1.The association between prefrontal cortex functional connectivity and clinical symptoms in patients with schizophrenia
Man DONG ; Yang TIAN ; Lifeng WANG ; Bingqian LIU ; Ranran XUE ; Xinxiu HE ; Xia LIU ; Shanling JI ; Hao YU
Chinese Journal of Behavioral Medicine and Brain Science 2025;34(10):905-911
Objective:To investigate the functional characteristics of the prefrontal cortex in patients with schizophrenia (SCZ) during resting state and analyze its association with clinical symptoms.Methods:Twenty-eight hospitalized patients with SCZ (SCZ group) were selected from November 2023 to May 2024, and 28 healthy controls (HC group) were recruited concurrently. By using functional near-infrared spectroscopy (fNIRS) technology, data on the concentration changes of oxygenated hemoglobin (HbO) and deoxygenated hemoglobin (HbR) in the prefrontal cortex during resting state were collected from all subjects to measure cortical hemodynamic activity. Regional activation values and functional connectivity (FC) values among brain areas were analyzed. Clinical symptoms in patients were assessed using the positive and negative syndrome scale (PANSS).SPSS 25.0 software was employed for statistical analysis. Between-group comparisons were performed using independent samples t-tests or Mann-Whitney U tests. Spearman correlation analysis and general linear regression models were applied to examine relationships between prefrontal cortical functional characteristics and clinical symptoms. Results:The levels of HbO in the right inferior frontal gyrus and left frontal pole area were significantly higher in the SCZ group (1.5 (1.0, 3.0)μmol/L, 1.0 (1.0, 2.8)μmol/L) than those in the HC group (-0.01 (-0.05, 0.02)μmol/L, -0.02 (-0.07, 0.03)μmol/L) ( Z=-6.46, -6.50, both P<0.01). The levels of HbR in the bilateral dorsolateral prefrontal cortex were significantly higher in the SCZ group (0.02 (-0.01, 0.07)μmol/L, 0.01 (-0.01, 0.03)μmol/L) than those in the HC group (-0.01 (-0.03, 0.01)μmol/L, -0.01 (-0.02, 0.01)μmol/L) ( Z=-2.46, -1.98, both P<0.05).The SCZ group showed significantly higher HbO-based FC values in the frontal pole-temporal pole (0.49±0.21) and temporal pole-dorsolateral prefrontal cortex (0.36±0.25) compared to the HC group (0.33±0.18, 0.15±0.19) ( t=3.02, 3.44, both P<0.01). Conversely, the SCZ group exhibited significantly lower HbR-based FC in the frontal pole-inferior frontal gyrus (0.15±0.13) and inferior frontal gyrus-temporal pole (0.27±0.37) compared to the HC group (0.33±0.26, 0.77±0.48) ( t=-3.17, -4.23, both P<0.01). Correlation analysis revealed that in the SCZ group, the level of HbO in the right inferior frontal gyrus was positively correlated with negative symptoms, positive symptoms, excitement/hostility, and PANSS total score ( r=0.45-0.64, all P<0.05), and the level of HbO in the left frontal pole area was positively correlated with excitement/hostility and PANSS total score ( r=0.57, 0.50, both P<0.01), while the FC value between the frontal pole and temporal pole areas showed a negative correlation with excitement/hostility ( r=-0.39, P<0.05). Regression analysis demonstrated that, the HbO concentration in the right inferior frontal gyrus significantly positively predicted PANSS total score, positive symptoms, and negative symptoms ( β=0.70, 0.64, 0.55, all P<0.01).The HbO concentration in the left frontal pole area significantly positively predicted excitement/hostility ( β=0.77, P<0.01).The frontal pole-temporal pole HbO-based FC significantly negatively predicted excitement/hostility scores ( β=-0.42, P<0.01). Conclusion:Patients with SCZ exhibit hyperactivation of localized prefrontal cortex brain regions and dysfunction of functional connectivity during resting state, which are significantly associated with core clinical symptoms including positive, negative, and excitement/hostility symptoms.
