Introduction: The 2021 IDF-DAR risk calculator had been previously evaluated in multiple studies and subsequently widely accepted and applied in clinical practice as a practical standardized tool for patient risk stratification. Recently updated, the 2026 IDF-DAR Risk calculator enables a more individualized, evidence-related evaluation of patientrelated and disease-related risk factors, incorporating modern diabetes technologies, including continuous glucose monitoring (CGM), automated insulin delivery (AID) systems, and advanced insulin formulations to enhance risk stratification. This tool allows medical professionals to tailor Ramadan practices based on overall factors toward promoting safe fasting. Methodology: This prospective multicentre observational study recruited adults with Type 1 and Type 2 diabetes attending public hospitals nationwide. People with diabetes (PwD) intending to perform Ramadan fasting were invited to participate and assessed using the 2026 IDF-DAR Risk Calculator in the 6-week pre-Ramadan period between 30th January and 19th March 2026. Results: A total of 458 PwD were evaluated and stratified into low (15.7%), moderate (41%), and high risk (43.3%) categories. Most participants had Type 2 diabetes (83.6%), with 60.3% having a disease duration exceeding 10 years and 43% exhibiting poor glycemic control (hemoglobin A1c >9%). Insulin therapy was used by 76.4% of participants, including two individuals with Type 1 diabetes using AID systems. Most participants reported no recent hypoglycemia (76.4%), 81.0% performed glucose monitoring, and 3.3% used CGM. Severe comorbidities were uncommon, with 1.1% having unstable macrovascular disease and 4.4% advanced chronic kidney disease (estimated glomerular filtration rate <30). Notably, 72.2% received structured Ramadan education. Conclusion Majority of PwD attending tertiary diabetes clinics were in the moderate- to high-risk category and intended to fast despite medical advice against fasting in some cases. Although most participants were on insulin therapy, hypoglycemia was low in the pre-Ramadan period. Integration of modern technologies, advanced insulin therapies, and structured education may support safer fasting practices.
Risk Assessment ; Diabetes Mellitus ; Hospitals ; Fasting

ObjectiveObesity, a global chronic metabolic disease, is closely associated with disruptions in lipid metabolism and gut microbiota. Current intervention strategies still have limitations in terms of safety and microecological regulation, necessitating the exploration of novel natural regulatory approaches. Based on the early pathological characteristics of obesity, this study innovatively employs a rectal delivery method alongside a high-fat diet (HFD)-induced obesity model to systematically evaluate the inhibitory effects, safety, and gut microbiota regulation mechanisms of leek-derived and konjac-derived extracellular vesicles on obesity development. By simulating early clinical intervention scenarios, this study aims to explore the preventive potential of plant-derived extracellular vesicles during the initial stages of obesity onset. MethodsExtracellular vesicles from leek and konjac were isolated using ultracentrifugation combined with density gradient centrifugation. Their nanoscale properties were characterized by dynamic light scattering (DLS), transmission electron microscopy (TEM), and nanoparticle tracking analysis (NTA). Male C57BL/6J mice were randomly divided into four groups: normal control (NC), high-fat diet (HFD), leek-derived extracellular vesicles (LEVs), and konjac-derived extracellular vesicles (KEVs). Beginning simultaneously with HFD feeding, mice in the intervention groups received 20 g/L vesicles rectally every 3 d for 4 weeks. Body mass and body composition were monitored throughout. At endpoint, mouse serum, adipose tissue, and colonic contents were collected. Serum biochemical indices (lipid profile, liver and kidney function, cardiac markers) were assessed to evaluate safety and metabolic efficacy, while 16S rRNA sequencing was employed to analyze gut microbial structure and diversity. ResultsDLS, NTA, and TEM confirmed that both LEVs and KEVs exhibited typical cup-shaped nanostructures with average particle sizes of approximately 284 nm and 223 nm, respectively. LEVs and KEVs treatment significantly suppressed HFD-induced weight gain and elevation of body-fat percentage (P<0.05), and reduced accumulation of abdominal white and epididymal adipose tissue. Serological analyses showed that both vesicles lowered total cholesterol, triglycerides and LDL-cholesterol, and ameliorated liver enzyme profiles (ALT, AST), demonstrating lipid-metabolic regulation and hepatoprotective effects. No hepatic, renal or cardiac dysfunction was observed, indicating favorable safety. Gut microbiota analyses revealed that vesicle intervention partially restored HFD-depleted microbial diversity and reshaped community structure. Notably, LEVs markedly increased the relative abundance of the beneficial taxon Lachnospiraceae at the family level, which is known for producing short-chain fatty acids and enhancing intestinal barrier function. Furthermore, Phylogenetic Investigation of Communities by Reconstruction of Unobserved States (PICRUSt) functional prediction suggested that LEVs and KEVs modulated gut microbial functions through distinct mechanisms: LEVs downregulated pathways related to ribosomes and DNA replication while enhancing xenobiotic degradation, whereas KEVs tended to upregulate energy metabolism and protein synthesis toward healthy levels. ConclusionRectally administered LEVs and KEVs exhibit excellent safety and pronounced metabolic benefits during the early phase of obesity, suppressing weight gain, correcting lipid dysregulation, and exerting effects via modulation of gut microbial composition and function. This study provides systematic experimental evidence supporting plant-derived exosome-like vesicles as an early intervention strategy against obesity.

