AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

Patients with novel coronavirus pneumonia enter the recovery period after effective intervention,but the patients in the recovery period may then suffer from multi-system sequelae.Symptomatic treatment is considered as the primary method for the treatment of multi-system sequelae of novel coronavirus infection in modern medicine,and there are no specific effective therapies yet.In the view of traditional Chinese medicine(TCM),novel coronavirus pneumonia can be categorized as damp-toxin pestilence and cold-damp pestilence,and the multi-system sequelae of novel coronavirus pneumonia result from the lingering pathogens,which consume the yin fluid continuously and lead to the injury of kidney yin.Classical formulas of TCM are formulated excellently and exert definite efficacy which have been confirmed by long-term clinical experience.This paper reviewed the literature on the classical formulas of TCM in the treatment of sequelae of novel coronavirus pneumonia.It is concluded that chronic cough,pulmonary fibrosis,dyspnea are the common respiratory disorders associated with novel coronavirus pneumonia,and can be treated separately by Xiao Qinglong Decoction and Xiao Chaihu Decoction,by Maimendong Decoction,Buyang Huanwu Decoction and Bufei Decoction,and by Qianj in Weij ing Decoction for modification.Abdominal pain and diarrhea,and poor appetite are the common digestive disorders associated with novel coronavirus pneumonia,and can be treated separately by Chaihu Guizhi Ganj iang Decoction and Xiao Chaihu Decoction,and by Buzhong Yiqi Decoction and Yiwei Decoction for modification.Neurological headache,sleep disorders,and cognitive dysfunction are the common neurological disorders associated with novel coronavirus pneumonia,and can be treated separately by Guizhi Decoction plus Chuanxiong Cha Tiao Powder,Danggui Sini Decoction,Mahuang Decoction,Guizhi Decoction,Gegen Decoction,Wuzhuyu Decoction,Mahuang Fuzi Xixin Decoction and Lizhong Pills,by Suanzaoren Decoction and Sini Decoction plus Chai Gui Longgu Muli Decoction,and by Renshen Yangrong Decoction and Changpu Yuj in Decoction plus Didang Decoction for modification.Chest tightness and chest pain,and palpitation are the common circulatory disorders associated with novel coronavirus pneumonia,and can be treated separately by Wendan Decoction plus Danshen Decoction and Tao Hong Siwu Decoction,and Shen Fu Decoction plus Guizhi Gancao Longgu Muli Decoction,and by Guizhi Decoction plus Zhi Gancao Decoction and Shengmai Decoction,Shengmai Decoction plus Shengxian Decoction,Huangqi Shengmai Decoction plus Sanj ia Fumai Decoction,Li's Qingshu Yiqi Decoction plus Xue's Wuye Lugen Decoction,and Tao Hong Siwu Decoction plus Xuefu Zhuyu Decoction for modification.The effective formulas screened from the classical formulas of TCM for the treatment of sequelae of novel coronavirus pneumonia from will provide more choices for the treatment of multi-system sequelae after novel coronavirus pneumonia.

Intraoperative cell salvage (IOCS) has been widely applied as an important blood conservation measure in surgical operations. However, there is currently a lack of clinical practice guidelines for the implementation of IOCS in patients with malignant tumors. This report aims to provide clinicians with recommendations on the use of IOCS in patients with malignant tumors based on the review and assessment of the existed evidence. Data were derived from databases such as PubMed, Embase, the Cochrane Library and Wanfang. The guideline development team formulated recommendations based on the quality of evidence, balance of benefits and harms, patient preferences, and health economic assessments. This study constructed seven major clinical questions. The main conclusions of this guideline are as follows: 1) Compared with no perioperative allogeneic blood transfusion (NPABT), perioperative allogeneic blood transfusion (PABT) leads to a more unfavorable prognosis in cancer patients (Recommended); 2) Compared with the transfusion of allogeneic blood or no transfusion, IOCS does not lead to a more unfavorable prognosis in cancer patients (Recommended); 3) The implementation of IOCS in cancer patients is economically feasible (Recommended); 4) Leukocyte depletion filters (LDF) should be used when implementing IOCS in cancer patients (Strongly Recommended); 5) Irradiation treatment of autologous blood to be reinfused can be used when implementing IOCS in cancer patients (Recommended); 6) A careful assessment of the condition of cancer patients (meeting indications and excluding contraindications) should be conducted before implementing IOCS (Strongly Recommended); 7) Informed consent from cancer patients should be obtained when implementing IOCS, with a thorough pre-assessment of the patient's condition and the likelihood of blood loss, adherence to standardized internally audited management procedures, meeting corresponding conditions, and obtaining corresponding qualifications (Recommended). In brief, current evidence indicates that IOCS can be implemented for some malignant tumor patients who need allogeneic blood transfusion after physician full evaluation, and LDF or irradiation should be used during the implementation process.