2.The association between prefrontal cortex functional connectivity and clinical symptoms in patients with schizophrenia
Man DONG ; Yang TIAN ; Lifeng WANG ; Bingqian LIU ; Ranran XUE ; Xinxiu HE ; Xia LIU ; Shanling JI ; Hao YU
Chinese Journal of Behavioral Medicine and Brain Science 2025;34(10):905-911
Objective:To investigate the functional characteristics of the prefrontal cortex in patients with schizophrenia (SCZ) during resting state and analyze its association with clinical symptoms.Methods:Twenty-eight hospitalized patients with SCZ (SCZ group) were selected from November 2023 to May 2024, and 28 healthy controls (HC group) were recruited concurrently. By using functional near-infrared spectroscopy (fNIRS) technology, data on the concentration changes of oxygenated hemoglobin (HbO) and deoxygenated hemoglobin (HbR) in the prefrontal cortex during resting state were collected from all subjects to measure cortical hemodynamic activity. Regional activation values and functional connectivity (FC) values among brain areas were analyzed. Clinical symptoms in patients were assessed using the positive and negative syndrome scale (PANSS).SPSS 25.0 software was employed for statistical analysis. Between-group comparisons were performed using independent samples t-tests or Mann-Whitney U tests. Spearman correlation analysis and general linear regression models were applied to examine relationships between prefrontal cortical functional characteristics and clinical symptoms. Results:The levels of HbO in the right inferior frontal gyrus and left frontal pole area were significantly higher in the SCZ group (1.5 (1.0, 3.0)μmol/L, 1.0 (1.0, 2.8)μmol/L) than those in the HC group (-0.01 (-0.05, 0.02)μmol/L, -0.02 (-0.07, 0.03)μmol/L) ( Z=-6.46, -6.50, both P<0.01). The levels of HbR in the bilateral dorsolateral prefrontal cortex were significantly higher in the SCZ group (0.02 (-0.01, 0.07)μmol/L, 0.01 (-0.01, 0.03)μmol/L) than those in the HC group (-0.01 (-0.03, 0.01)μmol/L, -0.01 (-0.02, 0.01)μmol/L) ( Z=-2.46, -1.98, both P<0.05).The SCZ group showed significantly higher HbO-based FC values in the frontal pole-temporal pole (0.49±0.21) and temporal pole-dorsolateral prefrontal cortex (0.36±0.25) compared to the HC group (0.33±0.18, 0.15±0.19) ( t=3.02, 3.44, both P<0.01). Conversely, the SCZ group exhibited significantly lower HbR-based FC in the frontal pole-inferior frontal gyrus (0.15±0.13) and inferior frontal gyrus-temporal pole (0.27±0.37) compared to the HC group (0.33±0.26, 0.77±0.48) ( t=-3.17, -4.23, both P<0.01). Correlation analysis revealed that in the SCZ group, the level of HbO in the right inferior frontal gyrus was positively correlated with negative symptoms, positive symptoms, excitement/hostility, and PANSS total score ( r=0.45-0.64, all P<0.05), and the level of HbO in the left frontal pole area was positively correlated with excitement/hostility and PANSS total score ( r=0.57, 0.50, both P<0.01), while the FC value between the frontal pole and temporal pole areas showed a negative correlation with excitement/hostility ( r=-0.39, P<0.05). Regression analysis demonstrated that, the HbO concentration in the right inferior frontal gyrus significantly positively predicted PANSS total score, positive symptoms, and negative symptoms ( β=0.70, 0.64, 0.55, all P<0.01).The HbO concentration in the left frontal pole area significantly positively predicted excitement/hostility ( β=0.77, P<0.01).The frontal pole-temporal pole HbO-based FC significantly negatively predicted excitement/hostility scores ( β=-0.42, P<0.01). Conclusion:Patients with SCZ exhibit hyperactivation of localized prefrontal cortex brain regions and dysfunction of functional connectivity during resting state, which are significantly associated with core clinical symptoms including positive, negative, and excitement/hostility symptoms.
