Objective:To explore the application effect of special quality control management for thyroid and breast ultrasound in community hospitals.Methods:This study was a prospective interventional study. From November 2024 to March 2025, the Department of Ultrasound, China-Japan Friendship Hospital conducted special quality control management for thyroid and breast ultrasound in 17 community hospitals in Chaoyang District. Through measures such as standardized training in thyroid and breast ultrasound as well as quality control investigations before and after the training, changes in the qualification rates of ultrasound image storage, report writing, and nodule grading accuracy for thyroid and breast in community hospitals before and after the implementation of this management were compared, A paired t-test was used for statistical analysis. Results:Thyroid ultrasound quality control effects: Image storage qualification rates significantly improved: the qualification rate of image adjustment increased from 62.94%±22.01% to 85.88%±14.17% ( t=6.35, P<0.001), and body markers application rose from 76.47%±4.93% to 95.29%±7.17% ( t=11.14, P<0.001). The qualification rates for nodule sections and blood flow sections both exceeded 95% ( P<0.001). In report writing: the qualification rates for items such as nodule location, measurement, and echo increased by 10%-25%. The description of nodule margins reached 100% ( t=8.79, P<0.001), and the description of echogenic foci features increased from 41.76% to 79.41% ( t=5.46, P<0.001). Nodule classification accuracy significantly improved: The guideline application rate increased from 55.29% to 91.18% ( t=4.84, P<0.001), and the classification correctness rate rose from 54.71% to 69.41% ( t=5.14, P<0.001). Breast ultrasound quality control effects: Overall improvement in image storage qualification rates: body marker application increased from 75.29%±21.54% to 97.00%±65.88% ( t=3.82, P=0.002). The qualification rates for nodule sections and blood flow section imaging both exceeded 94% ( P<0.001). In report writing: the qualification rates for items like nodule location, measurement, and echo increased by 10%-30%. The classification rate of the Breast Imaging Reporting and Data System (BI-RADS) classification rate rose from 68.82% to 98.24% ( t=3.68, P=0.002), and the classification correctness rate increased from 57.65% to 70.00% ( t=2.74, P=0.014). Conclusion:The implementation of special quality control management for thyroid and breast ultrasound is an effective method to improve the quality of ultrasound medical services in community hospitals.

Objective:To analyze the overall level,structure,and regional differences of central government's health and wellness transfer payments to local governments in China,providing a basis for improving the fiscal transfer payment system.Methods:The regional differences and their changes in central government's health and wellness transfer payments to local governments were analyzed using range,standard deviation,coefficient of variation,and Kendall's coefficient of concordance.Results:From the perspective of the per capita level of central government's health and wellness transfer payments to local governments,the relative differences among provinces have shown a downward trend,but the absolute differences have expanded.Meanwhile,the absolute and relative differences in the proportion of central government's health and wellness transfer payments to local governments in total government health expenditures have remained relatively stable.The Kendall's coefficient of concordance between per capita central government's health and wellness transfer payments to local governments and per capita general public budget revenue has shown a downward trend.Conclusion:Due to the different standards for sharing the expenditure responsibilities of common fiscal matters between the central and local governments,the existence of regional differences in central government's health and wellness transfer payments to local governments is inevitable.However,within regions with similar levels of economic development,there should not be significant differences in the standards and degrees of central government's health and wellness transfer payments to local governments.Therefore,it is necessary to evaluate the current standards for the division of fiscal powers,responsibilities,and expenditure responsibilities between the central and local governments,optimize the allocation mechanism of fiscal transfer payments,control the expansion of regional differences,and improve the regular assessment mechanism for fiscal transfer payments.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

Objective:To analyze the association between moderate-to-vigorous-physical activity (MVPA) and obesity, poor sleep quality, as well as multimorbidity in 7- to 8-year-old children in Shanghai City.Methods:From September to November 2023, a cluster sampling method was used to select second-grade students from four primary schools in Jinshan District, Shanghai. Three-axis acceleration motion sensors (GT3X+, Acti-graph) were used to monitor daily physical activity for seven consecutive days. A multivariate logistic regression model was used to analyze the association between MVPA duration characteristics and obesity, poor sleep quality and multimorbidity in school-age children.Results:Of the 937 study participants, 512 (54.64%) were boys and 425 (45.36%) were girls. Among them, 89 (9.50%) were obese and 782 (83.46%) had poor sleep quality. A total of 77 cases (8.22%) were affected by obesity and poor sleep quality. The average daily MVPA time was (45.97±15.87) minutes, and the MVPA attainment rate was 17.18%. The multivariate logistic regression model analysis showed that, after adjusting for covariates, the daily average MVPA time was negatively associated with the risk of obesity ( OR=0.982, 95% CI: 0.968-0.997), as well as multimorbidity ( OR=0.981, 95% CI: 0.965-0.997). The risk of obesity, poor sleep quality and multimorbidity in <1 d was 2.228 ( OR=2.228, 95% CI: 1.398-3.549), 1.702 ( OR=1.702, 95% CI: 1.141-2.540) and 2.150 ( OR=2.150, 95% CI: 1.310-3.528) times higher than that in ≥1 d. Conclusion:Obesity, poor sleep quality and multimorbidity of school-age children are closely related to the level of moderate-to-vigorous physical activity.