Traditional Chinese medicine （TCM） diagnostics is a discipline that studies the basic theories and fundamental skills of diagnostic methods， disease diagnosis， and differentiation in accordance with the theories of TCM. The artificial intelligence （AI） technology has gained remarkable achievements in the intelligentization of the four diagnostic methods in TCM and the standardization of differentiation and diagnosis. However， it still faces many challenges. The standardization of clinical data collection is difficult， and the data quality is uneven， which affects the usability of the data. The integration of the four diagnostic information is insufficient. Most instruments can only collect data from a single diagnostic method， lacking overall integrity. The scientific nature of the diagnostic model needs to be improved. The existing models lack dynamics and the reasoning logic of TCM differentiation. The accuracy of intelligent methods needs to be improved， and the existing evaluation indicators cannot fully reflect the practical application effect of the model. Furthermore， the relevant laws and regulations are still not perfect， and data security and patient privacy lack guarantees. The cultivation of compound talents is insufficient， and there is a lack of interdisciplinary talents who are proficient in both TCM and AI. On this basis， this paper expounded on the current development status， difficulties， and bottlenecks of AI in TCM diagnosis and then explored the development trend of AI in the field of TCM diagnosis. It proposed solutions such as optimizing the data collection process， constructing multimodal diagnostic models， facilitating multi-disciplinary exchanges and cooperation， improving laws and regulations， and cultivating compound talents. It is hoped that modern， standardized， normalized， and intelligent TCM diagnosis can be further promoted， thereby providing new impetus and methods for the inheritance and innovation of TCM.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective To construct a lung cancer surgery-oriented disease-specific database covering the entire perioperative care pathway, thereby improving the quality and usability of key surgical data elements. Methods Real-world clinical data were extracted from a single-center thoracic surgery department. A standardized data model was established based on the open electronic health record (openEHR) standard. Large language model (LLM), optical character recognition (OCR), and artificial intelligence (AI)-driven techniques were employed to extract, structure, and perform quality control on unstructured clinical narratives, imaging reports, and radiological data, with a focus on capturing surgically relevant perioperative indicator. Results A multimodal database comprising 19 917 patients was established, including 7 930 males and 11 987 females, with ages ranging from 15 to 97 (61.7±9.7) years. The database includes 582 structured data variables, textual report data corresponding to 69 clinical indicators, 13 000 pulmonary function test PDF reports, and chest CT imaging data from 16 884 patients. This database comprehensively covers major information relevant to surgical diagnosis and treatment of lung cancer, significantly improving the completeness and granularity of surgical detail data. Large language models (LLMs) and optical character recognition (OCR) technologies enhanced the efficiency of converting unstructured data into structured formats, while a multi-level manual verification process ensured data accuracy and traceability. The database supports real-world research including comparisons of surgical procedures, prediction of postoperative complications, prognosis assessment, and multimodal data association analyses.

