Pinellia ternata， belonging to the Pinellia genus within the Araceae family， is a medicinal plant due to its tubers. There are severe issues with unclear germplasm and mixed varieties in its cultivation， necessitating urgent new variety protection efforts. The distinctness， uniformity， and stability （DUS） testing of the plant variety is the basis for protecting new plant varieties， and the DUS test guidelines are the technical basis for DUS testing. To develop the DUS test guidelines for P. ternata， agronomic traits of 229 germplasm of P. ternata were observed and measured during its two growth stages over the years， and each character was graded and described. A total of 38 traits were selected as the test traits of the DUS test guideline for P. ternata. There were three plant traits， 19 leaf traits， six flower traits， two fruit traits， two tuber traits， five bulbil traits， and one ploidy trait. These traits could be divided into 22 quality characters， 12 quantitative characters， and four pseudo-quantitative characters， as well as seven groups， including plants， leaves， flowers， fruit， tubers， bulbils， and ploidy. By searching for standard traits， 10 standard varieties were ultimately determined. Preparing these guidelines will have great significance for reviewing and protecting P. ternata varieties， safeguarding breeders' rights， and promoting the development of the P. ternata industry.

Stratified diagnosis and treatment is a crucial approach in precision medicine， aiming to optimize medical care by grouping patients based on clinical manifestations， biomarkers， and pathological characteristics. Based on clinical stages， symptoms， age， gene expression， and pathology， research on Sjögren's syndrome （SS） has proposed various stratification methods， incorporating both traditional Chinese medicine （TCM） and Western medicine perspectives. These methods provide essential support for early diagnosis， risk assessment， and personalized treatment. Key strategies include moving SS intervention time forward， to leverage TCM's preventive principles， integrating TCM and Western tools to enhance precision， innovating clinical trial designs， developing multifactorial risk prediction models and digital imaging technologies， and constructing combined prognostic models for personalized follow-up and big data-driven treatment. These insights offer a comprehensive framework for advancing SS precision medicine.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

The 2025 European Lung Cancer Congress (ELCC) convened in Paris, France, centering on the optimization and innovation of immunotherapy for non-small cell lung cancer (NSCLC). Key topics at the congress included the application strategies for perioperative immunotherapy, breakthroughs in combination therapy models for advanced NSCLC, and the emerging roles of biomarkers in predicting diverse treatment outcomes. This paper integrates data from several key pivotal studies to systematically analyze the clinical value of neoadjuvant therapy within the perioperative setting, the potential of targeted combination regimens, and the challenges of managing drug resistance, thus offering new directions for clinical practice.

Among numerous medical imaging modalities, diffusion weighted imaging (DWI) is extremely sensitive to acute ischemic stroke lesions, especially small infarcts. However, magnetic resonance imaging is time-consuming and expensive, and it is also prone to interference from metal implants. Therefore, the aim of this study is to design a medical image synthesis method based on generative adversarial network, Stroke-p2pHD, for synthesizing DWI images from computed tomography (CT). Stroke-p2pHD consisted of a generator that effectively fused local image features and global context information (Global_to_Local) and a multi-scale discriminator (M ²Dis). Specifically, in the Global_to_Local generator, a fully convolutional Transformer (FCT) and a local attention module (LAM) were integrated to achieve the synthesis of detailed information such as textures and lesions in DWI images. In the M ²Dis discriminator, a multi-scale convolutional network was adopted to perform the discrimination function of the input images. Meanwhile, an optimization balance with the Global_to_Local generator was ensured and the consistency of features in each layer of the M ²Dis discriminator was constrained. In this study, the public Acute Ischemic Stroke Dataset (AISD) and the acute cerebral infarction dataset from Yantaishan Hospital were used to verify the performance of the Stroke-p2pHD model in synthesizing DWI based on CT. Compared with other methods, the Stroke-p2pHD model showed excellent quantitative results (mean-square error = 0.008, peak signal-to-noise ratio = 23.766, structural similarity = 0.743). At the same time, relevant experimental analyses such as computational efficiency verify that the Stroke-p2pHD model has great potential for clinical applications.
Humans ; Tomography, X-Ray Computed/methods* ; Diffusion Magnetic Resonance Imaging/methods* ; Cerebral Infarction/diagnostic imaging* ; Stroke/diagnostic imaging* ; Neural Networks, Computer ; Image Processing, Computer-Assisted/methods* ; Algorithms

Stroke is a critical health issue in China, and carotid artery stenosis and plaque play key roles in its prevalence. Despite the acknowledged significance of this condition, detailed information regarding the prevalence of carotid artery stenosis and plaque across the Chinese population has been scarce. This study analyzed data from the China Stroke High-risk Population Screening and Intervention Program for 2020-2021, focusing on 194 878 Chinese adults aged 40 years and above. It assessed the prevalence of carotid artery stenosis and plaque and identified their associated risk factors. Results revealed a standardized prevalence of 0.40% for carotid artery stenosis and 36.27% for carotid plaque. Notably, the highest rates of stenosis were observed in north and south China at 0.61%, while southwestern China exhibited the highest plaque prevalence at 43.17%. Key risk factors included older age, male gender, hypertension, diabetes, stroke, smoking, and atrial fibrillation. This study highlights significant geographical and demographic disparities in the prevalence of these conditions, underlining the urgent need for targeted interventions and policy reforms. These measures are essential for reducing the incidence of stroke and improving patient outcomes, addressing this significant health challenge in China.
Humans ; China/epidemiology* ; Male ; Female ; Prevalence ; Middle Aged ; Carotid Stenosis/epidemiology* ; Risk Factors ; Aged ; Adult ; Plaque, Atherosclerotic/epidemiology* ; Stroke/epidemiology* ; Aged, 80 and over

