AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

BACKGROUND:Ca2+expression in astrocytes has been found to be closely related to cognitive function,and the Ca2+signaling pathway regulated by inositol 1,4,5-trisphosphate receptors(IP3R2)and ryanodine receptor(RYR)2 receptors has become a hot spot in the study of cognitive disorder-related diseases. OBJECTIVE:To investigate the expression of Ca2+signals mediated by IP3R2 and RYR2 in hippocampal astrocytes in animal models of delayed encephalopathy after acute carbon monoxide poisoning,and to explore the possible pathogenesis of delayed encephalopathy after acute carbon monoxide poisoning. METHODS:C57BL mice with qualified cognitive function were selected by Morris water maze experiment and randomly divided into control group and experimental group.An animal model of delayed encephalopathy after acute carbon monoxide poisoning was established by static carbon monoxide inhalation in the experimental group,and the same amount of air was inhaled in the control group.Behavioral and neuronal changes,astrocyte specific marker glial fibrillary acidic protein,IP3R2,RYR2 receptor and Ca2+concentration in astrocytes of the two groups were detected using Morris water maze,hematoxylin-eosin staining,western blot,immunofluorescence double labeling and Ca2+fluorescence probe at 21 days after modeling. RESULTS AND CONCLUSION:In the Morris water maze,the escape latency of the experimental group was significantly longer than that of the control group(P<0.05).Hematoxylin-eosin staining results showed that in the experimental group,the number of hippocampal pyramidal cells decreased,the cell structure was disordered,and the nucleus was broken and dissolved.Immunofluorescence results showed that IP3R2 and RYR2 were co-expressed with glial fibrillary acidic protein in the hippocampus,and the expressions of IP3R2,RYR2 and glial fibrillary acidic protein were up-regulated in the hippocampus of the experimental group(P<0.05).Western blot analysis showed that the expressions of IP3R2,RYR2,and glial fibrillary acidic protein in the hippocampus of the experimental group were increased(P<0.05).Ca2+concentration in hippocampal astrocytes increased significantly in the experimental group(P<0.05).To conclude,astrocytes may affect Ca2+signals by mediating IP3R2 and RYR2 receptors,then impair the cognitive function of mice with carbon monoxide poisoning,and eventually lead to delayed encephalopathy after acute carbon monoxide poisoning.

Collagen is a major structural protein in the matrix of animal cells and the most widely distributed and abundant functional protein in mammals. Collagen’s good biocompatibility, biodegradability and biological activity make it a very valuable biomaterial. According to the source of collagen, it can be broadly categorized into two types: one is animal collagen; the other is recombinant collagen. Animal collagen is mainly extracted and purified from animal connective tissues by chemical methods, such as acid, alkali and enzyme methods, etc. Recombinant collagen refers to collagen produced by gene splicing technology, where the amino acid sequence is first designed and improved according to one’s own needs, and the gene sequence of improved recombinant collagen is highly consistent with that of human beings, and then the designed gene sequence is cloned into the appropriate vector, and then transferred to the appropriate expression vector. The designed gene sequence is cloned into a suitable vector, and then transferred to a suitable expression system for full expression, and finally the target protein is obtained by extraction and purification technology. Recombinant collagen has excellent histocompatibility and water solubility, can be directly absorbed by the human body and participate in the construction of collagen, remodeling of the extracellular matrix, cell growth, wound healing and site filling, etc., which has demonstrated significant effects, and has become the focus of the development of modern biomedical materials. This paper firstly elaborates the structure, type, and tissue distribution of human collagen, as well as the associated genetic diseases of different types of collagen, then introduces the specific process of producing animal source collagen and recombinant collagen, explains the advantages of recombinant collagen production method, and then introduces the various systems of expressing recombinant collagen, as well as their advantages and disadvantages, and finally briefly introduces the application of animal collagen, focusing on the use of animal collagen in the development of biopharmaceutical materials. In terms of application, it focuses on the use of animal disease models exploring the application effects of recombinant collagen in wound hemostasis, wound repair, corneal therapy, female pelvic floor dysfunction (FPFD), vaginal atrophy (VA) and vaginal dryness, thin endometritis (TE), chronic endometritis (CE), bone tissue regeneration in vivo, cardiovascular diseases, breast cancer (BC) and anti-aging. The mechanism of action of recombinant collagen in the treatment of FPFD and CE was introduced, and the clinical application and curative effect of recombinant collagen in skin burn, skin wound, dermatitis, acne and menopausal urogenital syndrome (GSM) were summarized. From the exploratory studies and clinical applications, it is evident that recombinant collagen has demonstrated surprising effects in the treatment of all types of diseases, such as reducing inflammation, promoting cell proliferation, migration and adhesion, increasing collagen deposition, and remodeling the extracellular matrix. At the end of the review, the challenges faced by recombinant collagen are summarized: to develop new recombinant collagen types and dosage forms, to explore the mechanism of action of recombinant collagen, and to provide an outlook for the future development and application of recombinant collagen.