Objective: To investigate the current status and trends of depressive symptoms among middle school and college students in Hunan Province, and to explore the primary related factors of depressive symptoms, so as to provide a scientific basis for strengthening mental health among students. Methods: A total of 279 382 students in Hunan Province were selected through a stratified cluster random sampling method from 2021 to 2023. National Survey Questionnaire on Common Diseases and Health Influencing Factors among Students was adopted for the survey, and the Center for Epidemiological Studies Depression Scale was used to assess their depressive symptoms. The χ 2 test and trend χ 2 test were used to analyze depressive symptoms prevalence and trends, and multivariable Logistic regression was used to analyze the related factors of depressive symptoms. Results: The prevalence of depressive symptoms among students in Hunan Province from 2021 to 2023 were 19.66%, 20.17% and 21.47%, respectively, showing an upward trend ( χ 2 trend =9.07, P <0.01). In addition, the results of the multivariable Logistic regression analysis showed that students with healthy diet ( OR=0.43, 95%CI =0.40-0.45), adequate sleep ( OR=0.88, 95%CI =0.86-0.90), and acceptable screen time ( OR=0.61, 95%CI =0.60-0.62) had lower risks in depressive symptoms detection, while students with smoking ( OR= 1.95, 95%CI =1.88-2.02), secondhand smoke exposure ( OR=1.33, 95%CI =1.30-1.36) and Internet addiction ( OR= 4.19 , 95%CI =4.05-4.34) had higher risks in depressive symptoms detection, with differences in the degree of association among different genders, educational stages and urban rural groups ( OR=0.40-6.04, Z =-12.69-11.98) ( P <0.05). Conclusions There is an increasing trend of depressive symptoms among middle school and college students in Hunan Province from 2021 to 2023.Targeted depression prevention measures should be taken for students with different demographic characteristics to promote their mental health.

Pinellia ternata， belonging to the Pinellia genus within the Araceae family， is a medicinal plant due to its tubers. There are severe issues with unclear germplasm and mixed varieties in its cultivation， necessitating urgent new variety protection efforts. The distinctness， uniformity， and stability （DUS） testing of the plant variety is the basis for protecting new plant varieties， and the DUS test guidelines are the technical basis for DUS testing. To develop the DUS test guidelines for P. ternata， agronomic traits of 229 germplasm of P. ternata were observed and measured during its two growth stages over the years， and each character was graded and described. A total of 38 traits were selected as the test traits of the DUS test guideline for P. ternata. There were three plant traits， 19 leaf traits， six flower traits， two fruit traits， two tuber traits， five bulbil traits， and one ploidy trait. These traits could be divided into 22 quality characters， 12 quantitative characters， and four pseudo-quantitative characters， as well as seven groups， including plants， leaves， flowers， fruit， tubers， bulbils， and ploidy. By searching for standard traits， 10 standard varieties were ultimately determined. Preparing these guidelines will have great significance for reviewing and protecting P. ternata varieties， safeguarding breeders' rights， and promoting the development of the P. ternata industry.

Objective:To analyze the overall level,structure,and regional differences of central government's health and wellness transfer payments to local governments in China,providing a basis for improving the fiscal transfer payment system.Methods:The regional differences and their changes in central government's health and wellness transfer payments to local governments were analyzed using range,standard deviation,coefficient of variation,and Kendall's coefficient of concordance.Results:From the perspective of the per capita level of central government's health and wellness transfer payments to local governments,the relative differences among provinces have shown a downward trend,but the absolute differences have expanded.Meanwhile,the absolute and relative differences in the proportion of central government's health and wellness transfer payments to local governments in total government health expenditures have remained relatively stable.The Kendall's coefficient of concordance between per capita central government's health and wellness transfer payments to local governments and per capita general public budget revenue has shown a downward trend.Conclusion:Due to the different standards for sharing the expenditure responsibilities of common fiscal matters between the central and local governments,the existence of regional differences in central government's health and wellness transfer payments to local governments is inevitable.However,within regions with similar levels of economic development,there should not be significant differences in the standards and degrees of central government's health and wellness transfer payments to local governments.Therefore,it is necessary to evaluate the current standards for the division of fiscal powers,responsibilities,and expenditure responsibilities between the central and local governments,optimize the allocation mechanism of fiscal transfer payments,control the expansion of regional differences,and improve the regular assessment mechanism for fiscal transfer payments.

