1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Yimei Baijiang Formula Treats Colitis-associated Colorectal Cancer in Mice via NF-κB Signaling Pathway
Qian WU ; Xin ZOU ; Chaoli JIANG ; Long ZHAO ; Hui CHEN ; Li LI ; Zhi LI ; Jianqin LIU
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(3):119-130
ObjectiveTo explore the effects of Yimei Baijiang formula (YMBJF) on colitis-associated colorectal cancer (CAC) and the nuclear factor kappaB (NF-κB) signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups: Normal, model, capecitabine (0.83 g
3.Yimei Baijiang Formula Treats Colitis-associated Colorectal Cancer in Mice via NF-κB Signaling Pathway
Qian WU ; Xin ZOU ; Chaoli JIANG ; Long ZHAO ; Hui CHEN ; Li LI ; Zhi LI ; Jianqin LIU
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(3):119-130
ObjectiveTo explore the effects of Yimei Baijiang formula (YMBJF) on colitis-associated colorectal cancer (CAC) and the nuclear factor kappaB (NF-κB) signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups: Normal, model, capecitabine (0.83 g
4.Polygonatum Sibiricum Polysaccharides Improve Colonic Injury in a Mouse Model of Chronic Obstructive Pulmonary Disease by Regulating Bile Acid Metabolism in the Colon
Wanrong LI ; Mengting TAO ; Yuanfeng ZOU ; Dan HE ; Nengyuan TANG ; Xin TAN ; Lixia LI ; Dandan CHEN
Journal of Sun Yat-sen University(Medical Sciences) 2025;46(3):431-443
ObjectiveTo investigate the effect and mechanism of Polygonatum neutral polysaccharides from sibiricum (PSP-NP) on colon injury in mice with chronic obstructive pulmonary disease (COPD). MethodsMale C57BL/6J mice were randomly divided into a control group, a COPD model group, and a PSP-NP group. The COPD model was established using smoke exposure combined with intranasal LPS administration. The PSP-NP group was simultaneously treated daily with 200 mg/kg of PSP-NP via intragastric gavage, while the other groups received an equal volume of saline. HE staining was used to observe the pathological changes in the colon. ELISA was employed to detect the levels of LPS in serum and the expressions of ZO-1, Occludin, IL-6, and TNF-α in colon tissue. UPLC-MS was used to detect the types and contents of bile acids in colonic content, and to screen for differential bile acids. Differential microbial flora were identified using 16S rRNA gene sequencing, and correlation analysis was conducted with differential bile acids. PSP-NP was combined with the differential bile acids cholic acid (CA), and deoxycholic acid (DCA) in vitro to analyze the binding capacity of PSP-NP for CA and DCA. PSP-NP was applied to NCM460 normal colonic epithelial cells cultured in CA and DCA. Cell migration ability was assessed using the scratch assay, and the mRNA expression levels of inflammatory cytokines TNF-α, IL-6, and NF-κB were measured by RT-qPCR. ResultsPSP-NP effectively improved colonic damage in COPD model mice, enhanced mechanical barrier function, alleviated inflammatory response, and regulated abnormal changes in colonic flora and bile acid metabolism. Correlation analysis further revealed that PSP-NP regulated colonic bile acid metabolism and reduced the redundancy of secondary bile acids by increasing the relative abundance of Bacteroidota, Verrucomicrobiota, Bacteroides, and Akkermansia, while decreasing the relative abundance of Lactobacillus and Bifidobacterium. Notably, in vitro binding assays demonstrated that PSP-NP bound to differential bile acids DCA and CA, with the strongest binding capacity for DCA at 58.2%. In cellular functional studies, DCA inhibited the migration ability of colonic epithelial cells NCM460 and significantly increased the relative mRNA expression levels of inflammatory factors TNF-α, IL-6, and NF-κB. Importantly, co-treatment with PSP-NP significantly ameliorated the impact of DCA on NCM460 cells. ConclusionsPSP-NP may significantly improve colonic damage in COPD model mice. The mechanism may involve the regulation of colonic bile acid metabolism and bile acid profiles through both microbial modulation and direct binding, thereby reducing the damage caused by secondary bile acids such as DCA to colonic epithelial cells.
