AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Acupuncture treatment of chronic pain combined with depression (CPDC) is the result of a multi-target, multi-pathway approach. Acupuncture can treat CPDC by inhibiting the activation of glial cells, regulating the release of inflammatory mediators, regulating the expressions of neurotransmitters, changing the plasticity of neural synapses, regulating related epigenetic effects, regulating the microbiota-brain-gut axis, inhibiting nerve cell apoptosis, and antagonizing oxidative stress. The mechanism of its effect mainly involves anti-inflammatory related signaling pathways, regulation of neural synapse-related signaling pathways, and exerts its therapeutic effect through hippocampus, cerebral cortex, and amygdala.

This study aims to investigate the potential effect of the water extract of fresh Rehmanniae Radix on hypercholesterolemia in mice that was induced by a high-fat and high-cholesterol diet and explore its possible mechanism from bile acid reabsorption. Male C57BL/6 mice were randomly assigned into the following groups: control, model, low-and high-dose(4 and 8 g·kg~(-1), respectively) fresh Rehmanniae Radix, and positive drug(simvastatin, 0.05 g·kg~(-1)). Other groups except the control group were fed with a high-fat and high-cholesterol diet for 6 consecutive weeks to induce hypercholesterolemia. From the 6th week, mice were administrated with corresponding drugs daily via gavage for additional 6 weeks, while continuing to be fed with a high-fat and high-cholesterol diet. Serum levels of total cholesterol(TC), triglycerides(TG), low density lipoprotein-cholesterol(LDL-c), high density lipoprotein-cholesterol(HDL-c), and total bile acid(TBA), as well as liver TC and TG levels and fecal TBA level, were determined by commercial assay kits. Hematoxylin-eosin(HE) staining, oil red O staining, and transmission electron microscopy were performed to observe the pathological changes in the liver. Three livers samples were randomly selected from each of the control, model, and high-dose fresh Rehmanniae Radix groups for high-throughput transcriptome sequencing. Differentially expressed genes were mined and KEGG pathway enrichment analysis was performed to predict the key pathways and target genes of the water extract of fresh Rehmanniae Radix in the treatment of hypercholesterolemia. RT-qPCR was employed to measure the mRNA levels of cholesterol 7α-hydroxylase(CYP7A1) and cholesterol 27α-hydroxylase(CYP27A1) in the liver. Western blot was employed to determine the protein levels of CYP7A1 and CYP27A1 in the liver as well as farnesoid X receptor(FXR), apical sodium-dependent bile acid transporter(ASBT), and ileum bile acid-binding protein(I-BABP) in the ileum. The results showed that the water extract of fresh Rehmanniae Radix significantly lowered the levels of TC and TG in the serum and liver, as well as the level of LDL-c in the serum. Conversely, it elevated the level of HDL-c in the serum and TBA in feces. No significant difference was observed in the level of TBA in the serum among groups. HE staining, oil red O staining, and transmission electron microscopy showed that the water extract reduced the accumulation of lipid droplets in the liver. Further mechanism studies revealed that the water extract of fresh Rehmanniae Radix significantly down-regulated the protein levels of FXR and bile acid reabsorption-related proteins ASBT and I-BABP. Additionally, it enhanced CYP7A1 and CYP27A1, the key enzymes involved in bile acid synthesis. Therefore, it is hypothesized that the water extract of fresh Rehmanniae Radix may exert an anti-hypercholesterolemic effect by regulating FXR/ASBT/I-BABP signaling, inhibiting bile acid reabsorption, and increasing bile acid excretion, thus facilitating the conversion of cholesterol to bile acids.
Animals ; Male ; Bile Acids and Salts/metabolism* ; Mice, Inbred C57BL ; Mice ; Diet, High-Fat/adverse effects* ; Cholesterol/metabolism* ; Drugs, Chinese Herbal/administration & dosage* ; Hypercholesterolemia/genetics* ; Receptors, Cytoplasmic and Nuclear/genetics* ; Rehmannia/chemistry* ; Liver/drug effects* ; Humans ; Cholesterol 7-alpha-Hydroxylase/genetics* ; Plant Extracts

