;31(17):2101-2106
OBJECTIVE:To establish a method for th e content determination of 7 kinds of triterpenoids in Poria cocos ,and to compare the differences of the above components in P. cocos from different habitats ,so as to provide reference for the quality control of P. cocos . METHODS :Using 36 batches of P. cocos from different habitats as samples ,HPLC method was used for content determination of dehydrotomorphic acid , polyporhinic acid C , 3-epidehydrotomorphic acid , 3-O-acetyl-16 α-hydroxy-hydrogenolysaccharic acid ,dehydrotomorphic acid ,pachymic acid and dehydrotrametenolic acid. The column was performed on Thermo Acclaim 120 C18 with mobile phase consisted of acetonitrile-phosphoric acid water (gradient elution )at the flow rate of 1 mL/min. The detection wavelength was set at 210 nm. The column temperature was 30 ℃,and the injection volume was 20 μL. SPSS 21.0 statistical software was used for cluster analysis of 36 batches of P. cocos from different habitats. RESULTS : The linearity of 7 triterpenoids was good in the range of their mass concentration (all r≥0.999 0);average recoveries were 96.74%-104.04%(RSD=0.54%-1.55%,n=6). RSDs of precision ,and reproducibility stability (24 h)tests were all lower than 3.0%(n=6). RSD of durability test was lower than 5.0%(n=2). There were some differences in the single content of 7 indicator components among samples from different habitats ,but the total content difference was not obvious (the total content of most samples was in the range of 1.3-1.9 mg/g). After cluster analysis ,36 batches of sample were clustered into 5 categories,i.e. S 27 was clustered into class Ⅰ;S30 and S 34 were clustered into class Ⅱ;S2,S8 and S 9 were clustered into class Ⅲ;S10,S11,S12 and S 14 were clustered into class Ⅳ;and the remaining 26 batches of samples were clustered into class Ⅴ. CONCLUSIONS :The method is simple ,and has good precision ,repeatability and durability. It can be used for the simultaneous determination of above 7 components in P. cocos . There has no significant difference in the quality of P. cocos from different habitats. The content of P. cocos in most producing areas is uniform in content and stable in quality ,only a few of them are different. Δ 基金项目 :国家重点研发计划中医药现代化研究重点专项
10.Comparison of Total Protein Content Difference of Poria cocos from Different Producing Areas
Xinyao LUO ; Jun LIU ; Huijun LI ; Tianhe WANG ; Yuying YANG ; Heyuan XIA ; Xiaochuan YE
China Pharmacy 2020;31(6):692-695
OBJECTIVE:Compare the difference of total protein content of Poria cocos from different producing areas. METHODs:Using bovine serum albumin (BSA) as control ,0.4 mol/L sodium hydroxide solution as exctraction solution , Coomassie brilliant blue G- 250 as chromogenic reagent ,visible spectrophotometry at 595 nm was used to determine the contents of total protein of P. cocos ;cluster analysis was used to classify 34 batches(S1-S34)of P. cocos from different producing areas. RESULTS:The linear range of BSA was 1.45-17.40 μ g/mL (r=0.999 6). RSDs of precision ,stability (20 min) and reproducibility tests were all lower than 3%;recoveries were 100.14%-104.26%(RSD=1.43%,n=9). The contents of total protein in 34 batches of P. cocos from different producing areas were 0.388 4%-1.129 7%. The results of cluster analysis showed that among 34 batches of P. cocos ,the total protein content of P. cocos produced in Yingshan county of Hubei province (S2,S3) was higher than 1%,clustered into one category ;the total protein contents of P. cocos produced in Hubei ,Yunnan,Anhui and Hunan(S1,S5-S10,S12,S13,S16,S17,S19-S21,S23-S25,S28,S30,S31)were 0.653 5%-0.946 1%,clustered into one categony,and the remaining batch content were 0.388 4%-0.601 2%,clustered into one category. CONCLUSIONS :Established method is suitable for the content determination of total protein content of P. cocos . The protein content of P. cocos from Yingshan county of Hubei province is the highest ,followed by Yunnan and Anhui in 34 batches of P. cocos from different producing areas.


Result Analysis
Print
Save
E-mail