AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

This study aims to investigate the potential effect of the water extract of fresh Rehmanniae Radix on hypercholesterolemia in mice that was induced by a high-fat and high-cholesterol diet and explore its possible mechanism from bile acid reabsorption. Male C57BL/6 mice were randomly assigned into the following groups: control, model, low-and high-dose(4 and 8 g·kg~(-1), respectively) fresh Rehmanniae Radix, and positive drug(simvastatin, 0.05 g·kg~(-1)). Other groups except the control group were fed with a high-fat and high-cholesterol diet for 6 consecutive weeks to induce hypercholesterolemia. From the 6th week, mice were administrated with corresponding drugs daily via gavage for additional 6 weeks, while continuing to be fed with a high-fat and high-cholesterol diet. Serum levels of total cholesterol(TC), triglycerides(TG), low density lipoprotein-cholesterol(LDL-c), high density lipoprotein-cholesterol(HDL-c), and total bile acid(TBA), as well as liver TC and TG levels and fecal TBA level, were determined by commercial assay kits. Hematoxylin-eosin(HE) staining, oil red O staining, and transmission electron microscopy were performed to observe the pathological changes in the liver. Three livers samples were randomly selected from each of the control, model, and high-dose fresh Rehmanniae Radix groups for high-throughput transcriptome sequencing. Differentially expressed genes were mined and KEGG pathway enrichment analysis was performed to predict the key pathways and target genes of the water extract of fresh Rehmanniae Radix in the treatment of hypercholesterolemia. RT-qPCR was employed to measure the mRNA levels of cholesterol 7α-hydroxylase(CYP7A1) and cholesterol 27α-hydroxylase(CYP27A1) in the liver. Western blot was employed to determine the protein levels of CYP7A1 and CYP27A1 in the liver as well as farnesoid X receptor(FXR), apical sodium-dependent bile acid transporter(ASBT), and ileum bile acid-binding protein(I-BABP) in the ileum. The results showed that the water extract of fresh Rehmanniae Radix significantly lowered the levels of TC and TG in the serum and liver, as well as the level of LDL-c in the serum. Conversely, it elevated the level of HDL-c in the serum and TBA in feces. No significant difference was observed in the level of TBA in the serum among groups. HE staining, oil red O staining, and transmission electron microscopy showed that the water extract reduced the accumulation of lipid droplets in the liver. Further mechanism studies revealed that the water extract of fresh Rehmanniae Radix significantly down-regulated the protein levels of FXR and bile acid reabsorption-related proteins ASBT and I-BABP. Additionally, it enhanced CYP7A1 and CYP27A1, the key enzymes involved in bile acid synthesis. Therefore, it is hypothesized that the water extract of fresh Rehmanniae Radix may exert an anti-hypercholesterolemic effect by regulating FXR/ASBT/I-BABP signaling, inhibiting bile acid reabsorption, and increasing bile acid excretion, thus facilitating the conversion of cholesterol to bile acids.
Animals ; Male ; Bile Acids and Salts/metabolism* ; Mice, Inbred C57BL ; Mice ; Diet, High-Fat/adverse effects* ; Cholesterol/metabolism* ; Drugs, Chinese Herbal/administration & dosage* ; Hypercholesterolemia/genetics* ; Receptors, Cytoplasmic and Nuclear/genetics* ; Rehmannia/chemistry* ; Liver/drug effects* ; Humans ; Cholesterol 7-alpha-Hydroxylase/genetics* ; Plant Extracts