5.Threshold of kurtosis on occupational hearing loss associated with non-steady noise
Yang LI ; Haiying LIU ; Linjie WU ; Jinzhe LI ; Jiarui XIN ; Hua ZOU ; Xin SUN ; Wei QIU ; Changyan YU ; Meibian ZHANG
Journal of Environmental and Occupational Medicine 2025;42(7):779-785
Background Kurtosis reflecting noise's temporal structure is an effective metric for evaluating noise-induced hearing loss (NIHL), and its threshold is still unclear. Objective To explore the energy range of kurtosis and the threshold of NIHL induced by kurtosis in this energy rangeMethods Using cross-sectional design,
6.Roles of A- and C-weighted kurtosis adjustment for equivalent sound level in evaluating occupational hearing loss
Haiying LIU ; Linjie WU ; Yang LI ; Jinzhe LI ; Jiarui XIN ; Hua ZOU ; Wei QIU ; Tong SHEN ; Meibian ZHANG
Journal of Environmental and Occupational Medicine 2025;42(7):793-799
Background Temporal kurtosis (without frequency weighting, i.e., Z-weighted kurtosis) can evaluate noise-induced hearing loss (NIHL). However, few studies have considered the function of frequency weighting (A- or C-weighted) kurtosis on NIHL. Objective To study the significance of A- and C-weighted kurtosis adjustment for equivalent sound level (L'EX,8 h) in evaluating occupational hearing loss. Methods A cross-sectional survey was used to select 973 noise-exposed workers in seven industries as the subjects. The noise exposure of all workers was assessed by distributions of A-, C-, and Z-weighted kurtosis (e.g., KA, KC, and KZ) and respective adjusted equivalent sound level (e.g., L'EX,8 h-KA, L'EX,8 h-KC, and L'EX,8 h-KZ). The significance of A- and C-weighted kurtosis in evaluating NIHL was evaluated by correlations between three types of L'EX,8 h and NIHL, and improvement of noise-induced permanent threshold shift (NIPTS) underestimation predicted by the ISO prediction model (Acoustics—Estimation of noise-induced hearing loss, ISO 1999-2013). Results The median KA, KC, and KZ were 68.33, 28.22, and 19.82, respectively. The binary logistic regression showed that LEX, 8 h-KA, LEX, 8 h-KC, and L'EX, 8 h-KZ were risk factors for NIHL (OR>1, P<0.001). The receiver operating characteristic (ROC) curve showed that when the outcome variable was noise-induced hearing impairment (NIHI), the areas under the curves corresponding to L'EX,8 h-KA, L'EX,8 h-KC, and L'EX,8 h-KZ were 0.625, 0.628, and 0.625, respectively. When the outcome variable was high-frequency noise-induced hearing loss (HFNIHL), the areas under the curves corresponding to L'EX,8 h-KA, L'EX, 8 h-KC, and L'EX,8 h-KZ were 0.624, 0.623, and 0.622, respectively (P<0.05). The order of underestimation improvement values predicted by L'EX,8 h for NIPTS1234 was: L'EX,8 h-KA (4.68 dB HL)>L'EX,8 h-KC (4.38 dB HL)>L'EX,8 h-KZ (4.28 dB HL) (P<0.001). The order of underestimation improvement values predicted by L'EX,8 h-K for NIPTS346 was: L'EX,8 h-KA (7.20 dB HL)>L'EX,8 h-KC (6.83 dB HL)>L'EX,8 h-KZ (6.71 dB HL) (P<0.001). Conclusion The adjustment of A- and C-weighted kurtosis to equivalent sound level LEX,8 h can effectively improve the accuracy of the ISO 1999 prediction model in NIPTS prediction, and compared with the C-weighted, the A-weighted kurtosis can improve the result of the ISO 1999 prediction model in terms of underestimating NIPTS.
