ObjectiveTo investigate the effect of quercetin on acute gouty arthritis （GA） in rats by inhibiting the reactive oxygen species （ROS）/NOD-like receptor protein 3 （NLRP3）/interleukin-1β （IL-1β） signaling pathway. MethodsSixty SPF-grade male SD rats were randomized into normal， model， colchicine （0.3 mg·kg^-1）， and low-， medium-， and high-dose （25， 50， 100 mg·kg^-1， respectively） quercetin groups （n=10）. The rats in the dosing groups were administrated with the corresponding drugs （10 mL·kg^-1） by gavage once a day for one week. An equal volume of normal saline was given by gavage to rats in normal and model groups. One hour after drug administration on day 5， an acute GA model was established in other groups except the control group via intra-articular injection of monosodium urate （MSU） suspension into the right posterior ankle joint cavity. The joint swelling and gait were scored at the time points of 6， 12， 24， 48 h after modeling. Histopathological alterations in the ankle joint tissue from each group were assessed by hematoxylin-eosin （HE） staining. Malondialdehyde （MDA）， xanthine oxidase （XOD）， and total superoxide dismutase （T-SOD） assay kits were used to assess the levels of MDA， XOD， and T-SOD in the serum. The levels of tumor interleukin-6 （IL-6）， necrosis factor-α （TNF-α）， and IL-1β in the rat serum， as well as ROS in the ankle joint tissue， were measured by enzyme-linked immunosorbent assay （ELISA）. Western blot was performed to determine the protein levels of NLRP3， thioredoxin-interacting protein （TXNIP）， apoptosis-associated speck-like protein containing a CARD domain （ASC）， precursor cysteinyl aspartate-specific proteinase-1 （pro-Caspase-1）， cleaved Caspase-1 （Caspase-1 p20）， and IL-1β in the ankle joint tissue. Real-time PCR was employed to assess the mRNA levels of TXNIP， NLRP3， ASC， IL-1β， and TNF-α in the ankle joint tissue. ResultsCompared with the normal group， the model group exhibited decreased spontaneous activity， mental fatigue， increased ankle joint swelling and gait scores （P<0.01）， aggravated synovial tissue edema and inflammatory cell infiltration （P<0.01）， elevated levels of XOD， MDA， TNF-α， IL-1β， and IL-6 in the serum and ROS in the joint tissue （P<0.01）， a declined level of T-SOD （P<0.01）， up-regulated protein levels of NLRP3， TXNIP， ASC， pro-Caspase-1， Caspase-1 p20， and IL-1β in the ankle joint tissue （P<0.01）， and up-regulated mRNA levels of NLRP3， TXNIP， ASC， IL-1β， and TNF-α in the ankle joint tissue （P<0.01）. Compared with the model group， the medium- and high-dose quercetin groups showed improved general conditions， decreased gait scores （P<0.05， P<0.01）， reduced joint swelling （P<0.01）， alleviated synovial tissue edema and inflammatory cell infiltration （P<0.05， P<0.01）， lowered levels of XOD， MDA， TNF-α， IL-1β， and IL-6 in the serum and ROS in the joint tissue （P<0.01）， increased levels of T-SOD （P<0.01）， down-regulated protein levels of TXNIP， NLRP3， ASC， pro-Caspase-1， Caspase-1 p20， and IL-1β in the ankle joint tissue （P<0.05， P<0.01）， and down-regulated mRNA levels of TXNIP， NLRP3， ASC， IL-1β， and TNF-α in the ankle joint tissue （P<0.01）. Low-dose quercetin also ameliorated some of the above parameters （P<0.05， P<0.01）. ConclusionQuercetin exerts anti-GA effects by blocking the ROS/NLRP3/IL-1β signaling pathway， downregulating NLRP3 inflammasome activation， and inhibiting the production of pro-inflammatory cytokines including TNF-α， IL-1β， and IL-6.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

Chronic obstructive pulmonary disease （COPD） is a chronic respiratory disease that poses a significant threat to global health， exhibiting high morbidity， disability and mortality rate， with its prevention and treatment situation becoming increasingly critical. The pathogenesis of COPD is complex， and the underlying cellular and molecular biological mechanisms remain incompletely elucidated. Programmed cell death （PCD） is the process wherein cells actively undergo demise to maintain internal environmental stability in response to certain signals or specific stimuli. Contemporary medical research indicates that the dysregulation of PCD patterns such as apoptosis， necroptosis， pyroptosis， autophagy， and ferroptosis is closely related to the onset and progression of COPD. Clarifying the molecular mechanisms of PCD in COPD may provide novel perspectives for in-depth understanding and prevention of the disease. Traditional Chinese medicine （TCM） is characterized by holistic regulation. In recent years， extensive research has been conducted in the TCM field focusing on modulating apoptosis， necroptosis， pyroptosis， autophagy， and ferroptosis for the treatment of COPD， yielding remarkable achievements. Therefore， this study systematically explored the molecular mechanism of PCD in COPD and reviewed the potential mechanisms and intervention status of TCM targeting PCD in COPD， aiming to provide insights and references for the clinical prevention， treatment and in-depth research of COPD.