This study aimed to investigate the effects of caffeoylquinic acids from Erigeron breviscapus(EBCQA) on cognitive impairment and mitochondrial dysfunction in Alzheimer's disease(AD), and to explore its underlying mechanisms. The impacts of EBCQA on paralysis, β-amyloid(Aβ) oligomerization, and mRNA expression of mitophagy-related genes [PTEN-induced putative kinase 1(PINK1) homolog-encoding gene pink-1, Parkin homolog-encoding gene pdr-1, Bcl-2 interacting coiled-coil protein 1(Beclin 1) homolog-encoding gene bec-1, microtubule-associated protein 1 light chain 3(LC3) homolog-encoding gene lgg-1, autophagic adapter protein 62(p62) homolog-encoding gene sqst-1] were examined in the AD Caenorhabditis elegans CL4176 model, along with mitochondrial functions including adenosine triphosphate(ATP) content, enzyme activities of mitochondrial respiratory chain complexes Ⅰ,Ⅲ, and Ⅳ, and mitochondrial membrane potential. Additionally, the effects of EBCQA on the green fluorescent protein(GFP)/red fluorescent protein from Discosoma sp.(DsRed) ratio, the expression of phosphatidylethanolamine-modified and GFP-labeled LGG-1(PE-GFP::LGG-1)/GFP-labeled LGG-1(GFP::LGG-1), and GFP-labeled SQST-1(GFP::SQST-1) proteins were investigated in transgenic C. elegans strains. The effect of EBCQA on paralysis was further evaluated after RNA interference(RNAi)-mediated suppression of the pink-1 and pdr-1 genes in CL4176 strain. An AD rat model was established through intraperitoneal injection of D-galactose and intragastric administration of aluminum trichloride. The effects of β-nicotinamide mononucleotide(NMN) and EBCQA on learning and memory ability, neuronal morphology, mitophagy occurrence, mitophagy-related protein expression(PINK1, Parkin, Beclin 1, LC3-Ⅱ/LC3-Ⅰ, p62), and mitochondrial functions(ATP content; enzyme activities of mitochondrial respiratory chain complexes Ⅰ, Ⅲ, and Ⅳ; mitochondrial membrane potential) were investigated in this AD rat model. The results showed that EBCQA delayed paralysis onset in the CL4176 strain, reduced Aβ oligomer formation, and upregulated the mRNA expression levels of lgg-1, bec-1, pink-1, and pdr-1, while downregulating sqst-1 mRNA expression. EBCQA also enhanced ATP content, mitochondrial membrane potential, and the activities of mitochondrial respiratory chain complexes Ⅰ, Ⅲ, and Ⅳ. Furthermore, EBCQA improved the PE-GFP::LGG-1/GFP::LGG-1 ratio, reduced GFP::SQST-1 expression, and decreased the GFP/DsRed ratio. Notably, the ability of EBCQA to delay paralysis was significantly reduced following RNAi-mediated suppression of pink-1 and pdr-1 in CL4176 strain. In AD rats, the administration of NMN or EBCQA significantly improved learning and memory, restored neuronal morphology in the hippocampus, increased autophagosome numbers, and upregulated the expression of PINK1, Parkin, Beclin 1, and the LC3-Ⅱ/LC3-Ⅰ ratio, while reducing p62 expression. Additionally, the treatment with NMN or EBCQA both elevated ATP content, mitochondrial respiratory chain complex Ⅰ, Ⅲ, and Ⅳ activities, and mitochondrial membrane potential in the hippocampus. The above findings indicate that EBCQA improves cognitive impairment and mitochondrial dysfunction in AD, possibly through activation of PINK1/Parkin-mediated mitophagy.
Animals ; Alzheimer Disease/psychology* ; Mitophagy/drug effects* ; Mitochondria/genetics* ; Caenorhabditis elegans/metabolism* ; Ubiquitin-Protein Ligases/genetics* ; Cognitive Dysfunction/physiopathology* ; Rats ; Protein Kinases/genetics* ; Humans ; Male ; Disease Models, Animal ; Caenorhabditis elegans Proteins/genetics* ; Drugs, Chinese Herbal/administration & dosage*

The precise and rapid monitoring of multiple organ dysfunction is crucial in drug discovery. Traditional methods, such as pathological analysis, are often time-consuming and inefficient. Here, we developed a multiplexed near-infrared window two (NIR-II) fluorescent bioimaging method that allows for real-time, rapid, and quantitative assessment of multiple organ dysfunctions. Given that existing probes did not fully meet requirements, we synthesized a range of NIR-II hemicyanine dyes (HDs) with varying absorption and emission wavelengths. By modifying these dyes, we achieved high spatial and temporal resolution imaging of the liver, kidneys, stomach, and intestines. This method was further applied to investigate disorders induced by cisplatin, a drug known to cause gastric emptying issues along with liver and kidney injuries. By monitoring the metabolic rate of the dyes in these organs, we accurately quantified multi-organ dysfunction, which was also confirmed by gold-standard pathological analysis. Additionally, we evaluated the effects of five aristolochic acids (AAs) on multiple organ dysfunction. For the first time, we identified that AA-I and AA-II could cause gastric emptying disorders, which was further validated through transcriptomics analysis. Our study introduces a novel approach for the simultaneous monitoring of multi-organ dysfunction, which may significantly enhance the evaluation of drug side effects.

Objective To investigate the correlation between interleukin 1β gene-511C/T polymorphism of and essential hypertension in the Yi ethnic group of Yunnan province.Methods-511C/T polymorphism of interleukin 1β gene was detected by PCR-RFLP in 85 Yi patients with essential hypertension(EH group)and 106 Yi healthy people(control group)in Shuanghe Township,Jinning County,Yunnan Province.Genotype and allele frequencies were analyzed by SPSS 27.0 software,and association analysis was performed.Results The frequency distribution of CC,CT and TT genotypes at the mutation site 511 of the IL-1βgene in EH group was 18.82%,44.71%and 36.47%,respectively,and it was 5.66%,26.42%and 67.92%in the control group.The difference in genotype frequency between the two groups was statistically significant(P＜0.05).The allele frequency of C and T in EH group was 41.18%and 58.82%,respectively,and the allele frequency of C and T in control group was 18.87%and 81.13%.The frequency difference of alleles between the two groups was statistically significant(P＜0.05).Both genotype frequency and allele frequency found in males and females had statistical differences(P＜0.05).Conclusions The distribution of IL-1β gene-511C/T polymorphism is related to the incident of essential hyper-tension among the Yi ethnic group Yunnan Province,and is the susceptibility gene of the Yi ethnic group to essen-tial hypertension.