Under the trend of increasing aging， integrated elderly care and medical services is an important measure to optimize the supply of elderly care services and promote the good death of the elderly. Using the cooperative production theory and the classical grounded theory， a qualitative analysis was conducted on 38 cases of elderly palliative care and 25 cases of hospital-based palliative care under the integrated elderly care and medical services model from a hospital in Nanning City using Nvivo 20.0 software. This paper found that the integrated elderly care and medical services mode emphasized the deep integration of medical and elderly care services by integrating resources and improving service efficiency， to achieve the basic experience of comprehensive health care for the elderly. The promotion of these experiences has a positive significance for building a multi-agent cooperative production system， strengthening personnel training， perfecting the performance distribution mechanism， and further promoting the development of the national palliative care pilot.

ObjectiveBased on transcriptomics， to explore the mechanism of Hei Xiaoyaosan regulating the phosphatidylinositol 3-kinase/protein kinase B （PI3K/Akt） signaling pathway to improve the learning and memory ability of insomnia rats with liver depression syndrome. MethodsSixty 8-week-old male SD rats were randomly divided into the blank group， model group， eszopiclone group （0.09 mg·kg^-1）， and low， medium， and high dose groups of Hei Xiaoyaosan （3.82， 7.65， 15.30 g·kg^-1）， with ten rats in each group. Except for the blank group， the other groups were induced insomnia rat model with liver depression by chronic restraint， tail clamping stimulation and intraperitoneal injection of p-chlorophenylalanine （PCPA）. Each treatment group received intragastric administration according to the specified dosage， once a day for 14 consecutive days. The pentobarbital sodium cooperative sleep test， open field test， and Morris water maze test were used to test the sleep quality， depressive-like behavior， and learning and memory abilities of rats. Additionally， enzyme-linked immunosorbent assay （ELISA） was used to detect the contents of 5-hydroxytryptamine （5-HT）， γ-aminobutyric acid （GABA）， brain-derived neurotrophic factor （BDNF）， glial cell line-derived neurotrophic factor （GDNF） and nitric oxide （NO） in hippocampus. Hematoxylin-eosin （HE） staining was performed to observe pathological changes of the hippocampal tissue， while terminal deoxynucleotidyl transferase deoxyuridine triphosphate （dUTP） nick end labeling （TUNEL） was used to evaluate apoptosis of hippocampal neurons. Transcriptomic sequencing technology was employed to identify differentially expressed genes in hippocampus between the model group and the blank group， as well as between the medium-dose group of Hei Xiaoyaosan and the model group. Gene Ontology （GO） and Kyoto Encyclopedia of Genes and Genomes （KEGG） enrichment analysis were performed on the intersecting genes. Subsequently， the enriched key genes and signaling pathways were analyzed and verified. Real-time fluorescence quantitative polymerase chain reaction （Real-time PCR） was utilized to assess the mRNA expression levels of phosphatase and tensin homolog （PTEN）， B-cell lymphoma-2 （Bcl-2）-like protein 11 （BCL2L11）， and mitogen-activated protein kinase 1 （MAPK1） in hippocampus， and Western blot was employed to evaluate the protein expressions of PI3K， phosphorylation （p）-PI3K， Akt， p-Akt， Bcl-2， Bcl-2-associated X protein （Bax）， and cleaved Caspase-3 in the same tissue. ResultsCompared with the blank group， the model group exhibited a reduction in body weight， an increase in sleep latency， and a decrease in sleep duration （P<0.01）. Additionally， rats showed obvious depression-like behavior， and their learning and memory abilities decreased. Furthermore， the contents of 5-HT， GABA， NO， BDNF and GDNF in hippocampus decreased （P<0.01）. Histological examination revealed a disorganized cell arrangement in the CA1 region of the hippocampus， characterized by irregular cell shapes， a reduced cell count， deeply stained and pyknotic nuclei， increased vacuolar degeneration， and an elevated apoptosis rate （P<0.01）. Compared with the model group， the body weight of the high and medium dose groups of Hei Xiaoyaosan increased， the sleep latency shortened and the sleep time prolonged （P<0.05， P<0.01）. Additionally， depression-like behavior and learning and memory abilities of rats were significantly improved， the levels of 5-HT， GABA， NO， BDNF and GDNF in the hippocampus increased （P<0.05， P<0.01）. These interventions also ameliorated pathological damage in the hippocampal CA1 area and reduced the apoptosis of hippocampal neurons （P<0.01）. Transcriptomic sequencing results indicated that Hei Xiaoyaosan might exert a therapeutic effect by regulating PI3K/Akt pathway through key mRNAs such as PTEN， BCL2L11， and MAPK1. The roles of these key mRNAs and proteins within PI3K/Akt pathway were further validated. In comparison to the blank group， the expression levels of PTEN， BCL2L11 and MAPK1 mRNA in the hippocampus of rats in the model group were increased （P<0.01）， while the protein expression levels of p-PI3K， p-Akt and Bcl-2 were decreased （P<0.01）， and the protein expression levels of PTEN， Bax and cleaved Caspase-3 were increased （P<0.01）. Compared with the model group， the high-dose and medium-dose groups of Hei Xiaoyaosan could down-regulate the expressions of PTEN， BCL2L11 and MAPK1 mRNAs （P<0.01）， up-regulate the expressions of p-PI3K， p-Akt and Bcl-2 proteins （P<0.01）， and down-regulate the protein expressions of PTEN， Bax and cleaved Caspase-3 （P<0.05， P<0.01）. ConclusionHei Xiaoyaosan may regulate PI3K/Akt signaling pathway by down-regulating expressions of key genes such as PTEN， BCL2L11 and MAPK1， and thus improve the learning and memory abilities of insomnia rats with liver depression syndrome.