ObjectiveObesity, a global chronic metabolic disease, is closely associated with disruptions in lipid metabolism and gut microbiota. Current intervention strategies still have limitations in terms of safety and microecological regulation, necessitating the exploration of novel natural regulatory approaches. Based on the early pathological characteristics of obesity, this study innovatively employs a rectal delivery method alongside a high-fat diet (HFD)-induced obesity model to systematically evaluate the inhibitory effects, safety, and gut microbiota regulation mechanisms of leek-derived and konjac-derived extracellular vesicles on obesity development. By simulating early clinical intervention scenarios, this study aims to explore the preventive potential of plant-derived extracellular vesicles during the initial stages of obesity onset. MethodsExtracellular vesicles from leek and konjac were isolated using ultracentrifugation combined with density gradient centrifugation. Their nanoscale properties were characterized by dynamic light scattering (DLS), transmission electron microscopy (TEM), and nanoparticle tracking analysis (NTA). Male C57BL/6J mice were randomly divided into four groups: normal control (NC), high-fat diet (HFD), leek-derived extracellular vesicles (LEVs), and konjac-derived extracellular vesicles (KEVs). Beginning simultaneously with HFD feeding, mice in the intervention groups received 20 g/L vesicles rectally every 3 d for 4 weeks. Body mass and body composition were monitored throughout. At endpoint, mouse serum, adipose tissue, and colonic contents were collected. Serum biochemical indices (lipid profile, liver and kidney function, cardiac markers) were assessed to evaluate safety and metabolic efficacy, while 16S rRNA sequencing was employed to analyze gut microbial structure and diversity. ResultsDLS, NTA, and TEM confirmed that both LEVs and KEVs exhibited typical cup-shaped nanostructures with average particle sizes of approximately 284 nm and 223 nm, respectively. LEVs and KEVs treatment significantly suppressed HFD-induced weight gain and elevation of body-fat percentage (P<0.05), and reduced accumulation of abdominal white and epididymal adipose tissue. Serological analyses showed that both vesicles lowered total cholesterol, triglycerides and LDL-cholesterol, and ameliorated liver enzyme profiles (ALT, AST), demonstrating lipid-metabolic regulation and hepatoprotective effects. No hepatic, renal or cardiac dysfunction was observed, indicating favorable safety. Gut microbiota analyses revealed that vesicle intervention partially restored HFD-depleted microbial diversity and reshaped community structure. Notably, LEVs markedly increased the relative abundance of the beneficial taxon Lachnospiraceae at the family level, which is known for producing short-chain fatty acids and enhancing intestinal barrier function. Furthermore, Phylogenetic Investigation of Communities by Reconstruction of Unobserved States (PICRUSt) functional prediction suggested that LEVs and KEVs modulated gut microbial functions through distinct mechanisms: LEVs downregulated pathways related to ribosomes and DNA replication while enhancing xenobiotic degradation, whereas KEVs tended to upregulate energy metabolism and protein synthesis toward healthy levels. ConclusionRectally administered LEVs and KEVs exhibit excellent safety and pronounced metabolic benefits during the early phase of obesity, suppressing weight gain, correcting lipid dysregulation, and exerting effects via modulation of gut microbial composition and function. This study provides systematic experimental evidence supporting plant-derived exosome-like vesicles as an early intervention strategy against obesity.

Work serves as a critical means of obtaining resources, facilitating personal growth, realizing self-worth, and engaging in social interactions. However, work-related diseases pose significant threats to workers’ health and productivity, and impose considerable economic burdens. This article categorized work-related diseases into six major types, including musculoskeletal disorders, mental and behavioral disorders, cardiovascular and metabolic diseases, digestive system diseases, reproductive system diseases, and non-specific respiratory diseases, and summarized their risk factors, assessment methods, policy regulation, and prevention and control measures. Current research in this field predominantly relies on cross-sectional studies, which present limitations in causal inference and potential risks of bias. Future studies should expand sample sizes, optimize research designs, and establish multidimensional evaluation systems to comprehensively assess the health and economic impacts of work-related diseases. It is recommended to enhance the translation of research findings into practice, thereby providing a scientific basis for the occupational health protection system and promoting the well-being and sustainable development of the working population.