3.The effect of intrinsic capacity and comorbidity on adverse outcomes in community-dwelling older adults: path analysis based on structure equation model
Shuo LIU ; Xiaohong LIU ; Lin KANG ; Shan JIANG ; Jiaojiao LI ; Xinxiu YU
Chinese Journal of Geriatrics 2024;43(3):366-371
Objective:To examine the impact of intrinsic capacity(IC), comorbidity, and their interaction on the occurrence of adverse outcomes in community-dwelling older adults.Methods:This 2-year observational cohort study included 230 residents aged 75 and above who lived in the Beijing Taikang Yanyaun community active area from June to August 2018.The study evaluated the IC scale, Charlson comorbidity index(CCI), and activity of daily living(ADL).In September 2020, adverse outcomes such as functional decline(defined as a decline of at least one point on the ADL scores at 2-year follow-up compared with baseline)and falls were assessed.The structure equation model(SEM)path analysis was employed to examine the direct and indirect effects of IC and CCI on adverse outcomes.Results:Among the 212 older adults who completed a 2-year follow-up, aged 75-93(mean age 83.8±4.4)years, 59.4%(126 cases)were female.Out of these participants, 51.4%(109 cases)experienced functional decline and 33.5%(71 cases)had falls.Path analysis revealed that the direct effects of IC on functional decline and falls were significantly positive, with standardized coefficients of 0.430 and 0.369, respectively.However, the effect of CCI was not found to be significant.The multi-variable Logistic regression model showed that the total effect of IC on functional decline and falls remained significantly positive, with values of 1.184 and 0.915, respectively.CCI acted as a mediating factor, with indirect effects on functional decline and falls accounting for 5.4% and 0.8%, respectively.In terms of the relationship between age and adverse outcomes, the indirect effect of IC was significantly higher than that of CCI(functional decline: 0.192 vs.0.037; falls: 0.158 vs.0.017). Conclusions:The maintenance of IC in the health management of community-dwelling older adults should be given more attention as it can significantly affect the incidence of functional decline and falls.Comorbidity, on the other hand, has a weaker influence.
4.Akinesia deformation sequence in a fetus suspected by prenatal ultrasound and confirmed after mid-term termination
Xinyao LUO ; Qiuyang GU ; Xinxiu LIU ; Jianhua LI ; Liyan HUANG ; Xiaohua HUANG ; Shengnan WU ; Jingping YANG ; Meihua TAN
Chinese Journal of Perinatal Medicine 2022;25(3):218-221
We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.
5.Changes and clinical significance of gastrin 17 in diabetic nephropathy
Dechao YIN ; Jianfeng CHEN ; Fei ZHAI ; Kemei LIU ; Xinxiu ZHANG ; Xiaofang HAN
Chinese Journal of Postgraduates of Medicine 2021;44(8):676-679
Objective:To investigate the changes and clinical significance of gastrin 17 (G-17) in patients with diabetic nephropathy (DN).Methods:One hundred and twenty-four DN patients admitted to Hefei Second People′s Hospital from July 2018 to December 2020 were selected as the DN group, and divided into Ⅰ-Ⅱstage subgroup (68 cases) and Ⅲ-Ⅴ stage subgroup (56 cases) according to the stage of DN.Inaddition, 100 cases of type 2 diabetes mellitus(T2DM) patients without DN were selected as the T2DM group, and 100 healthy subjects who examined during the same period were selected as the control group. The levels of G-17, serum creatinine (SCr), evaluated glomerular filtration rate (eGFR) and other index in each group were detected. The normal level of G-17 was 1-7 pmol/L. G-17>7 pmol/L and ≤ 15 pmol/L was as marginal rising, and G-17>15 pmol/L was as rising.Results:The marginal rising rate of G-17 in the DN group was higher than that in the T2DM group: 43.5%(54/124) vs. 23.0%(23/100); the rising rate of G-17 in the DN group was higher than that in the T2DM group and the control group: 21.0%(26/124) vs. 7.0%(7/100), 4.0%(4/100), and the differences were statistically significant ( P<0.05). The marginal rising rate and rising rate of G-17 in Ⅲ-Ⅴstage subgroup were both higher than those in the Ⅰ-Ⅱ stage subgroup and the T2DM group: 58.9%(33/56) vs. 30.9%(21/68), 23.0%(23/100); 32.1%(18/56) vs. 11.8%(8/68), 7.0%(7/100), and the differences were statistically significant ( P<0.05). The marginal rising rate and rising rate of G-17 in DN patients with a disease course of ≥3 years was higher than that in patients with a disease course of <3 years and the T2DM group: 53.0%(44/83) vs. 24.4%(10/41), 23.0%(23/100); 27.7%(23/83) vs. 7.3%(3/41), 7.0%(7/100), and the differences were statistically significant ( P<0.05). Correlation analysis showed that G-17 was positively correlated with SCr ( r = 0.367, P<0.001) and negatively correlated with eGFR ( r = -0.619, P<0.001) in DN patients. Conclusions:The level of G-17 in ND patients is significantly increased, which is closely related to DN staging and can provide an auxiliary indicator for screening renal function in patients with T2DM.