OBJECTIVE To explore the mechanism of Shenqi guben formula （SQGB） in improving cancer-related fatigue （CRF） based on network pharmacology and cellular experiments. METHODS Active components of SQGB and CRF-related targets were identified on the basis of databases such as the Traditional Chinese Medicine Systems Pharmacology platform. An in vitro CRF cell model was established by inducing A549 cells with interleukin-17 （IL-17）. Cells were treated with low （1.0 mg/mL） or high （1.5 mg/mL） concentrations of SQGB. The effects on cell viability， migration， apoptosis， inflammatory factors， mRNA expression， apoptosis-related proteins and key proteins 011） of IL-17 signaling pathway were evaluated using scratch assay， flow cytometry， ELISA， real-time fluorescent quantitative PCR and Western blot analysis. RESULTS SQGB contained 84 active components acting on 209 potential CRF targets. Among E-these， quercetin， kaempferol， and luteolin were identified as the core components of the compound. Core targets included tumor protein p53， AKT serine/threonine kinase 1， IL-6， and tumor necrosis factor （TNF）. IL-17， TNF and phosphatidylinositol-3- kinase-serine/threonine protein kinase （PI3K/Akt） signaling pathways were identified as crucial pathways. Compared with IL-17 intervention group， the cell migration rate， B-cell lymphoma 2 （Bcl-2） protein expression， the levels of IL-6 and TNF-α in the supernatant， mRNA expression of IL-17 receptor A （IL-17RA）， TNF-α， and IL-6， as well as the protein expression of IL-17RA and nuclear factor kappa-B p65 subunit （p65）， and phosphorylated （p）-p65/p65 ratio in IL-17+SQGB low- and high- quality concentration groups were all significantly decreased or down-regulation （P＜0.05）； the apoptosis rate， expression levels of Bcl-2 associated X protein （Bax） and cleaved caspase-3 protein， the ratio of Bax/Bcl-2， the expression level of p-p38 protein， and the p- p38/p38 ratio were all significantly increased or up-regulated （P＜0.05）. Moreover， the improvement effects of these indicators were mostly better in the high-quality concentration groups compared to the low-quality concentration groups （P＜0.05）. CONCLUSIONS SQGB ameliorates CRF by regulating the IL-17 signaling pathway， inhibiting the expression of inflammatory factors， and activating p38 MAPK-dependent apoptosis pathway.