This study aimed to investigate the effects of caffeoylquinic acids from Erigeron breviscapus(EBCQA) on cognitive impairment and mitochondrial dysfunction in Alzheimer's disease(AD), and to explore its underlying mechanisms. The impacts of EBCQA on paralysis, β-amyloid(Aβ) oligomerization, and mRNA expression of mitophagy-related genes [PTEN-induced putative kinase 1(PINK1) homolog-encoding gene pink-1, Parkin homolog-encoding gene pdr-1, Bcl-2 interacting coiled-coil protein 1(Beclin 1) homolog-encoding gene bec-1, microtubule-associated protein 1 light chain 3(LC3) homolog-encoding gene lgg-1, autophagic adapter protein 62(p62) homolog-encoding gene sqst-1] were examined in the AD Caenorhabditis elegans CL4176 model, along with mitochondrial functions including adenosine triphosphate(ATP) content, enzyme activities of mitochondrial respiratory chain complexes Ⅰ,Ⅲ, and Ⅳ, and mitochondrial membrane potential. Additionally, the effects of EBCQA on the green fluorescent protein(GFP)/red fluorescent protein from Discosoma sp.(DsRed) ratio, the expression of phosphatidylethanolamine-modified and GFP-labeled LGG-1(PE-GFP::LGG-1)/GFP-labeled LGG-1(GFP::LGG-1), and GFP-labeled SQST-1(GFP::SQST-1) proteins were investigated in transgenic C. elegans strains. The effect of EBCQA on paralysis was further evaluated after RNA interference(RNAi)-mediated suppression of the pink-1 and pdr-1 genes in CL4176 strain. An AD rat model was established through intraperitoneal injection of D-galactose and intragastric administration of aluminum trichloride. The effects of β-nicotinamide mononucleotide(NMN) and EBCQA on learning and memory ability, neuronal morphology, mitophagy occurrence, mitophagy-related protein expression(PINK1, Parkin, Beclin 1, LC3-Ⅱ/LC3-Ⅰ, p62), and mitochondrial functions(ATP content; enzyme activities of mitochondrial respiratory chain complexes Ⅰ, Ⅲ, and Ⅳ; mitochondrial membrane potential) were investigated in this AD rat model. The results showed that EBCQA delayed paralysis onset in the CL4176 strain, reduced Aβ oligomer formation, and upregulated the mRNA expression levels of lgg-1, bec-1, pink-1, and pdr-1, while downregulating sqst-1 mRNA expression. EBCQA also enhanced ATP content, mitochondrial membrane potential, and the activities of mitochondrial respiratory chain complexes Ⅰ, Ⅲ, and Ⅳ. Furthermore, EBCQA improved the PE-GFP::LGG-1/GFP::LGG-1 ratio, reduced GFP::SQST-1 expression, and decreased the GFP/DsRed ratio. Notably, the ability of EBCQA to delay paralysis was significantly reduced following RNAi-mediated suppression of pink-1 and pdr-1 in CL4176 strain. In AD rats, the administration of NMN or EBCQA significantly improved learning and memory, restored neuronal morphology in the hippocampus, increased autophagosome numbers, and upregulated the expression of PINK1, Parkin, Beclin 1, and the LC3-Ⅱ/LC3-Ⅰ ratio, while reducing p62 expression. Additionally, the treatment with NMN or EBCQA both elevated ATP content, mitochondrial respiratory chain complex Ⅰ, Ⅲ, and Ⅳ activities, and mitochondrial membrane potential in the hippocampus. The above findings indicate that EBCQA improves cognitive impairment and mitochondrial dysfunction in AD, possibly through activation of PINK1/Parkin-mediated mitophagy.
Animals ; Alzheimer Disease/psychology* ; Mitophagy/drug effects* ; Mitochondria/genetics* ; Caenorhabditis elegans/metabolism* ; Ubiquitin-Protein Ligases/genetics* ; Cognitive Dysfunction/physiopathology* ; Rats ; Protein Kinases/genetics* ; Humans ; Male ; Disease Models, Animal ; Caenorhabditis elegans Proteins/genetics* ; Drugs, Chinese Herbal/administration & dosage*

The precise and rapid monitoring of multiple organ dysfunction is crucial in drug discovery. Traditional methods, such as pathological analysis, are often time-consuming and inefficient. Here, we developed a multiplexed near-infrared window two (NIR-II) fluorescent bioimaging method that allows for real-time, rapid, and quantitative assessment of multiple organ dysfunctions. Given that existing probes did not fully meet requirements, we synthesized a range of NIR-II hemicyanine dyes (HDs) with varying absorption and emission wavelengths. By modifying these dyes, we achieved high spatial and temporal resolution imaging of the liver, kidneys, stomach, and intestines. This method was further applied to investigate disorders induced by cisplatin, a drug known to cause gastric emptying issues along with liver and kidney injuries. By monitoring the metabolic rate of the dyes in these organs, we accurately quantified multi-organ dysfunction, which was also confirmed by gold-standard pathological analysis. Additionally, we evaluated the effects of five aristolochic acids (AAs) on multiple organ dysfunction. For the first time, we identified that AA-I and AA-II could cause gastric emptying disorders, which was further validated through transcriptomics analysis. Our study introduces a novel approach for the simultaneous monitoring of multi-organ dysfunction, which may significantly enhance the evaluation of drug side effects.