7.Effects of fractionated low-dose ionizing radiation on differentially expressed genes in ferroptosis of human bronchial epithelial cells
Min ZHANG ; Lingyu ZHANG ; Yashi CAI ; Huixian LI ; Yanting CHEN ; Guanyou CHEN ; Xin LAN ; Changyong WEN ; Weixu HUANG ; Jianming ZOU ; Huifeng CHEN
Chinese Journal of Radiological Health 2025;34(3):310-317
Objective To investigate the effects of fractionated low-dose ionizing radiation (LDIR) on the ferroptosis in human bronchial epithelial (HBE) cells as well as the associated differentially expressed genes (DEGs), biological processes, and signaling pathways. Methods HBE cells were exposed to different single doses of X-ray irradiation (0, 25, 50, 75, and 100 mGy) for 24, 48, and 72 h, respectively. The change in cell viability was detected by MTT assay. Cells were irradiated with 0, 25, 50, and 100 mGy X-rays 5 times, with 48 h between each irradiation and a dose rate of 50 mGy/min. Cells were harvested 24 h after irradiation for the measurement of the expression of ferroptosis-related genes SLC7A11 and GPX4 at the mRNA and protein levels, cellular iron content, and the expression of FTH1 and FTL mRNAs. High-throughput sequencing was used to screen for the DEGs in each dose group, followed by Gene Ontology-Biological Process (GO-BP) analysis, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, and Gene Set Enrichment Analysis (GSEA). Results Compared with the control group, single-dose LDIR significantly increased cell proliferation at 75 mGy after 24 h (P < 0.05), at 50, 75, and 100 mGy after 48 h (P < 0.05), and at 75 and 100 mGy after 72 h (P < 0.05). Compared with the control group, at the end of the fifth fractionated LDIR, SLC7A11 and GPX4 mRNAs decreased at all doses (P < 0.05), SLC7A11 protein decreased at all doses, GPX4 protein decreased at 25 and 100 mGy, iron content increased at all doses, and FTH1 and FTL mRNAs decreased at all doses (P< 0.05). Sequencing analysis identified 248, 30, and 291 DEGs and 10, 2, and 9 ferroptosis-associated genes at the three doses compared to the control. Gene Ontology-Biological Process analysis showed that DEGs were mainly enriched in biological processes such as response to lipids, cell death, and response to unfolded proteins. Kyoto Encyclopedia of Genes and Genomes analysis showed that DEGs were mainly enriched in the JAK-STAT signaling pathway, lipids and atherosclerosis, ferroptosis, protein processing in the endoplasmic reticulum, and FoxO signaling pathway. Gene set enrichment analysis showed that DEGs were mainly enriched in ferroptosis, fatty acid degradation, and glutathione metabolism. Conclusion Fractionated low-dose radiation induced ferroptosis in HBE cells, and DEGs were predominantly enriched in biological processes and signaling pathways related to inflammation, ferroptosis, and endoplasmic reticulum stress.
8.Association between long-term exposure to low-dose ionizing radiation and metabolic syndrome among medical radiologists
Changyong WEN ; Xiaoman ZHOU ; Xiaolian LIU ; Yiqing LIAN ; Weizhen GUO ; Yanting CHEN ; Xin LAN ; Mingfang LI ; Sufen ZHANG ; Weixu HUANG ; Jianming ZOU ; Huifeng CHEN
Journal of Environmental and Occupational Medicine 2025;42(10):1209-1215
Background In recent years, the increasingly widespread application of nuclear and medical radiation technologies has resulted in a large number of occupational populations exposed to low-dose ionizing radiation (LDIR). At present, there is no consistent conclusion on the effects of long-term exposure to LDIR on the metabolic health of the occupational population. Objective To explore the association between long-term exposure to LDIR and metabolic syndrome (MetS) among medical radiologists. Methods A cross-sectional study was conducted to enroll
9.Effects of low-dose fractionated X-ray radiation on the senescence of L02 hepatocytes