Objective: To investigate the indoor fine particulate matter (PM 2.5 ) pollution and its influencing factors in children s bedrooms using solid fuel, so as to provide evidence for effective strategy to reduce PM 2.5 pollution. Methods: From December 2019 to November 2020, 198 households (108 in the north, 90 in the south) from two pilots in the north(Jiamusi in Heilongjiang Province) and south of China (Mianyang in Sichuan Province) were selected, and status of solid fuels using were obtained through home visits, dynamic changes in PM 2.5 concentrations in children s bedrooms were monitored by using real time online instruments, and the influencing factors of PM 2.5 pollution were analyzed by using a mixed effects model. Results: During the monitoring period, the daily PM 2.5 concentrations in the northern and southern pilot were 78.33 (40.50, 154.80) and 38.54(26.20, 58.46) μg/m 3, respectively, exceeding standard rates of 44.57% and 33.22%. During the heating period, the daily PM 2.5 concentrations in the northern and southern pilot were 212.50(133.60,244.10) and 104.42(73.97, 134.90) μg/m 3, respectively, with over standard rates of 96.75% and 86.96%. The mixed effects model analysis results showed that children s bedroom PM 2.5 concentrations were associated with solid fuel usage duration, window opening time, room layout (shared entrance door between kitchen and bedroom), indoor smoking, indoor humidity, and solid fuel use in the bedroom ( β =0.19, -0.05, 1.20, 0.43, 0.02, 0.35, all P <0.05). Conclusion Solid fuel combustion significantly comtributes to PM 2.5 pollution in children s bedrooms, with more pronounced impacts observed in northern China compared to southern regions.

The Golgi apparatus (GA) is a key membranous organelle in eukaryotic cells, acting as a central component of the endomembrane system. It plays an irreplaceable role in the processing, sorting, trafficking, and modification of proteins and lipids. Under normal conditions, the GA cooperates with other organelles, including the endoplasmic reticulum (ER), lysosomes, mitochondria, and others, to achieve the precise processing and targeted transport of nearly one-third of intracellular proteins, thereby ensuring normal cellular physiological functions and adaptability to environmental changes. This function relies on Golgi protein quality control (PQC) mechanisms, which recognize and handle misfolded or aberrantly modified proteins by retrograde transport to the ER, proteasomal degradation, or lysosomal clearance, thus preventing the accumulation of toxic proteins. In addition, Golgi-specific autophagy (Golgiphagy), as a selective autophagy mechanism, is also crucial for removing damaged or excess Golgi components and maintaining its structural and functional homeostasis. Under pathological conditions such as oxidative stress and infection, the Golgi apparatus suffers damage and stress, and its homeostatic regulatory network may be disrupted, leading to the accumulation of misfolded proteins, membrane disorganization, and trafficking dysfunction. When the capacity and function of the Golgi fail to meet cellular demands, cells activate a series of adaptive signaling pathways to alleviate Golgi stress and enhance Golgi function. This process reflects the dynamic regulation of Golgi capacity to meet physiological needs. To date, 7 signaling pathways related to the Golgi stress response have been identified in mammalian cells. Although these pathways have different mechanisms, they all help restore Golgi homeostasis and function and are vital for maintaining overall cellular homeostasis. It is noteworthy that the regulation of Golgi homeostasis is closely related to multiple programmed cell death pathways, including apoptosis, ferroptosis, and pyroptosis. Once Golgi function is disrupted, these signaling pathways may induce cell death, ultimately participating in the occurrence and progression of diseases. Studies have shown that Golgi homeostatic imbalance plays an important pathological role in various major diseases. For example, in Alzheimer’s disease (AD) and Parkinson’s disease (PD), Golgi fragmentation and dysfunction aggravate the abnormal processing of amyloid β-protein (Aβ) and Tau protein, promoting neuronal loss and advancing neurodegenerative processes. In cancer, Golgi homeostatic imbalance is closely associated with increased genomic instability, enhanced tumor cell proliferation, migration, invasion, and increased resistance to cell death, which are important factors in tumor initiation and progression. In infectious diseases, pathogens such as viruses and bacteria hijack the Golgi trafficking system to promote their replication while inducing host defensive cell death responses. This process is also a key mechanism in host-pathogen interactions. This review focuses on the role of the Golgi apparatus in cell death and major diseases, systematically summarizing the Golgi stress response, regulatory mechanisms, and the role of Golgi-specific autophagy in maintaining homeostasis. It emphasizes the signaling regulatory role of the Golgi apparatus in apoptosis, ferroptosis, and pyroptosis. By integrating the latest research progress, it further clarifies the pathological significance of Golgi homeostatic disruption in neurodegenerative diseases, cancer, and infectious diseases, and reveals its potential mechanisms in cellular signal regulation.

