1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Yimei Baijiang Formula Treats Colitis-associated Colorectal Cancer in Mice via NF-κB Signaling Pathway
Qian WU ; Xin ZOU ; Chaoli JIANG ; Long ZHAO ; Hui CHEN ; Li LI ; Zhi LI ; Jianqin LIU
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(3):119-130
ObjectiveTo explore the effects of Yimei Baijiang formula (YMBJF) on colitis-associated colorectal cancer (CAC) and the nuclear factor kappaB (NF-κB) signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups: Normal, model, capecitabine (0.83 g
3.Yimei Baijiang Formula Treats Colitis-associated Colorectal Cancer in Mice via NF-κB Signaling Pathway
Qian WU ; Xin ZOU ; Chaoli JIANG ; Long ZHAO ; Hui CHEN ; Li LI ; Zhi LI ; Jianqin LIU
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(3):119-130
ObjectiveTo explore the effects of Yimei Baijiang formula (YMBJF) on colitis-associated colorectal cancer (CAC) and the nuclear factor kappaB (NF-κB) signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups: Normal, model, capecitabine (0.83 g
4.Optimization of temperature parameters for screening unexpected antibodies in Rh system by manual polybrene test
Xin ZOU ; Minjie CHEN ; Sifei MA ; Hongmei YANG
Chinese Journal of Blood Transfusion 2025;38(1):97-100
[Objective] To explore the temperature parameters affecting the polybrene test and determine the optimal temperature conditions for detecting unexpected antibodies of the Rh system. [Methods] The reaction of IgG human anti-D antibody with different dilutions (undiluted, 1∶2, 1∶4, 1∶8, 1∶16, 1∶32,1∶64) with D antigen-positive red blood cells was detected by manual polybrene test (MPT). Different temperatures (25℃ and 37℃) were set, and the reaction time with low ionic medium was 4 minutes. The agglutination integral value of anti-D and red cell depolymerization time were compared to observe the effect of enhanced agglutination reaction, thereby establishing the test temperature reaction conditions for enhancing the MPT. The same reaction condition was applied to 36 blood samples containing unexpected antibodies of the Rh system, and the effect of enhanced MPT was observed in comparison with the polybrene method and the antiglobulin test (column agglutination). [Results] With all other conditions held constant, when low ionic medium was added, the incubation temperature of 25℃ and 37℃ resulted in different total agglutination integral values for anti-D (20.9±2.025 vs 25.5±2.635), and the comparison showed a significant difference (P<0.05). When the antibody dilution was 1∶16, the incubation temperature of 25℃ and 37℃ resulted in different agglutination integral values (3.9±0.738 vs 5.8±0.632), and the comparison showed a significant difference (P<0.05). Erythrocyte depolymerization time (62.8±8.149 vs 90.1±10.713) was significantly different (P<0.05). At a dilution of 1∶32, the incubation temperatures of 25℃ and 37℃ resulted in different agglutination integral values (2.5±0.527 vs 4.3±0.675), as well as different red blood cell dissociation times (35.4±7.792 vs 57.4±10.885)(P<0.05), and the comparison showed a significant difference (P<0.05), with no differences observed in the other groups. In the detection of 36 Rh system unexpected antibody samples, when the antibody titer was ≤2, the enhanced polybrene method had a higher positive rate, and when the antibody titer was ≥4, the detection rates of the three methods were consistent. [Conclusion] The reference temperature condition for the modified MPT is incubation at 37℃ for 4 min after the addition of low ionic medium. The application of this temperature condition to unexpected antibody samples of Rh system could achieve a significant enhancement effect, thereby increasing transfusion safety for the treatment of emergency patients, and is worth popularizing.