Background: s/Aims: Postoperative pancreatic fistulas (POPF) remain a major cause of morbidity and mortality following pancreatoduodenectomy (PD). Pancreatogastrostomy (PG) and pancreatojejunostomy (PJ) are the two most commonly used reconstruction techniques, yet evidence favoring one over the other is inconclusive. This study evaluates postoperative outcomes following open PD at a single institution that transitioned from PG to PJ as the preferred reconstruction method. Methods: This retrospective comparative study included patients who underwent PD between April 2005 and August 2022. Of 757 patients identified, 522 met the inclusion criteria. Propensity score matching (PSM) was performed to adjust for clinically relevant covariates. Primary endpoints were clinically relevant (CR) POPF (grade B/C) and Clavien–Dindo (CD) grade ≥ 3 POPFs. Secondary outcomes included post-pancreatectomy hemorrhage (PPH), delayed gastric emptying (DGE), systemic complications, length of hospital stay, and mortality. Results: Overall, CR-POPF and CD grade ≥ 3 POPFs occurred in 21.3% and 8.0% of patients, respectively. Thirty-day and in-hospital mortality rates were 3.1% and 4.2%. After PSM, 368 patients (184 PG and 184 PJ) were analyzed. Grade B POPFs were more frequent following PJ than PG (24.5% vs. 15.8%, p < 0.001). Although CR-POPF and CD grade ≥ 3 POPFs were numerically higher in the PJ group, differences were not statistically significant. In contrast, DGE, PPH, and in-hospital mortality were significantly higher following PG (37.0% vs. 25.0%, p = 0.025; 16.3% vs. 8.7%, p = 0.025; and 7.6% vs. 2.7%, p = 0.049, respectively). Conclusions PG was associated with a lower incidence of grade B POPFs but higher rates of DGE, PPH, and in-hospital mortality.

Objective: To investigate the awareness of knowledge about hepatitis C prevention and control among outpatients in Ningbo City, Zhejiang Province, and its influencing factors, so as to provide the evidence for strengthening health education on hepatitis C prevention and control. Methods: Based on sentinel surveillance of hepatitis C, the outpatients aged 15 to 65 years at seven hospitals in Yinzhou District, Cixi City and Xiangshan County of Ningbo City were selected using the convenient sampling method from April to June during 2020 and 2022. Demographic information, knowledge and behaviors related to hepatitis C prevention and control were collected through questionnaire surveys. The influencing factors for knowledge about hepatitis C prevention and control were analyzed using a multivariable logistic regression model. Results: A total of 2 792 participants were surveyed, including 1 157 males (41.44%) and 1 635 females (58.56%). The awareness rate of knowledge about hepatitis C prevention and control was 56.23%, and was lower in knowledge about hepatitis C vaccine and treatment. The awareness rates of knowledge about hepatitis C prevention and control among outpatients from 2020 to 2022 were 47.11%, 53.22% and 70.65%, respectively, showing an upward trend (P<0.05). Multivariable logistic regression analysis showed that participants aged 25 to <50 years (OR=1.358, 95%CI: 1.073-1.719), with an educational level of high school or junior college (OR=1.431, 95%CI: 1.134-1.806) or above junior college (OR=3.728, 95%CI: 2.958-4.699), with household monthly income per capita of 3 000 to <5 000 yuan (OR=1.828, 95%CI: 1.344-2.486) or ≥5 000 yuan (OR=1.858, 95%CI: 1.366-2.526), without a history of invasive treatments such as pedicure in public places (OR=1.287, 95%CI: 1.024-1.618), without a history of contact with family members' blood-contaminated items (OR=2.050, 95%CI: 1.552-2.707), and always using condoms during sexual contacts (OR=1.740, 95%CI: 1.273-2.378) had higher awareness of knowledge about hepatitis C prevention and control. Conclusions The awareness of knowledge about hepatitis C vaccine and treatment among outpatients in Ningbo City needs to be improved. Age, educational level, household monthly income per capita, history of invasive treatments such as pedicure in public places, history of contact with family members' blood-contaminated items and frequency of condom use during sexual contacts are associated with outpatients' awareness of knowledge about hepatitis C prevention and control.