Perimenopausal depression （PMD） is an affective disorder that occurs in women during the transition from sexual maturity to old age. It can induce various complications， such as insomnia and cognitive decline. The etiology of PMD is complex. Although multiple hypotheses have been proposed， there is still no unified theory that fully explains its pathogenesis. Research into its mechanisms relies heavily on animal experiments， and establishing reliable animal models is crucial for experimental studies. Appropriate animal models can better simulate human pathophysiological states， rapidly evaluate the efficacy and safety of drugs and intervention methods， grasp the essence of the disease， and uncover its intrinsic connections， thereby exploring more advanced intervention strategies. However， there is a lack of systematic review and summarization of literature related to model construction. Additionally， traditional Chinese medicine （TCM）， adhering to the principles of ''syndrome differentiation and treatment'' and ''holistic concept''， has shown significant efficacy in treating PMD. In recent years， research exploring and analyzing its therapeutic mechanisms has been increasing. Therefore， to gain a clearer and more comprehensive understanding of PMD animal modeling methods and the mechanisms of TCM， this paper reviewed Chinese and English literature on PMD animal models and mechanisms of TCM in PMD treatment. It summarized the construction methods of single-factor and multi-factor PMD models， and discussed the advantages and disadvantages of each modeling approach. Furthermore， it delved into the mechanisms of TCM intervention in PMD， revealing that TCM formulas primarily exert their effects by regulating the hypothalamic-pituitary-adrenal axis， hypothalamic-pituitary-ovarian axis， gut-brain axis， cell signaling pathways， neural circuits， hormone levels， and neurotransmitter levels. This review aims to provide a reference for future research in this field. In summary， by summarizing the progress in the methods for PMD animal model construction and the mechanisms of TCM， the paper seeks to offer new insights into the mechanistic research of TCM intervention in PMD.

Neurocritical care involves complex pathophysiological mechanisms, and its incidence is higher, injuries are more severe, and treatment is more challenging in high-altitude environments. This consensus, based on the latest domestic and international evidence-based medical data, establishes a standardized, goal-oriented framework for neurocritical care management applicable in high-altitude regions and nationwide. The consensus was developed following international standards for evidence quality assessment and underwent two rounds of Delphi expert consultation, resulting in 32 recommendation statements covering three parts: management systems, monitoring and assessment, and core strategies. Key updates include: advocating for the establishment of independent neurocritical care units and implementing precise tiered diagnosis and treatment based on the "Five Differences in Critical Care" concept; constructing a "trinity" multimodal brain monitoring system centered on cerebral blood flow, cerebral oxygenation, and brain function, emphasizing routine bedside transcranial Doppler ultrasound, cerebral oximetry, and continuous electroencephalography monitoring; shifting management strategies from mild hypothermia therapy to targeted temperature management, and defining the "446" target management pathway for the supercritical stage; emphasizing the assessment of static and dynamic cerebrovascular autoregulation functions through multimodal methods to achieve individualized optimal mean arterial pressure management; elevating cerebrospinal fluid management goals to the level of "glymphatic system" function maintenance; implementing a multidisciplinary collaborative, whole-process management model focusing on patients' long-term neurological functional outcomes; de-escalation criteria include multidimensional indicators such as recovery of brain structure, restoration of cerebrovascular autoregulation, improvement in cerebrospinal fluid dynamics, and reduction in biomarker levels; and integrating cutting-edge technologies like artificial intelligence into post-critical care management and rehabilitation planning. This consensus systematically integrates the entire process of neurocritical care management, reflecting the modern connotation of goal-oriented, dynamic, and multimodal integration in neurocritical care medicine. It aims to adapt to new trends such as deepening understanding of pathophysiological mechanisms, the integration of medicine and engineering, and the empowerment of artificial intelligence, thereby further advancing the discipline of critical care medicine.

With the rapid advancement of hemodynamic indices and monitoring technologies, their classification methods and application processes have become increasingly complex. Currently, no unified standard hasbeen established, making it difficult to fully meet the clinical requirements for hemodynamic management. To assist in hemodynamic monitoring assessment and therapeutic decision-making in critically ill patients, the Critical Hemodynamic Therapy Collaborative Group, in conjunction with the Critical Ultrasound Study Group, has jointly developed the Standard for the Application of Hemodynamic Monitoring Techniques in Critical Care. The first part of this standard systematically categorizes hemodynamic indicators into flow indicators, pressure and its derivative indicators, and tissue perfusion indicators, while elaborating on the clinical application of each. The second part establishes a standardized clinical implementation pathway for hemodynamic monitoring. It proposes a tiered monitoring strategy-comprising basic, advanced, indication-specific, and special scenario monitoring-tailored to different clinical settings. It emphasizes the central role of critical care ultrasound across all levels of monitoring and establishes hemodynamic assessment standards for organs such as the brain, kidneys, and gastrointestinal tract. This standard aims to provide a unified framework for clinical practice, teaching, training, and research in critical care medicine, thereby promoting standardized development within the discipline.

