AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

[Objective] To explore the temperature parameters affecting the polybrene test and determine the optimal temperature conditions for detecting unexpected antibodies of the Rh system. [Methods] The reaction of IgG human anti-D antibody with different dilutions (undiluted, 1∶2, 1∶4, 1∶8, 1∶16, 1∶32，1∶64) with D antigen-positive red blood cells was detected by manual polybrene test (MPT). Different temperatures (25℃ and 37℃) were set, and the reaction time with low ionic medium was 4 minutes. The agglutination integral value of anti-D and red cell depolymerization time were compared to observe the effect of enhanced agglutination reaction, thereby establishing the test temperature reaction conditions for enhancing the MPT. The same reaction condition was applied to 36 blood samples containing unexpected antibodies of the Rh system, and the effect of enhanced MPT was observed in comparison with the polybrene method and the antiglobulin test (column agglutination). [Results] With all other conditions held constant, when low ionic medium was added, the incubation temperature of 25℃ and 37℃ resulted in different total agglutination integral values for anti-D (20.9±2.025 vs 25.5±2.635), and the comparison showed a significant difference (P<0.05). When the antibody dilution was 1∶16, the incubation temperature of 25℃ and 37℃ resulted in different agglutination integral values (3.9±0.738 vs 5.8±0.632), and the comparison showed a significant difference (P<0.05). Erythrocyte depolymerization time (62.8±8.149 vs 90.1±10.713) was significantly different (P<0.05). At a dilution of 1∶32, the incubation temperatures of 25℃ and 37℃ resulted in different agglutination integral values (2.5±0.527 vs 4.3±0.675), as well as different red blood cell dissociation times (35.4±7.792 vs 57.4±10.885)(P<0.05), and the comparison showed a significant difference (P<0.05), with no differences observed in the other groups. In the detection of 36 Rh system unexpected antibody samples, when the antibody titer was ≤2, the enhanced polybrene method had a higher positive rate, and when the antibody titer was ≥4, the detection rates of the three methods were consistent. [Conclusion] The reference temperature condition for the modified MPT is incubation at 37℃ for 4 min after the addition of low ionic medium. The application of this temperature condition to unexpected antibody samples of Rh system could achieve a significant enhancement effect, thereby increasing transfusion safety for the treatment of emergency patients, and is worth popularizing.

Intraoperative cell salvage (IOCS) has been widely applied as an important blood conservation measure in surgical operations. However, there is currently a lack of clinical practice guidelines for the implementation of IOCS in patients with malignant tumors. This report aims to provide clinicians with recommendations on the use of IOCS in patients with malignant tumors based on the review and assessment of the existed evidence. Data were derived from databases such as PubMed, Embase, the Cochrane Library and Wanfang. The guideline development team formulated recommendations based on the quality of evidence, balance of benefits and harms, patient preferences, and health economic assessments. This study constructed seven major clinical questions. The main conclusions of this guideline are as follows: 1) Compared with no perioperative allogeneic blood transfusion (NPABT), perioperative allogeneic blood transfusion (PABT) leads to a more unfavorable prognosis in cancer patients (Recommended); 2) Compared with the transfusion of allogeneic blood or no transfusion, IOCS does not lead to a more unfavorable prognosis in cancer patients (Recommended); 3) The implementation of IOCS in cancer patients is economically feasible (Recommended); 4) Leukocyte depletion filters (LDF) should be used when implementing IOCS in cancer patients (Strongly Recommended); 5) Irradiation treatment of autologous blood to be reinfused can be used when implementing IOCS in cancer patients (Recommended); 6) A careful assessment of the condition of cancer patients (meeting indications and excluding contraindications) should be conducted before implementing IOCS (Strongly Recommended); 7) Informed consent from cancer patients should be obtained when implementing IOCS, with a thorough pre-assessment of the patient's condition and the likelihood of blood loss, adherence to standardized internally audited management procedures, meeting corresponding conditions, and obtaining corresponding qualifications (Recommended). In brief, current evidence indicates that IOCS can be implemented for some malignant tumor patients who need allogeneic blood transfusion after physician full evaluation, and LDF or irradiation should be used during the implementation process.