5.Clinical practice guidelines for intraoperative cell salvage in patients with malignant tumors
Changtai ZHU ; Ling LI ; Zhiqiang LI ; Xinjian WAN ; Shiyao CHEN ; Jian PAN ; Yi ZHANG ; Xiang REN ; Kun HAN ; Feng ZOU ; Aiqing WEN ; Ruiming RONG ; Rong XIA ; Baohua QIAN ; Xin MA
Chinese Journal of Blood Transfusion 2025;38(2):149-167
Intraoperative cell salvage (IOCS) has been widely applied as an important blood conservation measure in surgical operations. However, there is currently a lack of clinical practice guidelines for the implementation of IOCS in patients with malignant tumors. This report aims to provide clinicians with recommendations on the use of IOCS in patients with malignant tumors based on the review and assessment of the existed evidence. Data were derived from databases such as PubMed, Embase, the Cochrane Library and Wanfang. The guideline development team formulated recommendations based on the quality of evidence, balance of benefits and harms, patient preferences, and health economic assessments. This study constructed seven major clinical questions. The main conclusions of this guideline are as follows: 1) Compared with no perioperative allogeneic blood transfusion (NPABT), perioperative allogeneic blood transfusion (PABT) leads to a more unfavorable prognosis in cancer patients (Recommended); 2) Compared with the transfusion of allogeneic blood or no transfusion, IOCS does not lead to a more unfavorable prognosis in cancer patients (Recommended); 3) The implementation of IOCS in cancer patients is economically feasible (Recommended); 4) Leukocyte depletion filters (LDF) should be used when implementing IOCS in cancer patients (Strongly Recommended); 5) Irradiation treatment of autologous blood to be reinfused can be used when implementing IOCS in cancer patients (Recommended); 6) A careful assessment of the condition of cancer patients (meeting indications and excluding contraindications) should be conducted before implementing IOCS (Strongly Recommended); 7) Informed consent from cancer patients should be obtained when implementing IOCS, with a thorough pre-assessment of the patient's condition and the likelihood of blood loss, adherence to standardized internally audited management procedures, meeting corresponding conditions, and obtaining corresponding qualifications (Recommended). In brief, current evidence indicates that IOCS can be implemented for some malignant tumor patients who need allogeneic blood transfusion after physician full evaluation, and LDF or irradiation should be used during the implementation process.
6.Surveillance results of respiratory syncytial virus outbreaks in kindergarten and school in Shenzhen, 2017-2023
WANG Xin, FANG Shisong, WU Weihua, LIU Hui, SUN Ying, ZOU Xuan, TANG Xiujuan
Chinese Journal of School Health 2025;46(3):435-437
Objective:
To analyze respiratory syncytial virus(RSV) outbreaks surveillance results and the epidemiological characteristics in kindergarten and school in Shenzhen during 2017-2023 , so as to provide a scientific reference for control and prevention of RSV.
Methods:
Epidemiological data and surveillance results of RSV outbreaks in kindergarten and school from 2017 to 2023 were collected for descriptive analyses.
Results:
A total of 31 RSV outbreaks were identified in kindergarten and school in 2017-2023 in Shenzhen, 346 cases were reported, the average incidence rate was 22.02%. The most annual RSV outbreaks were reported in 2020 with 14 outbreaks, followed by 8 outbreaks in 2023. A total of 64.52% of RSV outbreaks were identified in kindergarten with rest occurring in primary school or middle school. The greatest monthly count of outbreak was 18 (58.06%) in September, followed by 3 outbreaks (9.68%) in March and October. A total of 244 swab samples were collected, 169 samples were positive for respiratory viruses, the positive rate was 69.26%, 121 samples were positive for RSV,from 31 respiratory syncytical virus outbreaks 57 and samples were positive for other respiratory viruses(9 samples were positive for two respiratory viruses). A toral of 14(45.16%) outbreaks are caused by RSV alone, 17 outbreaks (54.84%) were caused by RSV and other respiratory viruses.
Conclusions
Most RSV outbreaks in kindergarten and school are reported after 2020 in Shenzhen, most RSV outbreaks occur in kindergarten, peak seasons of RSV outbreaks are autumn and spring.
7.The Ferroptosis-inducing Compounds in Triple Negative Breast Cancer
Xin-Die WANG ; Da-Li FENG ; Xiang CUI ; Su ZHOU ; Peng-Fei ZHANG ; Zhi-Qiang GAO ; Li-Li ZOU ; Jun WANG
Progress in Biochemistry and Biophysics 2025;52(4):804-819