Objective:To explore the application effect of special quality control management for thyroid and breast ultrasound in community hospitals.Methods:This study was a prospective interventional study. From November 2024 to March 2025, the Department of Ultrasound, China-Japan Friendship Hospital conducted special quality control management for thyroid and breast ultrasound in 17 community hospitals in Chaoyang District. Through measures such as standardized training in thyroid and breast ultrasound as well as quality control investigations before and after the training, changes in the qualification rates of ultrasound image storage, report writing, and nodule grading accuracy for thyroid and breast in community hospitals before and after the implementation of this management were compared, A paired t-test was used for statistical analysis. Results:Thyroid ultrasound quality control effects: Image storage qualification rates significantly improved: the qualification rate of image adjustment increased from 62.94%±22.01% to 85.88%±14.17% ( t=6.35, P<0.001), and body markers application rose from 76.47%±4.93% to 95.29%±7.17% ( t=11.14, P<0.001). The qualification rates for nodule sections and blood flow sections both exceeded 95% ( P<0.001). In report writing: the qualification rates for items such as nodule location, measurement, and echo increased by 10%-25%. The description of nodule margins reached 100% ( t=8.79, P<0.001), and the description of echogenic foci features increased from 41.76% to 79.41% ( t=5.46, P<0.001). Nodule classification accuracy significantly improved: The guideline application rate increased from 55.29% to 91.18% ( t=4.84, P<0.001), and the classification correctness rate rose from 54.71% to 69.41% ( t=5.14, P<0.001). Breast ultrasound quality control effects: Overall improvement in image storage qualification rates: body marker application increased from 75.29%±21.54% to 97.00%±65.88% ( t=3.82, P=0.002). The qualification rates for nodule sections and blood flow section imaging both exceeded 94% ( P<0.001). In report writing: the qualification rates for items like nodule location, measurement, and echo increased by 10%-30%. The classification rate of the Breast Imaging Reporting and Data System (BI-RADS) classification rate rose from 68.82% to 98.24% ( t=3.68, P=0.002), and the classification correctness rate increased from 57.65% to 70.00% ( t=2.74, P=0.014). Conclusion:The implementation of special quality control management for thyroid and breast ultrasound is an effective method to improve the quality of ultrasound medical services in community hospitals.

Objective:To analyze the association between moderate-to-vigorous-physical activity (MVPA) and obesity, poor sleep quality, as well as multimorbidity in 7- to 8-year-old children in Shanghai City.Methods:From September to November 2023, a cluster sampling method was used to select second-grade students from four primary schools in Jinshan District, Shanghai. Three-axis acceleration motion sensors (GT3X+, Acti-graph) were used to monitor daily physical activity for seven consecutive days. A multivariate logistic regression model was used to analyze the association between MVPA duration characteristics and obesity, poor sleep quality and multimorbidity in school-age children.Results:Of the 937 study participants, 512 (54.64%) were boys and 425 (45.36%) were girls. Among them, 89 (9.50%) were obese and 782 (83.46%) had poor sleep quality. A total of 77 cases (8.22%) were affected by obesity and poor sleep quality. The average daily MVPA time was (45.97±15.87) minutes, and the MVPA attainment rate was 17.18%. The multivariate logistic regression model analysis showed that, after adjusting for covariates, the daily average MVPA time was negatively associated with the risk of obesity ( OR=0.982, 95% CI: 0.968-0.997), as well as multimorbidity ( OR=0.981, 95% CI: 0.965-0.997). The risk of obesity, poor sleep quality and multimorbidity in <1 d was 2.228 ( OR=2.228, 95% CI: 1.398-3.549), 1.702 ( OR=1.702, 95% CI: 1.141-2.540) and 2.150 ( OR=2.150, 95% CI: 1.310-3.528) times higher than that in ≥1 d. Conclusion:Obesity, poor sleep quality and multimorbidity of school-age children are closely related to the level of moderate-to-vigorous physical activity.

Multiple thrombosis in the coronary arteries need to be characterized by a thorough determination of the source of the thrombus to distinguish them as thrombosis or coronary embolism.This case was a 38-year-old male patient with chest pain and an electrocardiogram showing acute inferior wall and right ventricular myocardial infarction.Emergency coronary angiography showed thrombosis in the proximal middle of the left anterior descending artery,the opening of the first diagonal artery,and the middle of the right coronary artery,but no obvious stenosis was seen.Postoperative electrocardiogram showed acute inferior wall,right ventricular and anterior wall myocardial infarction,and intensive antithrombotic treatment was applied,elective re-examination of coronary angiography and intraluminal imaging showed mixed plaques and suspicious intimal dissection,indicating the possibility of thrombosis secondary to unstable plaque and coronary dissection,and intensive drug treatment was given.After discharge,the patient was stable during the regular follow-up visits.