[Objective] To explore the temperature parameters affecting the polybrene test and determine the optimal temperature conditions for detecting unexpected antibodies of the Rh system. [Methods] The reaction of IgG human anti-D antibody with different dilutions (undiluted, 1∶2, 1∶4, 1∶8, 1∶16, 1∶32，1∶64) with D antigen-positive red blood cells was detected by manual polybrene test (MPT). Different temperatures (25℃ and 37℃) were set, and the reaction time with low ionic medium was 4 minutes. The agglutination integral value of anti-D and red cell depolymerization time were compared to observe the effect of enhanced agglutination reaction, thereby establishing the test temperature reaction conditions for enhancing the MPT. The same reaction condition was applied to 36 blood samples containing unexpected antibodies of the Rh system, and the effect of enhanced MPT was observed in comparison with the polybrene method and the antiglobulin test (column agglutination). [Results] With all other conditions held constant, when low ionic medium was added, the incubation temperature of 25℃ and 37℃ resulted in different total agglutination integral values for anti-D (20.9±2.025 vs 25.5±2.635), and the comparison showed a significant difference (P<0.05). When the antibody dilution was 1∶16, the incubation temperature of 25℃ and 37℃ resulted in different agglutination integral values (3.9±0.738 vs 5.8±0.632), and the comparison showed a significant difference (P<0.05). Erythrocyte depolymerization time (62.8±8.149 vs 90.1±10.713) was significantly different (P<0.05). At a dilution of 1∶32, the incubation temperatures of 25℃ and 37℃ resulted in different agglutination integral values (2.5±0.527 vs 4.3±0.675), as well as different red blood cell dissociation times (35.4±7.792 vs 57.4±10.885)(P<0.05), and the comparison showed a significant difference (P<0.05), with no differences observed in the other groups. In the detection of 36 Rh system unexpected antibody samples, when the antibody titer was ≤2, the enhanced polybrene method had a higher positive rate, and when the antibody titer was ≥4, the detection rates of the three methods were consistent. [Conclusion] The reference temperature condition for the modified MPT is incubation at 37℃ for 4 min after the addition of low ionic medium. The application of this temperature condition to unexpected antibody samples of Rh system could achieve a significant enhancement effect, thereby increasing transfusion safety for the treatment of emergency patients, and is worth popularizing.

High-performance liquid chromatography(HPLC) was used to determine the content of three major components in Citri Reticulatae Semen(CRS), including limonin, nomilin, and obacunone. The chromaticity of the CRS sample during salt processing and stir-frying was measured using a color difference meter. Next, the relationship between the color and content of the salt-processed CRS sample was investigated through correlation analysis. By integrating the oil bath technique for processing simulation with HPLC, the changes in the relative content of nomilin and its transformation products were analyzed, with its structural transformation pattern during processing identified. Additionally, RAW264.7 cells were induced with lipopolysaccharides(LPSs) to establish an inflammatory model, and the anti-inflammatory activity of nomilin and its transformation product, namely obacunone was evaluated. The results indicated that as processing progressed, E~*ab and L~* values showed a downward trend; a~* values exhibited a slow increase over a certain period, followed by no significant changes, and b~* values remained stable with no significant changes over a certain period and then started to decrease. The limonin content remained barely unchanged; the nomilin content decreased, and the obacunone increased significantly. The changing trends in content and color parameters during salt-processing and stir-frying were basically consistent. The content of nomilin and obacunone was significantly correlated with the colorimetric values(L~*, a~*, b~*, and E~*ab), while limonin content showed no significant correlation with these values. By analyzing HPLC patterns of nomylin at different heating temperatures and time, it was found that under conditions of 200-250 ℃ for heating of 5-60 min, the content of nomilin significantly decreased, while the obacunone content increased pronouncedly. The in vitro anti-inflammatory activity results indicated that compared to the model group, the group with a high concentration of nomilin and the groups with varying concentrations of obacunone showed significantly reduced release of nitric oxide(NO)(P<0.01). When both were at the same concentration, obacunone showed better performance in inhibiting NO release. In this study, the obvious correlation between the color and content of major components during the processing of CRS samples was identified, and the dynamic patterns of quality change in CRS samples during processing were revealed. Additionally, the study revealed and confirmed the transformation of nomilin into obacunone during processing, with the in vitro anti-inflammatory activity of obacunone significantly greater than that of nomilin. These findings provided a scientific basis for CRS processing optimization, tablet quality control, and its clinical application.
Mice ; Animals ; Drugs, Chinese Herbal/pharmacology* ; RAW 264.7 Cells ; Limonins/chemistry* ; Chromatography, High Pressure Liquid ; Citrus/chemistry* ; Color ; Benzoxepins/chemistry* ; Anti-Inflammatory Agents/chemistry*