Ferroptosis, a programmed cell death modality discovered and defined in the last decade, is primarily induced by iron-dependent lipid peroxidation. At present, it has been found that ferroptosis is involved in various physiological functions such as immune regulation, growth and development, aging, and tumor suppression. Especially its role in tumor biology has attracted extensive attention and research. Breast cancer is one of the most common female tumors, characterized by high heterogeneity and complex genetic background. Triple negative breast cancer (TNBC) is a special type of breast cancer, which lacks conventional breast cancer treatment targets and is prone to drug resistance to existing chemotherapy drugs and has a low cure rate after progression and metastasis. There is an urgent need to find new targets or develop new drugs. With the increase of studies on promoting ferroptosis in breast cancer, it has gradually attracted attention as a treatment strategy for breast cancer. Some studies have found that certain compounds and natural products can act on TNBC, promote their ferroptosis, inhibit cancer cells proliferation, enhance sensitivity to radiotherapy, and improve resistance to chemotherapy drugs. To promote the study of ferroptosis in TNBC, this article summarized and reviewed the compounds and natural products that induce ferroptosis in TNBC and their mechanisms of action. We started with the exploration of the pathways of ferroptosis, with particular attention to the System Xc--cystine-GPX4 pathway and iron metabolism. Then, a series of compounds, including sulfasalazine (SAS), metformin, and statins, were described in terms of how they interact with cells to deplete glutathione (GSH), thereby inhibiting the activity of glutathione peroxidase 4 (GPX4) and preventing the production of lipid peroxidases. The disruption of the cellular defense against oxidative stress ultimately results in the death of TNBC cells. We have also our focus to the realm of natural products, exploring the therapeutic potential of traditional Chinese medicine extracts for TNBC. These herbal extracts exhibit multi-target effects and good safety, and have shown promising capabilities in inducing ferroptosis in TNBC cells. We believe that further exploration and characterization of these natural compounds could lead to the development of a new generation of cancer therapeutics. In addition to traditional chemotherapy, we discussed the role of drug delivery systems in enhancing the efficacy and reducing the toxicity of ferroptosis inducers. Nanoparticles such as exosomes and metal-organic frameworks (MOFs) can improve the solubility and bioavailability of these compounds, thereby expanding their therapeutic potential while minimizing systemic side effects. Although preclinical data on ferroptosis inducers are relatively robust, their translation into clinical practice remains in its early stages. We also emphasize the urgent need for more in-depth and comprehensive research to understand the complex mechanisms of ferroptosis in TNBC. This is crucial for the rational design and development of clinical trials, as well as for leveraging ferroptosis to improve patient outcomes. Hoping the above summarize and review could provide references for the research and development of lead compounds for the treatment for TNBC.
8.Process Optimization and Health Risk Assessment of Calcined Haematitum Based on QbD Concept
Yue YANG ; Jingwei ZHOU ; Jialiang ZOU ; Guorong MEI ; Yifan SHI ; Lei ZHONG ; Jiaojiao WANG ; Xuelian GAN ; Dewen ZENG ; Xin CHEN ; Lin CHEN ; Hongping CHEN ; Shilin CHEN ; Yuan HU ; Youping LIU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(13):187-196
ObjectiveTo investigate the processing technology of calcined Haematitum based on the concept of quality by design(QbD) and to assess its health risk. MethodsTaking whole iron content, Fe2+ dissolution content and looseness as critical quality attributes(CQAs), and calcination temperature, calcination time, spreading thickness and particle size as critical process parameters(CPPs) determined by the failure mode and effect analysis(FMEA), the processing technology of calcined Haematitum was optimized by orthogonal test combined with analytic hierarchy process-criteria importance through intercriteria correlation(AHP-CRITIC) hybrid weighting method. The contents of heavy metals and harmful elements were determined by inductively coupled plasma mass spectrometry, and the health risk assessment was carried out by daily exposure(EXP), target hazard quotient(THQ) and lifetime cancer risk(LCR), and the theoretical value of the maximum limit was deduced. ResultsThe optimal processing technology for calcined Haematitum was calcination at 650 ℃, calcination time of 1 h, particle size of 0.2-0.5 cm, spreading thickness of 1 cm, and vinegar quenching for 1 time[Haematitum-vinegar(10:3)]. The contents of 5 heavy metals and harmful elements in 13 batches of calcined Haematitum were all decreased with reductions of up to 5-fold. The cumulative THQ of 2 batches of samples was>1, while the cumulative THQ of all batches of Haematitum was>1. The LCR of As in 1 batches of Haematitum was 1×10-6-1×10-4, and the LCR of the rest was<1×10-6, and the LCRs of calcined Haematitum were all<1×10-6, indicating that the carcinogenic risk of calcined Haematitum was low, but special attention should still be paid to Haematitum medicinal materials. Preliminary theoretical values of the maximum limits of Cu, As, Cd, Pb and Hg were formulated as 1 014, 25, 17, 27, 7 mg·kg-1. ConclusionThe optimized processing technology of calcined Haematitum is stable and feasible, and the contents of heavy metals and harmful elements are reduced after processing. Preliminary theoretical values of the maximum limits of Cu, As, Cd, Pb and Hg are formulated to provide a scientific basis for the formulation of standards for the limits of harmful elements in Haematitum.