ObjectiveThis study proposes a novel single-cell protein localization method based on a class perception graph convolutional network (CP-GCN) to overcome several critical challenges in protein microscopic image analysis, including the scarcity of cell-level annotations, inadequate feature extraction, and the difficulty in achieving precise protein localization within individual cells. The methodology involves multiple innovative components designed to enhance both feature extraction and localization accuracy. MethodsFirst, a class perception module (CPM) is developed to effectively capture and distinguish semantic features across different subcellular categories, enabling more discriminative feature representation. Building upon this, the CP-GCN network is designed to explore global features of subcellular proteins in multicellular environments. This network incorporates a category feature-aware module to extract protein semantic features aligned with label dimensions and establishes a subcellular relationship mining module to model correlations between different subcellular structures. By doing so, it generates co-occurrence embedding features that encode spatial and contextual relationships among subcellular locations, thereby improving feature representation. To further refine localization, a multi-scale feature analysis approach is employed using the K-means clustering algorithm, which classifies multi-scale features within each subcellular category and generates multi-cell class activation maps (CAMs). These CAMs highlight discriminative regions associated with specific subcellular locations, facilitating more accurate protein localization. Additionally, a pseudo-label generation strategy is introduced to address the lack of annotated single-cell data. This strategy segments multicellular images into single-cell images and assigns reliable pseudo-labels based on the CAM-predicted regions, ensuring high-quality training data for single-cell analysis. Under a transfer learning framework, the model is trained to achieve precise single-cell-level protein localization, leveraging both the extracted features and pseudo-labels for robust performance. ResultsExperimental validation on multiple single-cell test datasets demonstrates that the proposed method significantly outperforms existing approaches in terms of robustness and localization accuracy. Specifically, on the Kaggle 2021 dataset, the method achieves superior mean average precision (mAP) metrics across 18 subcellular categories, highlighting its effectiveness in diverse protein localization tasks. Visualization of the generated CAM results further confirms the model’s capability to accurately localize subcellular proteins within individual cells, even in complex multicellular environments. ConclusionThe integration of the CP-GCN network with a pseudo-labeling strategy enables the proposed method to effectively capture heterogeneous cellular features in protein images and achieve precise single-cell protein localization. This advancement not only addresses key limitations in current protein image analysis but also provides a scalable and accurate solution for subcellular protein studies, with potential applications in biomedical research and diagnostic imaging. The success of this method underscores the importance of combining advanced deep learning architectures with innovative training strategies to overcome data scarcity and improve localization performance in biological image analysis. Future work could explore the extension of this framework to other types of microscopic imaging and its application in large-scale protein interaction studies.

AIM:To investigate the therapeutic effects of botulinum toxin A(BTXA)injection versus strabismus surgery in the treatment of acute acquired comitant esotropia(AACE).METHODS:Patient records of AACE cases treated at First People's Hospital of Nantong from January 2019 to September 2023 were retrospectively analyzed in this study. Patients were categorized into either strabismus surgery or BTXA injection groups based on treatment modality. Further stratification was performed according to preoperative deviation angles [>35 prism diopters(PD)vs ≤35 PD] and age(≥18 years adult group vs <18 years adolescent group). The baseline patient characteristics were collected, deviation angles at multiple timepoints before and after treatment were measured, and stereopsis test results were documented. Through comparative analysis of therapeutic outcomes across subgroups, we systematically evaluated the efficacy of different treatment approaches.RESULTS:A total of 43 AACE patients were included. At the final follow-up, both the surgery and BTXA injection groups showed a statistically significant decrease in deviation angle compared to pretreatment measurements(P<0.001). Significant differences were noted between the two groups in terms of the cure rate of strabismus and the recovery rate of stereopsis(P<0.05). For patients with deviations >35 PD, surgery yielded significantly better outcomes than injection therapy in postoperative angle, success rate, and stereopsis recovery(P<0.05). Similarly, in patients aged ≥18 years, surgical treatment was superior to injections in reducing strabismus angle, improving success rates, and restoring stereopsis(P<0.05).CONCLUSION:Both BTXA injection and strabismus surgery demonstrate therapeutic efficacy in AACE. Surgical treatment demonstrated superior efficacy compared to BTXA injection therapy, particularly in patients with deviations >35 PD and those aged ≥18 years. For patients with angles ≤35 PD or under 18 years, BTXA injection remains a viable treatment option.