Xin LAN ; Lina CAI ; Lingyu ZHANG ; Yashi CAI ; Linqian ZHOU ; Weiyi KE ; Weixu HUANG ; Jianming ZOU ; Huifeng CHEN
Chinese Journal of Radiological Health 2025;34(5):672-678
Objective To investigate the induction of senescence in L02 hepatocytes by low-dose fractionated X-ray radiation and its effects on oxidative stress, oxidative damage, and nuclear factor-κB (NF-κB) pathway protein levels. Methods L02 cells were subjected to fractionated X-ray irradiation at doses of 0.1, 0.2, and 0.5 Gy per fraction for a total of six fractions. Assays were performed 24 hours after the final irradiation. Measurements included SA-β-gal staining, the mRNAs of senescence-related genes p53 and p21 and their encoded proteins, mRNAs of genes encoding senescence-associated secretory phenotype factors (IL-6, IL-8, GM-CSF, MMP-15), reactive oxygen species, oxidative and anti-oxidative markers (malondialdehyde, glutathione, superoxide dismutase), DNA oxidative damage markers (8-OHdG and γ-H2AX), and NF-κB pathway protein levels. Results Compared with the control group, at 24 hours after the end of six irradiations, the number of cells positive in SA-β-gal staining was significantly increased in all dose groups. The mRNA and protein levels of p21 and p53 were significantly elevated in the 0.2 Gy × 6 and 0.5 Gy × 6 groups (P < 0.05). The mRNA levels of genes encoding IL-6, GM-CSF, and MMP-15 were significantly increased in all dose groups (P < 0.05). The mRNA levels of the gene encoding IL-8 were significantly increased in the 0.2 Gy × 6 and 0.5 Gy × 6 groups (P < 0.05). The levels of reactive oxygen species, malondialdehyde, and glutathione were significantly increased in all dose groups (P < 0.01). The level of superoxide dismutase was significantly increased in the 0.5 Gy × 6 group (P < 0.01). The levels of 8-OHdG were significantly increased in all dose groups (P < 0.05). In both the 0.2 Gy × 6 and 0.5 Gy × 6 groups, the expression levels of γ-H2AX and p-NF-κB p65 were significantly increased (P < 0.05), and the levels of IκBα were significantly decreased (P < 0.05). Conclusion Low-dose fractionated X-ray radiation can induce senescence and cause alterations in oxidative stress, oxidative damage, and the levels of NF-κB pathway proteins in L02 hepatocytes.
10.Inhibitory effect of β-elemonic acid on proliferation and invasion of colon cancer cell lines
Ting SUN ; Teng ZOU ; Yisong YANG ; Shuangping LIU ; Xin REN ; Dan WANG
Basic & Clinical Medicine 2025;45(6):748-754
Objective To investigate the inhibitory effect of β-elemonic acid(β-EA)on the proliferation and inva-sion of colon cancer cells and the underlying mechanisms through PI3K/AKT/mTOR signaling pathway.Methods The effects of β-EA on colon cancer cell proliferation were evaluated using the MTT assay and colony formation as-say.Transwell invasion assay were used to assess the impact of β-EA on invasion.Western blot analysis was con-ducted to detect changes in PI3K/AKT/mTOR pathway proteins after treatment.Results MTT assay showed thatβ-EA effectively inhibited the proliferation of colon cancer HCT8 and HCT116 cells in a dose-dependent manner.The colony formation assay confirmed its inhibitory effect on cell proliferation.Transwell invasion assays demonstra-ted that β-elemonic acid reduced the invasion abilities of the cells.Western blot analysis revealed increased expression of apoptosis-related proteins cleaved-caspase 3,cleaved-caspase 9,and Bax,while Bcl-2 expression was decreased.Invasion-related proteins vimentin,snail,MMP2,and MMP9 were downregulated after treatment.Addi-tionally,β-EAA reduced the levels of p-PI3K,p-Akt,and p-mTOR,and these reductions were more pronounced af-ter the addition of the PI3K inhibitor LY294002.Conclusions β-EA may inhibit proliferation and invasion in colon cancer cell lines HCT8 and HCT116 through PI3K/AKT/mTOR signaling pathway,and potentially be transformed as a novel therapeutic agent for colon cancer.

Result Analysis
Print
Save
E-mail