9.Optimization of Processing Technology of Calcined Pyritum Based on QbD Concept and Its XRD Fingerprint Analysis
Xin CHEN ; Jingwei ZHOU ; Haiying GOU ; Lei ZHONG ; Tianxing HE ; Wenbo FEI ; Jialiang ZOU ; Yue YANG ; Dewen ZENG ; Lin CHEN ; Hongping CHEN ; Shilin CHEN ; Yuan HU ; Youping LIU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(13):197-205
ObjectiveBased on the concept of quality by design(QbD), the processing process of calcined Pyritum was optimized, and its X-ray diffraction(XRD) fingerprint was established. MethodsThe safety, effectiveness and quality controllability of calcined Pyritum were taken as the quality profile(QTPP), the color, hardness, metallic luster, phase composition, the contents of heavy metals and hazardous elements were taken as the critical quality attributes(CQAs), and the calcination temperature, calcination time, paving thickness and particle size were determined as the critical process parameters(CPPs). Differential thermal analysis, X-ray diffraction(XRD) and inductively coupled plasma mass spectrometry(ICP-MS) were used to analyze the correlation between the calcination temperature and CQAs of calcined Pyritum. Then, based on the criteria importance through intercriteria correlation(CRITIC)-entropy weight method, the optimal processing process of calcined Pyritum was optimized by orthogonal test. Powder XRD was used to analyze the phase of calcined Pyritum samples processed according to the best process, and the mean and median maps of calcined Pyritum were established by the superposition of geometric topological figures, and similarity evaluation and cluster analysis were carried out. ResultsThe results of single factor experiments showed that the physical phase of Pyritum changed from FeS2 to Fe7S8 during the process of temperature increase, the color gradually deepened from dark yellow, and the contents of heavy metals and harmful elements decreased. The optimized processing process of calcined Pyritum was as follows:calcination temperature at 750 ℃, calcination time of 2.5 h, paving thickness of 3 cm, particle size of 0.8-1.2 cm, vinegar quenching 1 time[Pyritum-vinegar(10∶3)]. After calcination, the internal structure of Pyritum was honeycomb-shaped, which was conducive to the dissolution of active ingredients. XRD fingerprints of 13 batches of calcined Pyritum characterized by 10 common peaks were established. The similarities of the relative peak intensities of the XRD fingerprints of the analyzed samples were>0.96, and it could effectively distinguish the raw products and unqualified products. ConclusionTemperature is the main factor affecting the quality of calcined Pyritum. After processing, the dissolution of the effective components in Pyritum increases, and the contents of heavy metals and harmful substances decrease, reflecting the function of processing to increase efficiency and reduce toxicity. The optimized processing process is stable and feasible, and the established XRD fingerprint can be used as one of the quality control standards of calcined Pyritum.
10.Process Optimization and Health Risk Assessment of Calcined Haematitum Based on QbD Concept
Yue YANG ; Jingwei ZHOU ; Jialiang ZOU ; Guorong MEI ; Yifan SHI ; Lei ZHONG ; Jiaojiao WANG ; Xuelian GAN ; Dewen ZENG ; Xin CHEN ; Lin CHEN ; Hongping CHEN ; Shilin CHEN ; Yuan HU ; Youping LIU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(13):187-196
ObjectiveTo investigate the processing technology of calcined Haematitum based on the concept of quality by design(QbD) and to assess its health risk. MethodsTaking whole iron content, Fe2+ dissolution content and looseness as critical quality attributes(CQAs), and calcination temperature, calcination time, spreading thickness and particle size as critical process parameters(CPPs) determined by the failure mode and effect analysis(FMEA), the processing technology of calcined Haematitum was optimized by orthogonal test combined with analytic hierarchy process-criteria importance through intercriteria correlation(AHP-CRITIC) hybrid weighting method. The contents of heavy metals and harmful elements were determined by inductively coupled plasma mass spectrometry, and the health risk assessment was carried out by daily exposure(EXP), target hazard quotient(THQ) and lifetime cancer risk(LCR), and the theoretical value of the maximum limit was deduced. ResultsThe optimal processing technology for calcined Haematitum was calcination at 650 ℃, calcination time of 1 h, particle size of 0.2-0.5 cm, spreading thickness of 1 cm, and vinegar quenching for 1 time[Haematitum-vinegar(10:3)]. The contents of 5 heavy metals and harmful elements in 13 batches of calcined Haematitum were all decreased with reductions of up to 5-fold. The cumulative THQ of 2 batches of samples was>1, while the cumulative THQ of all batches of Haematitum was>1. The LCR of As in 1 batches of Haematitum was 1×10-6-1×10-4, and the LCR of the rest was<1×10-6, and the LCRs of calcined Haematitum were all<1×10-6, indicating that the carcinogenic risk of calcined Haematitum was low, but special attention should still be paid to Haematitum medicinal materials. Preliminary theoretical values of the maximum limits of Cu, As, Cd, Pb and Hg were formulated as 1 014, 25, 17, 27, 7 mg·kg-1. ConclusionThe optimized processing technology of calcined Haematitum is stable and feasible, and the contents of heavy metals and harmful elements are reduced after processing. Preliminary theoretical values of the maximum limits of Cu, As, Cd, Pb and Hg are formulated to provide a scientific basis for the formulation of standards for the limits of harmful elements in Haematitum.


Result Analysis
Print
Save
E-mail