Objective:To explore the efficacy and safety of olverembatinib in treatment of chronic myeloid leukemia (CML) progressed to acute lymphoblastic leukemia with D241E mutation.Methods:The diagnosis and treatment of a patient with D241E mutant CML progressed to acute lymphoblastic leukemia admitted to the Fourth People's Hospital of Jinan in December 2018 were retrospectively analyzed, and relevant literature was reviewed.Results:The patient was a 47-year-old female, and her blood test result was abnormal during physical examination. She was diagnosed as CML and received treatment with imatinib and dasatinib for 2 years. The disease progressed to philadelphia chromosome (Ph)-positive acute B-lymphoblastic leukemia with BCR-ABL mutation (a D241E mutation). After 3 courses of chemotherapy combined with a targeted drug (ponatinib), the patient achieved complete remission, while the minimal residual disease continued to be positive. The patient received 1 course of chemotherapy combined with olverembatinib from the 4th course of treatment. After olverembatinib monotherapy maintenance therapy for 36 months, the patient achieved molecular complete remission with minimal residual disease. The patient developed complications such as skin pigmentation and elevated lipid levels, but all complications were tolerable.Conclusions:The application of olverembatinib in D241E mutant CML progressed to acute lymphoblastic leukemia can help patients obtain sustained molecular biological remission and good safety.

Objective:To investigate the efficacy and safety of selective dorsal rhizotomy with small incision under electrophysiological monitoring in lower limb spasticity.Methods:Twenty patients with lower limb spasticity due to craniocerebral injury admitted to Department of Neurosurgery,Tianjin Huanhu Hospital from January 2019 to December 2023 were selected. Target muscles (Ashworth Scale graded 1 + or higher) were identified preoperatively. Intraoperatively, the lower L 1 spinous process and the upper L 2 spinous process were resected to expose the cauda equina nerves. A bipolar stimulator was applied to electrically stimulate the cauda equina nerves root by root to identify the sensory nerves of the target muscles; subsequently, strings of electrical stimulation were given, 50% cauda equina nerves were cut off if no contraction of the contralateral muscles was seen, and 75% were cut off if contraction of the contralateral muscles was noted. Motor function and muscle tension were assessed and compared before and 6 months after surgery by Gross Motor Function Measure (GMFM)-66, Gross Motor Function Classification System (GMFCS), and Ashworth spasticity scale. Complications early after surgery and 6 months after surgery were observed. Results:The most common targeted muscles in these 20 patients included the gastrocnemius (the medial and lateral side, n=20), followed by the biceps femoris ( n=12) and the adductor muscles of thigh ( n=9). Number of nerves intraoperatively cut in patients with GMFCS grading 1-4 was 5.40±1.84, 9.50±6.36, 11.67±5.86, and 14.00±5.66, respectively, with significant differences ( F=5.506 , P=0.009). Grading of Ashworth spasticity scale of the target muscles before surgery in these 20 patients showed significant difference compared with that at 6 months after surgery ( P<0.05), and average rank indicated that Ashworth spasticity scale of target muscles 6 months after surgery was graded obviouly better than that before surgery. In addition, the GMFM-66 total scores and major joint motion scores of the patients 6 months after surgery were significantly higher than those before surgery ( P<0.05). Fifteen patients had fever early after surgery, 18 patients had incisional pain, and 1 patient developed reversible hypesthesia of the lower extremities; these symptoms disappeared 0.5-4.0 years after surgery. No patients developed lower limb hypokinesia, urinary and defecation disorders, or spinal deformities. Conclusion:Selective dorsal rhizotomy with small incision under electrophysiological monitoring used in this study can effectively reduce surgical trauma and relieve lower limb spasticity due to craniocerebral injury, enjoying high surgical safety.

Objective:To observe any effects of repetitive high-frequency transcranial magnetic stimulation (rTMS) on the upper limb motor function of stroke survivors with right hemiplegia.Methods:Forty stroke survivors with right hemiplegia were divided at random into a high-frequency rTMS group and a sham stimulation group, each of 20. In addition to routine rehabilitation, the high-frequency rTMS group was given daily high-frequency rTMS 5d per week for 2 weeks, while the sham stimulation group was provided with sham rTMS. Before and after the treatment, both groups were evaluated using the Fugl-Meyer Upper Extremity motor function evaluation scale (FMA-UE), surface electromyography (sEMG), and electroencephalographic microstatus testing. Any adverse reactions in the course of the treatment were recorded.Results:After the treatment, the average FMA-UE scores of both groups had improved significantly, with the average of the high-frequency rTMS group significantly higher than the other group′s average. After the treatment the peak-to-peak sEMG value of the radial long extensor carpi radialis longus muscle in the high-frequency rTMS group was significantly higher than before the treatment and significantly higher than that of the other group. The temporal coverage of microstate B, the average duration and temporal coverage of microstate C, and the temporal coverage and frequency of occurrence of microstate D after treatment of both groups were also significantly improved. The mean duration of electroencephalographic (EEG) microstate A was negatively correlated with the FMA-UE scale scores ( r=-0.57) and its temporal coverage was positively correlated with the peak-to-peak sEMG value of the ulnar lateral wrist flexor. The mean duration of EEG microstate B was positively correlated with the peak-to-peak sEMG value of the triceps brachii and deltoid, and the mean duration of EEG microstate C was also positively correlated with the peak-to-peak sEMG value of the deltoid muscle. Conclusions:High-frequency rTMS can effectively improve the upper limb motor functioning of stroke survivors with right hemiparesis. After high-frequency rTMS, the functional network activity related to EEG microstate B increases significantly, while that related to microstates C and D decreases significantly.