OBJECTIVE: To explore clinical efficacy of tibial transverse transport (TTT) combined with debridement in treating necrotizing fasciitis of the lower extremities. METHODS: A retrospective analysis was conducted on 31 patients with necrotizing fasciitis of the lower extremities who were treated with TTT from January 2021 to October 2023, including 28 males and 3 females, aged from 44 to 76 years old with an average of (57.58±8.79) years old. In-hospital mortality rate, amputation rate, length of hospital stay, hospitalization cost, number of surgeries, and inflammatory indicators before and after operation (white blood cells, hemoglobin, C-reactive protein, albumin), as well as wound healing and daily living ability were observed and compared. RESULTS: All 31 patients were followed up for 3 to 12 months with an average of (6.61±2.46) months. All patients' wounds healed without recurrence. The wound healing time was (4.96±2.61) months, amputation rate of 31 patients was 3.22% (1/31), in-hospital mortality rate was 0%, the length of hospital stay was (27.10±24.51) days, the hospitalization cost was (107, 300 ± 83, 300) yuan, and the number of surgeries was (3.26±1.93) times. White blood cells, C-reactive protein and albumin before operation were (13.41±5.54) ×10⁹/L, (136.67±73.50) mg·L^-1 and (25.92±5.59) g·L^-11 respectively, and improved to (11.05±3.65) ×10⁹/L, (79.91±51.40) mg·L^-1, and (30.31±4.02) g·L^-1 at 2 weeks after operation, and the differences were statistically significant (P<0.05);there was no statistically significant difference in hemoglobin before and after operation (P>0.05). At the latest follow-up, 16 patients were able to take care of themselves, 12 patients were partially self-sufficient, and 3 patients were completely unable to take care of themselves. CONCLUSION TTT with debridement could achieve satisfactory clinical efficacy in treating necrotizing fasciitis of the lower extremities.
Humans ; Male ; Female ; Middle Aged ; Aged ; Adult ; Fasciitis, Necrotizing/mortality* ; Retrospective Studies ; Debridement ; Lower Extremity/surgery* ; Tibia/surgery*

OBJECTIVES: To evaluate the efficacy and safety of avatrombopag in promoting platelet engraftment after allogeneic hematopoietic stem cell transplantation (allo-HSCT) in children, compared with recombinant human thrombopoietin (rhTPO). METHODS: A retrospective analysis was conducted on 53 pediatric patients who underwent allo-HSCT at the Institute of Hematology and Blood Diseases Hospital, Chinese Academy of Medical Sciences from April 2023 to August 2024. Based on medications used during the periengraftment period, patients were divided into two groups: the avatrombopag group (n=15) and the rhTPO group (n=38). RESULTS: At days 14, 30, and 60 post-transplant, platelet engraftment was achieved in 20% (3/15), 60% (9/15), and 93% (14/15) of patients in the avatrombopag group, and in 39% (15/38), 82% (31/38), and 97% (37/38) in the rhTPO group, respectively. There were no significant differences between the two groups in platelet engraftment rates at each time point, cumulative incidence of platelet engraftment, overall survival, and relapse-free survival (all P>0.05). Multivariable Cox proportional hazards analysis indicated that acute graft-versus-host disease was an independent risk factor for delayed platelet engraftment (P=0.043). CONCLUSIONS In children undergoing allo-HSCT, avatrombopag effectively promotes platelet engraftment, with efficacy and safety comparable to rhTPO, and represents a viable therapeutic option.
Humans ; Retrospective Studies ; Hematopoietic Stem Cell Transplantation/adverse effects* ; Male ; Female ; Child ; Child, Preschool ; Infant ; Adolescent ; Transplantation, Homologous ; Blood Platelets/drug effects* ; Thiazoles/therapeutic use* ; Thrombopoietin/therapeutic use* ; Thiophenes

Objective:To explore the factors influencing adherence to voice therapy among patients with voice disorders in China. Methods:Patients with voice disorders who visited the Voice Therapy Center at Sun Yat-sen Memorial Hospital, Sun Yat-sen University, from February to May 2022 were enrolled in the study. Adherence was assessed using the URICA-Voice scale, while influencing factors were assessed through the Voice Handicap Index（VHI） scale and a general information questionnaire. Correlation analysis was conducted using univariate and multivariate logistic regression analysis. Results:A total of 247 patients were included in the study, comprising 57 males（23.08%） and 190 females（76.92%）. The results revealed that: ①Female patients demonstrated higher likelihood of being in the contemplation stage（OR=0.22） compared to males. ②Patients with a monthly family income per capita>6 000 yuan were more likely to be in the contemplation stage than those with<3 000 yuan with an OR = 13.94. ③High vocal-demand occupations increased contemplation stage probability（OR=7.70） compared to moderate-demand occupations. ④Residence within 30-minute commute predicted action/maintenance stages（OR=7.14） versus≥60-minute commute. ⑤Patients whose occupations had high voice demands were more likely to be in the action and maintenance stages than those with average voice demands, with an OR of 16.20. Conclusion:Gender, monthly family income per capita, occupational voice demands, and distance to the hospital significantly impact the URICA-Voice compliance stages of patients. Patients who are female, have higher family income, have occupations with high voice demands, and live closer to the hospital exhibit higher compliance with voice training.
Humans ; Male ; Female ; Voice Disorders/therapy* ; Patient Compliance ; Voice Training ; Surveys and Questionnaires ; China ; Middle Aged ; Adult ; Voice Quality ; Logistic Models ; Aged