6.Monochorionic monoamniotic twins discordant for anencephaly: a case report
Yanqiu ZHONG ; Xinxiu LIU ; Min CHEN ; Haiying LI ; Qiuyang GU ; Juanbing WEI ; Ling CHEN ; Ling GAN
Chinese Journal of Perinatal Medicine 2019;22(5):345-349
We reported a case of monochorionic monoamniotic twins discordant for anencephaly diagnosed by second-trimester ultrasonography at the First Affiliated Hospital of Fujian Medical University.Ultrasound at seven weeks of gestation showed only one gestational sac with an embryo inside.Another 12 gestational weeks' ultrasound scan performed at another hospital found one gestational sac and one fetus (crown-rump length was 6.11 cm and nuchal translucency was 0.11 cm) in the upper-middle uterine cavity.The ultrasound examination at 22+6 gestational weeks identified one placenta and two fetuses without obvious diaphragm echo in between.Although no structural abnormality was observed in one fetus,frog-like eyes,absence of skull image and brain tissue echo were presented in the other fetus.The patient was transferred to a higher level hospital and was successfully performed radiofrequency ablation for selective reduction at 23+4 weeks of gestation.At 35 weeks,a premature live boy and an anencephalic stillbirth fetus were born vaginally after premature rupture of membranes.The baby boy was healthy at follow-up at four months old.
7.Meningeal cysts complicated with tethered cord syndrome diagnosed by prenatal ultrasonography:a case report
Shengnan WU ; Xinxiu LIU ; Ling CHEN ; Zhaoyang QU ; Zhen YE
Chinese Journal of Perinatal Medicine 2019;22(8):614-616
We reported a case diagnosed with meningeal cysts complicated with tethered cord syndrome based on prenatal ultrasound images at 37+5 gestational weeks, which also showed horseshoe kidney and intrahepatic vascular abnormalities (arteriovenous fistula) in the fetus. The gravida had a precipitate delivery at 39+4 gestational weeks. The anus of this newborn was about 1 cm in front of the normal position. Intrahepatic arteriovenous fistula and horseshoe kidney were detected by neonatal ultrasound and CT scan, and spinal cystic occupying lesion was found by lumbar-sacrum MRI. Intraspinal tumors were removed through spinal canal exploration and spinal cord tumor resection and were confirmed as ependymal cysts by pathological analysis, which was consistent with the prenatal diagnosis. Postoperative changes of lumbar spine was reported by CT scan after the operation. The baby received successful anoplasty when five months old and no abnormal growth or development were found when followed up to one year and eight months old. Raising awareness of tethered cord syndrome can help reduce missed diagnosis and misdiagnosis.