Multiple thrombosis in the coronary arteries need to be characterized by a thorough determination of the source of the thrombus to distinguish them as thrombosis or coronary embolism.This case was a 38-year-old male patient with chest pain and an electrocardiogram showing acute inferior wall and right ventricular myocardial infarction.Emergency coronary angiography showed thrombosis in the proximal middle of the left anterior descending artery,the opening of the first diagonal artery,and the middle of the right coronary artery,but no obvious stenosis was seen.Postoperative electrocardiogram showed acute inferior wall,right ventricular and anterior wall myocardial infarction,and intensive antithrombotic treatment was applied,elective re-examination of coronary angiography and intraluminal imaging showed mixed plaques and suspicious intimal dissection,indicating the possibility of thrombosis secondary to unstable plaque and coronary dissection,and intensive drug treatment was given.After discharge,the patient was stable during the regular follow-up visits.

Objective:Analyzing the relationship between negative life events and depressive symptoms in university freshmen,and the mediating effects of neuroticism and the moderating role of exercise frequency.Meth-ods:A sampling of 8 079 university freshmen,and the Patient Health Questionnaire was used to assess depressive symptoms,the Eysenck Personality Inventory-Neuroticism subscale to assess neuroticism,the self-administered questionnaire to assess the number of negative life events that the participants had experienced and the exercise fre-quency.Model 4 in the Process plug-in was used to test the mediating effect of neuroticism,and Model 7 to test the moderating role of exercise frequency.Results:The numbers of negative life events were positively correlated with the depressive symptoms scores(r=0.16,P＜0.01),and were positively correlated with the neuroticism scores(r=0.26,P＜0.01).The neuroticism scores were positively correlated with the depressive symptoms scores(r=0.52,P＜0.01).Neuroticism score partially mediated between negative life events and depressive symptoms score,with a mediating effect of 78.4％,and exercise frequency score moderated between negative life events and neuroti-cism scores(β=-0.05,P=0.032).Conclusion:Negative life events are associated with depressive symptoms,neuroticism plays a mediating role,and exercise frequency could moderate negative life events and neuroticism.

Objective To explore the value of the Kyoto classification score in differentiating undifferentiated gastric cancer from differentiated gastric cancer,and establish a predictive scoring system for differentiating undifferentiated gastric cancer under endoscope.Methods 183 gastric cancer patients were retrospectively analyzed.According to pathology,95 patients were included in the differentiated group and 88 were included in the undifferentiated group.The age,gender and Kyoto classification score of patients in the two groups were compared,and the factors associated with undifferentiated gastric cancer were screened by binary Logistic regression analysis.The predictive scoring system for undifferentiated gastric cancer was established based on the obtained odds ratio(O(R))values,and the receiver operator characteristic curve(ROC curve)was drawn.Results Compared with differentiated group,the total scores of Kyoto classification,atrophy,intestinal metaplasia and diffuse redness were lower in undifferentiated group(P<0.01).Under the age of 55(P<0.05),female(P<0.05),and C1 atrophy or no atrophy(P<0.01)were independently associated with undifferentiated gastric cancer.The area under the curve(AUC)of predictive scoring system for undifferentiated gastric cancer was 0.881(95％CI:0.828～0.934),and the sensitivity and specificity were 80.70％and 90.50％at the optimal cut-off value.Conclusion There are differences in Kyoto classification scores between undifferentiated and differentiated gastric cancer patients.The predictive scoring system of undifferentiated gastric cancer established by us has certain value in distinguishing undifferentiated gastric cancer under endoscope.

Screening and evaluating the diseases responding specifically to traditional Chinese medicine （TCM） will help to highlight the advantages of TCM treatment， and the evaluation method should be standardized with consideration to the unique characteristics of the diseases. The incidence of Sjögren's Syndrome （SS） is increasing year by year， while the pathogenesis of this disease remains unclear. Modern therapies for this disease include biological agents and immunosuppressants， which generally have unsatisfactory efficacy. The TCM treatment of SS focuses on the harmony of the physical and mental health. The Rheumatology Branch of the China Association of Chinese Medicine organizes experts in TCM， Western medicine， and evidence-based medicine to form working groups. Delphi method and bibliometric method were used for analysis， and SS was selected as a disease responding specifically to TCM. Furthermore， the evaluation system was established for this disease， and the consensus regarding this disease was reached after seminar discussion. This paper summarized the whole process of the evaluation of the advantages of TCM treatment of SS. First， because TCM atomization is widely used in clinical practice and enriches TCM administration methods， this therapy is included after other non-drug therapies were taken as characteristic therapies. Second， the evaluation indicators of therapeutic effect should be determined with consideration to international acceptance and the current research status. Third， the expression method should be accurate， standardized， and objective， highlight the natural advantages of TCM， and avoid arbitrary extension. This paper provides a reference for clinicians to explore other diseases responding specifically to TCM.