Objective:To compare the efficacy of gasless robotic surgery via transaxillary approach and combined axillary-retroauricular approach for unilateral N1b PTC, and to explore the safety and effectiveness of gasless robotic surgery via transaxillary approach for unilateral N1b PTC. Methods:Unilateral N1b PTC patients who underwent surgery in the Department of Otolaryngology, Sun Yat Sen Memorial Hospital, Sun Yat sen University between July 2016 and December 2024 were included and analyzed. According to the inclusion and exclusion criteria and the differences of surgical approaches, the patients were divided into the transaxillary approach（TA） group and the combined axillary-retroauricular approach（TARA） group. The demographic data, operation time, intraoperative blood loss, postoperative drainage volume, postoperative complications, shoulder function evaluation, postoperative visual analogue scale（VAS） of neck aesthetics and recurrence of the two groups were statistically analyzed. Results:A total of 88 patients undergoing gasless robotic surgery were included in this study, including 23 cases in the TA group and 65 cases in the TARA group. The proportion of males in the TA group was significantly higher than that in the TARA group（56.5% vs 21.5%, χ²=9.776, P=0.002）. The total operation time in the TA group was significantly lower than that in the TARA Group（180.00[155.00, 220.00]min vs 220.00[177.50, 272.50]min, z=-2.775, P=0.006）, and the postoperative blood loss in the TA group was significantly lower than that in the TARA Group（30.00[20.00, 50.00]ml vs 50.00[30.00, 60.00]ml, Z=-2.127, P=0.033）. The proportion of area Ⅱ-Ⅴ in the TA group and the TARA group was 87.0% and 70.8%, respectively, and there was no significant difference between the two groups（P>0.05）. There was no significant difference in lateral cervical lymph node dissection and central lymph node dissection between the two groups（P>0.05）. During the follow-up period, no recurrence was found in the two groups, and there was no significant difference in the incidence of complications between the two groups（P>0.05）. According to the stratification of dynamic recurrence risk assessment, it can be seen that the proportion of curative effect satisfaction in the TA group was as high as 95.7%, and that in the TARA group was as high as 81.5%, with no significant difference between the two groups. There was no significant difference in VAS score of neck, Constant Shoulder Score and NDⅡ scale between the two groups（P>0.05）. Conclusion:Gasless robotic surgery via transaxillary approach for unilateral N1b PTC is safe and feasible, and the amount postoperative lymph node acquisition is equivalent to that of combined axillary-retroauricular approach, which can provide a new choice for the treatment of unilateral N1b PTC patients.
Humans ; Robotic Surgical Procedures/methods* ; Axilla/surgery* ; Male ; Female ; Operative Time ; Middle Aged ; Adult ; Treatment Outcome ; Postoperative Complications

ObjectiveTo investigate the effect and mechanism of Polygonatum neutral polysaccharides from sibiricum （PSP-NP） on colon injury in mice with chronic obstructive pulmonary disease （COPD）. MethodsMale C57BL/6J mice were randomly divided into a control group， a COPD model group， and a PSP-NP group. The COPD model was established using smoke exposure combined with intranasal LPS administration. The PSP-NP group was simultaneously treated daily with 200 mg/kg of PSP-NP via intragastric gavage， while the other groups received an equal volume of saline. HE staining was used to observe the pathological changes in the colon. ELISA was employed to detect the levels of LPS in serum and the expressions of ZO-1， Occludin， IL-6， and TNF-α in colon tissue. UPLC-MS was used to detect the types and contents of bile acids in colonic content， and to screen for differential bile acids. Differential microbial flora were identified using 16S rRNA gene sequencing， and correlation analysis was conducted with differential bile acids. PSP-NP was combined with the differential bile acids cholic acid （CA）， and deoxycholic acid （DCA） in vitro to analyze the binding capacity of PSP-NP for CA and DCA. PSP-NP was applied to NCM460 normal colonic epithelial cells cultured in CA and DCA. Cell migration ability was assessed using the scratch assay， and the mRNA expression levels of inflammatory cytokines TNF-α， IL-6， and NF-κB were measured by RT-qPCR. ResultsPSP-NP effectively improved colonic damage in COPD model mice， enhanced mechanical barrier function， alleviated inflammatory response， and regulated abnormal changes in colonic flora and bile acid metabolism. Correlation analysis further revealed that PSP-NP regulated colonic bile acid metabolism and reduced the redundancy of secondary bile acids by increasing the relative abundance of Bacteroidota， Verrucomicrobiota， Bacteroides， and Akkermansia， while decreasing the relative abundance of Lactobacillus and Bifidobacterium. Notably， in vitro binding assays demonstrated that PSP-NP bound to differential bile acids DCA and CA， with the strongest binding capacity for DCA at 58.2%. In cellular functional studies， DCA inhibited the migration ability of colonic epithelial cells NCM460 and significantly increased the relative mRNA expression levels of inflammatory factors TNF-α， IL-6， and NF-κB. Importantly， co-treatment with PSP-NP significantly ameliorated the impact of DCA on NCM460 cells. ConclusionsPSP-NP may significantly improve colonic damage in COPD model mice. The mechanism may involve the regulation of colonic bile acid metabolism and bile acid profiles through both microbial modulation and direct binding， thereby reducing the damage caused by secondary bile acids such as DCA to colonic epithelial cells.