Guided by the concept of quality by design(QbD), this study optimizes the calcination and quenching process of calcined Magnetitum and establishes the XRD characteristic spectra of calcined Magnetitum, providing a scientific basis for the formulation of quality standards. Based on the processing methods and quality requirements of Magnetitum in the Chinese Pharmacopoeia, the critical process parameters(CPPs) identified were calcination temperature, calcination time, particle size, laying thickness, and the number of vinegar quenching cycles. The critical quality attributes(CQAs) included Fe mass fraction, Fe~(2+) dissolution, and surface color. The weight coefficients were determined by combining Analytic Hierarchy Process(AHP) and the criteria importance though intercrieria correlation(CRITIC) method, and the calcination process was optimized using orthogonal experimentation. Surface color was selected as a CQA, and based on the principle of color value, the surface color of calcined Magnetitum was objectively quantified. The vinegar quenching process was then optimized to determine the best processing conditions. X-ray diffraction(XRD) was used to establish the characteristic spectra of calcined Magnetitum, and methods such as similarity evaluation, cluster analysis, and orthogonal partial least squares-discriminant analysis(OPLS-DA) were used to evaluate the quality of the spectra. The optimized calcined Magnetitum preparation process was found to be calcination at 750 ℃ for 1 h, with a laying thickness of 4 cm, a particle size of 0.4-0.8 cm, and one vinegar quenching cycle(Magnetitum-vinegar ratio 10∶3), which was stable and feasible. The XRD characteristic spectra analysis method, featuring 9 common peaks as fingerprint information, was established. The average correlation coefficient ranged from 0.839 5-0.988 1, and the average angle cosine ranged from 0.914 4 to 0.995 6, indicating good similarity. Cluster analysis results showed that Magnetitum and calcined Magnetitum could be grouped together, with similar compositions. OPLS-DA discriminant analysis identified three key characteristic peaks, with Fe_2O_3 being the distinguishing component between the two. The final optimized processing method is stable and feasible, and the XRD characteristic spectra of calcined Magnetitum was initially established, providing a reference for subsequent quality control and the formulation of quality standards for calcined Magnetitum.
X-Ray Diffraction/methods* ; Drugs, Chinese Herbal/chemistry* ; Quality Control ; Particle Size

The prevalence of Class III malocclusion varies among different countries and regions. The populations from Southeast Asian countries (Chinese and Malaysian) showed the highest prevalence rate of 15.8%, which can seriously affect oral function, facial appearance, and mental health. As anterior crossbite tends to worsen with growth, early orthodontic treatment can harness growth potential to normalize maxillofacial development or reduce skeletal malformation severity, thereby reducing the difficulty and shortening the treatment cycle of later-stage treatment. This is beneficial for the physical and mental growth of children. Therefore, early orthodontic treatment for Class III malocclusion is particularly important. Determining the optimal timing for early orthodontic treatment requires a comprehensive assessment of clinical manifestations, dental age, and skeletal age, and can lead to better results with less effort. Currently, standardized treatment guidelines for early orthodontic treatment of Class III malocclusion are lacking. This review provides a comprehensive summary of the etiology, clinical manifestations, classification, and early orthodontic techniques for Class III malocclusion, along with systematic discussions on selecting early treatment plans. The purpose of this expert consensus is to standardize clinical practices and improve the treatment outcomes of Class III malocclusion through early orthodontic treatment.
Humans ; Malocclusion, Angle Class III/classification* ; Orthodontics, Corrective/methods* ; Consensus ; Child

Instrument separation is a critical complication during root canal therapy, impacting treatment success and long-term tooth preservation. The etiology of instrument separation is multifactorial, involving the intricate anatomy of the root canal system, instrument-related factors, and instrumentation techniques. Instrument separation can hinder thorough cleaning, shaping, and obturation of the root canal, posing challenges to successful treatment outcomes. Although retrieval of separated instrument is often feasible, it carries risks including perforation, excessive removal of tooth structure and root fractures. Effective management of separated instruments requires a comprehensive understanding of the contributing factors, meticulous preoperative assessment, and precise evaluation of the retrieval difficulty. The application of appropriate retrieval techniques is essential to minimize complications and optimize clinical outcomes. The current manuscript provides a framework for understanding the causes, risk factors, and clinical management principles of instrument separation. By integrating effective strategies, endodontists can enhance decision-making, improve endodontic treatment success and ensure the preservation of natural dentition.
Humans ; Root Canal Therapy/adverse effects* ; Consensus ; Root Canal Preparation/adverse effects*