OBJECTIVE To investigate the effects of early continuous renal replacement therapy （CRRT） combined with nafamostat mesylate （NM） on clinical outcomes， safety， inflammatory reaction， and oxidative stress in patients with sepsis- associated acute kidney injury （SA-AKI）. METHODS Patients’ data were gathered from 153 cases admitted to the intensive care unit of the our hospital between January 2023 and January 2025， who initiated CRRT within 48 hours after being diagnosed with SA-AKI. These patients were divided into control group （75 cases） and observation group （78 cases） according to different anticoagulant drugs used during CRRT. After CRRT， control group was given sodium citrate， while observation group was given NM. The clinical outcomes [the duration of mechanical ventilation， length of stay in the intensive care unit （ICU）] as well as Acute Physiology and Chronic Health Evaluation Ⅱ （APACHE Ⅱ） score， Sequential Organ Failure Assessment （SOFA） score， renal function indexes [serum creatinine （Scr）， blood urea nitrogen （BUN）， cystatin C （CysC）]， inflammatory indexes [C-reactive protein （CRP）， procalcitonin （PCT）， interleukin-6 （IL-6）]， oxidative stress markers [malondialdehyde （MDA）， superoxide dismutase （SOD）， glutathione peroxidase （GSH-Px）] and the occurrence of adverse drug reactions before and after treatment were compared between the two groups. RESULTS After treatment， the observation group had significantly shorter mechanical ventilation duration and ICU length of stay compared to the control group （P＜0.05）. APACHE Ⅱ scores， SOFA scores， renal function indexes， inflammatory indexes and MDA levels of two groups were significantly lower than those before treatment within the same group （P＜0.05）， and the observation group were significantly lower than the control group （P＜0.05）. The levels of SOD and GSH-Px were significantly higher than those before treatment within the same group （P＜0.05）， and the observation group were significantly higher than the control group （P＜0.05）. There was no statistically significant difference in the overall incidence of adverse events between the two groups （P＞0.05）. CONCLUSIONS Compared with early CRRT combined with sodium citrate， early CRRT combined with NM can significantly improve renal function in patients with SA-AKI， alleviate the degree of inflammatory reaction and oxidative stress， shorten ICU stay length， and demonstrate favorable safety.

Based on the theory of "disease of both blood and water" in Essentials from the Golden Cabinet （《金匮要略》）， and in combination with the dynamic syndrome evolution of heart failure with preserved ejection fraction （HFpEF）， this paper systematically clarifies the pathomechanism of HFpEF， characterized by yang deficiency as the root， blood stasis as the pivotal factor and water retention as the manifestation. Accordingly， the therapeutic principles have been proposed， which are warming yang and banking up original qi to consolidate the root， activating blood and unblocking collaterals to smooth the mechanism， and promoting urination and regulating pivot to remove the branch. On this basis， a compound formula structure of "one monarch， one minister and one assistant" is established， forming an integrated intervention strategy that synergistically combines the three methods of warming yang， activating blood， and promoting urination through combined classical formulas. Zhenwu Decoction （真武汤）， which warms yang and dissolves rheum， is used to consolidate the root and directly target the source of yang deficiency， serving as the monarch； Guizhi Fuling Pills （桂枝茯苓丸）， which activates blood， promotes urination and unblocks the pivot， assists in interrupting the binding of blood stasis and water retention， serving as the minister； Tingli Dazao Xiefei Decoction （葶苈大枣泻肺汤）， which regulates qi， disperses retained fluids， and eliminates the manifestation， alleviates acute water-retention symptoms， serving as the assistant. This compound formula is warming without being drying， diuretic without being drastic， and dispels stasis without consuming blood， thereby achieving the therapeutic effects of warming yang， activating blood， and promoting urination.

Objective The aim of this study was to investigate the correlation between the interaction of uric acid and inflammatory factors and hyperuricemia in overweight/obese patients. Methods The personnel with hyperuricemia who underwent physical examination in our hospital from September 2021 to September 2022 were selected as the study subjects, and they were divided into 100 cases of overweight group and 90 cases of obese group according to the BMI index; 120 cases of healthy and non-hyperuricemic personnel were randomly selected as the control group; venous blood of the three groups was collected in 5 mL after 8 h of fasting, and were tested respectively for serum uric acid, lipid indexes and inflammatory factors: IL-6, IL-2, IFN-γ, TNF-α, IL-4, IL-10. Results Glucose, triglycerides, total cholesterol, and LDL were significantly higher in the obese group versus the overweight group (P<0.001), while HDL was significantly lower than the control group (P<0.001), and these changes were more pronounced in the obese group (P<0.001).The Pearson correlation coefficient pointed out that the levels of serum uric acid in patients with hyperuricosuric acid were significantly associated with the pro-inflammatory factors IL- 6, IL-2, IFN-γ, and TNF-α were significantly positively correlated (P<0.001), whereas they were significantly negatively correlated with the anti-inflammatory factors IL-4, IL-10 (P<0.001). Conclusion High uric acid levels in overweight/obese patients can cause enhanced inflammatory responses and reduced expression levels of anti-inflammatory factors, and the interaction between uric acid and pro-inflammatory factors aggravates the condition of patients with hyperuricemia.