Objective:To investigate the effect of interaction between body mass index (BMI) and gender on the survival of advanced gastric cancer after immunotherapy.Methods:The retrospective cohort study was conducted. The clinicopathological data of 317 patients with advanced gastric cancer who were admitted to the Nanfang Hospital, Southern Medical University from November 2019 to October 2023 were collected. There were 205 males and 112 females, aged 56 (range, 21-79)years. All 317 patients were divided into three groups based on BMI of patients, including 58 cases with BMI <18.5 kg/m2 were classified as the low body mass group, 183 cases with BMI 18.5-24.0 kg/m2 were classified as the normal body mass group, and 76 cases with BMI >24.0 kg/m2 were classified as the overweight or obese group. Patients included in the study were treated with a programmed death-ligand 1 (PD-L1) based immunotherapy regimen for 3 cycles based on their specific conditions, and further decision was made whether to undergo radical surgery or continue comprehensive treatment after evaluating the efficacy. Observation indicators: (1) clinicopathological characteristics of patients; (2) follow-up and mortality status; (3) analysis of factors affecting survival of patients with advanced gastric cancer after immunotherapy. Comparison of measurement data with normal distribution among groups was conducted using the ANOVA. Comparison of measurement data with skewed distribution among groups was conducted using the Kruskal-Wallis H test. Comparison of count data among groups was conducted using the chi-square test. The Cox proportional hazard model was used for univariate and multivariate analyses. Nonlinear trend was analyzed using the restricted cubic spline (RCS) curve, and trend and correction graphs were created using the rcssci package (v1.0). Results:(1) Clinicopathological characteristics of patients. There was no significant difference in gender, age, Borrmann classification, Lauren classification, combined positive score of PD-L1, expression of human epidermal growth factor receptor 2, Epstein-Barr virus infection, carcino-embryonic antigen, CA19-9, CA72-4, alpha-fetoprotein, conversion surgery among the 3 groups of patients ( P>0.05), and there was a significant difference in mismatch repair combined with micro-satellite stability among the 3 groups of patients ( P<0.05). (2) Follow-up and mortality status. Of the 317 patients, 316 cases completed follow-up and 1 case in the overweight or obese group was lost to follow-up. The follow-up time of the 316 cases was 13.8(range, 0.9-48.2)months. During the follow-up, the number of death in the low body mass group, normal body mass group and overweight or obese group were 27, 70 and 31, respectively. (3) Analysis of factors affecting survival of patients with advanced gastric cancer after immunotherapy. Results of multivariate analysis showed that gender and BMI were independent factors affecting survival of patients with advanced gastric cancer after immunotherapy ( hazard ratio=0.066, 0.922, 95% confidence interval as 0.005-0.846, 0.855-0.994, P<0.05). Results of further analysis showed that the interaction between BMI and gender was an independent factor affecting survival of patients with advanced gastric cancer after immuno-therapy ( hazard ratio=1.152, 95% confidence interval as 1.024-1.296, P<0.05). Results of Cox regre-ssion analysis based on different gender showed that took patients of the normal body mass group as a reference, the male patients of the low body mass group had a significantly increased risk of death, showing a significant statistically difference ( hazard ratio=1.809, 95% confidence interval as 1.037-3.155, P<0.05). Results of RCS curve analysis showed that there was a non-linear correlation between BMI and survival of patients with advanced gastric cancer after immunotherapy ( P<0.05). Results of corrected RCS curve analysis using the rcssci package showed that there was a U-shaped relationship between BMI and survival of patients with advanced gastric cancer after immuno-therapy ( P<0.05), with the optimal cut-off value of BMI as 22.2 kg/m 2. Results of RCS curve analysis based on different gender showed that there was a U-shaped relationship between BMI and survival of male patients with advanced gastric cancer after immunotherapy ( P<0.05), with the optimal cut-off value of BMI as 22.7 kg/m 2. Conclusions:Gender, BMI and the interaction between BMI and gender are independent factors affecting survival of patients with advanced gastric cancer after immuno-therapy. There is a U-shaped relationship between BMI and survival of patients, with the optimal cut-off value of BMI as 22.2 kg/m 2, and there is a U-shaped relationship between BMI and survival of male patients, with the optimal cut-off value of BMI as 22.7 kg/m 2.