8.Determination of Residual Solvents in Rupatadine Fumarate by Headspace Gas Chromatography
Xiaolei SHI ; Hanhan LIU ; Jing WU ; Xinxiu FANG ; Renjie SONG
China Pharmacist 2016;19(5):1024-1025,1026
Objective:To determine the content of cyclohexane, ethyl acetate, methanol, methylene chloride and trichloromethane in rupatadine fumarate by headspace gaschromatography. Methods:A DB-WAXETRR capillary column(30 m × 0. 32 mm,0. 25 μm)was used and the carrier gas was nitrogen. The detector was an FID and the inlet temperature was 200℃ . The column temperature program was with the initial temperature of 35℃,maintained 10 min,and then risen to 220℃ with the rate of 20℃·min -1 ,and maintained 5 min. Results:Cyclohexane,ethyl acetate,methanol,methylene chloride and trichloromethane showed a good linear relationship within the range of 77. 590 1- 698. 310 9 μg·ml -1(r = 0. 999 7),102. 166 6- 919. 499 4 μg· ml -1(r = 0. 999 8),62. 744 7- 564. 703 2μg·ml -1(r = 0. 999 9),12. 011 2- 108. 101 1 μg·ml-1(r = 0. 999 6)and 1. 262 8-11. 365 6 μg·ml -1(r = 0. 999 6). The average recovery was 103. 9% ,103. 5% ,104. 9% ,107. 1% and 103. 4% and RSD was 2. 3% ,2. 6% ,3. 1% ,2. 8% and 4. 5%(n = 9),respectively. The five residual solvents were not detected out in rupatadine fumarate. Conclusion:The method is stable,simple,sensitive and accurate,and can be used for the determination of residual solvents in rupatadine fumarate.
9.Clinical application of VIP-CT flap with GBR technique in dental implantation of the maxillary anterior region
Xinxiu DUAN ; Xin LIU ; Jiacai HE
Acta Universitatis Medicinalis Anhui 2015;(4):549-551
This article presented a series of cases using vascularized interpositional periosteal-connective tissue ( VIP-CT) flap with guide bone regeneration ( GBR) in peri-implant soft and hard tissue reconstuction at the esthet-ic zone of maxillary. Fifteen cases with bone and soft tissue defects underwent VIP-CT flap with GBR in the implant treatment. And the attached gingiva width was evaluated before treatment and six months and eighteen months after the operation. The width of attached gingival of six months and eighteen months after surgery was significantly dif-ferent from the preoperative value (P<0. 05). However, no statistically significant difference could be found at six months and eighteen months postoperative. The application of VIP-CT flap could increase the width of attached gin-giva around implants and the short-term effects were stable and favorable.
10.JAK2 V617F mutation burden and its clinical implications in 415 patients with myeloproliferative neoplasm.
Yuquan LIU ; Chuanfang LIU ; Na HE ; Min WANG ; Xinxiu ZHANG ; Dongyi TANG ; Chunyan JI ; Daoxin MA
Chinese Journal of Hematology 2015;36(3):191-195
OBJECTIVETo detect JAK2 V617F mutation burden and its clinical implications in patients with myeloproliferative neoplasm (MPN).
METHODSJAK2 V617F mutation burden were detected by using MGB Taqman probes and its clinical significance were retrospectively studied in 415 MPN patients.
RESULTSJAK2 V617F was found in 56.9% of all patients [83.5% in polycythemia vera (PV), 55.9% in essential thrombocythemia (ET), 41.9% in primary myelofibrosis (PMF) and 64.7% in MPN-unclassifiable)]. The majority of patients carried heterozygous JAK2 V617F mutation and homozygote was found only in 12 cases (4 in PV, 4 in MPN-U, 2 in PMF, 1 in ET, and 1 in chronic neutrophilic leukemia). Most patients (68.8%) were lower mutation burden (mutation burden<50%), but PV had the highest burden, the moderate burden in PMF and the least in ET. The patient's age and WBC count were significantly correlated with higher mutation burden in PV. WBC count was significantly related to higher mutation burden in ET. WBC count, Hb level and the platelet count were significantly related to higher mutation burden in PMF.
CONCLUSIONThe mutation burden of JAK2 V617F from high to low was PV, ET and PMF. The majority of JAK2 V617F mutation was heterozygous. JAK2 V617F mutation burden was positively correlated with age, WBC, Hb and platelet counts.
Homozygote ; Humans ; Janus Kinase 2 ; Leukocyte Count ; Mutation ; Myeloproliferative Disorders ; Platelet Count ; Polycythemia Vera ; Retrospective Studies ; Thrombocythemia, Essential

Result Analysis
Print
Save
E-mail