Objective:To investigate the prevalence of adult skeletal fluorosis caused by drinking tea-type endemic fluorosis in Yushu Tibetan Autonomous Prefecture (hereinafter referred to as Yushu Prefecture), Qinghai Province, and provide scientific basis for prevention and control of the disease.Methods:In August 2021, one village was selected as a survey site in six counties (cities) in Yushu Prefecture, including Nangqian, Chindu, Yushu, Zadoi, Qumarlêb, and Zhiduo. Drinking water samples and 10 brick tea samples were collected from each village to determine the fluoride content in water and brick tea; at least 100 permanent residents aged ≥ 25, who had a habit of drinking brick tea and had lived in the local area for more than 5 years, were selected for X-ray imaging to examine the prevalence of adult skeletal fluorosis.Results:A total of 75 samples of residential drinking water were collected, with a fluoride content of (0.21 ± 0.05) mg/L, ranging from 0.11 to 0.34 mg/L; 60 samples of brick tea, with a fluoride content of (626.70 ± 157.27) mg/kg, ranging from 324.00 to 2 102.00 mg/kg. A total of 1 136 adults were examined, and 318 cases of skeletal fluorosis were diagnosed, with a detection rate of 27.99%. Among them, the detection rates of mild, moderate, and severe skeletal fluorosis were 20.95% (238/1 136), 6.07% (69/1 136), and 0.97% (11/1 136), respectively, with mild symptoms being the main. The detection rates of skeletal fluorosis in males and females were 29.09% (121/416) and 27.36% (197/720), respectively, with no statistically significant difference between the gender (χ 2 = 0.39, P = 0.533). Comparison of the skeletal fluorosis in different gender, the differences were statistically significant (χ 2 = 22.31, P < 0.001). The detection rates of skeletal fluorosis in the age groups of 25 - 35, 36 - 45, 46 - 55, 56 - 65, 66 - 75, and ≥76 years old were 6.86% (7/102), 22.37% (51/228), 24.02% (92/383), 37.44% (73/195), 43.48% (70/161), and 37.31% (25/67), respectively. The differences between the groups were statistically significant (χ 2 = 59.84, P < 0.001). Moreover, there was a statistically significant difference in the composition of skeletal fluorosis among different age groups ( H = 37.66, P < 0.001). The Spearman correlation analysis results showed that the severity of adult skeletal fluorosis was positively correlated with age ( r = 0.34, P < 0.001). Conclusions:There is a certain degree of prevalence of adult skeletal fluorosis in Yushu Prefecture. And as age increases, the condition of skeletal fluorosis becomes more severe.

italic>Salvia miltiorrhiza, a commonly used traditional Chinese medicine, has been widely recognized for its blood-activating and stasis-removing properties in the clinical treatment of cardiovascular and cerebrovascular diseases. The synthesis and regulatory mechanism of tanshinones, the key active constituents of Salvia miltiorrhiza, have been a hot topic of research. The paper summarized the research findings on the regulation of tanshinone biosynthesis by transcription factors such as AP2/ERF, bHLH, MYB, bZIP, and WRKY in recent years. The review identifies the existing issues in the transcriptional regulation studies of Salvia miltiorrhiza and discusses the research direction of transcription factors in the regulation of tanshinone biosynthesis, providing a theoretical basis for the further discovery and utilization of functional genes involved in the regulation of tanshinone bioactive constituents.

AIM To explore the mechanism of Yiqi Wenyang Huwei Decoction on airway inflammation improvement of rats with bronchial asthma based on IL-25/NF-κB signaling pathway.METHODS 60 rats were randomly divided into the control group,the model group,the dexamethasone group(0.2 mg/mL),the low-dose,medium-dose and high-dose Yiqi Wenyang Huwei Decoction groups(1,2,4 g/mL),with 10 rats in each group.Intraperitoneal injection of ovalbumin(OVA)and aluminum hydroxide suspension was applied to establish the rat asthma model,followed by 2-week corresponding dosing of the drugs.The rats of each group had their daily diet,mental status,hair growth and respiration observed;their differential count of inflammatory cells in bronchoalveolar lavage fluid(BALF)detected by automatic hematology analyzer;their pathological changes of lung tissue observed by HE staining;their pulmonary IL-25 protein expression detected by immunohistochemistry(IHC);their levels of IL-4,IL-5 and IL-13 in BALF measured by ELISA;their pulmonary expression of IL-25 and TRAF6 mRNA detected by RT-qPCR;and their pulmonary protein expressions of IL-25,TRAF6,IκBα,p-IκBα,NF-κB p65 and p-NF-κB p65 detected by Western blot.RESULTS Compared with the control group,the model group displayed severe damage of the lung tissue and infiltration of a large number of inflammatory cells;increased number of inflammatory cells and levels of IL-4,IL-5 and IL-13 in BALF(P<0.01);increased mRNA expressions of IL-25 and TRAF6,and pulmonary protein expressions of IL-25,TRAF6,p-IκBα/IκBα and p-NF-κB p65/NF-κB p65(P<0.01).Compared with the model group,all of the Yiqi Wenyang Huwei Decoction groups shared improved pulmonary infiltration of inflammatory cells;decreased number of inflammatory cells and levels of IL-4,IL-5 and IL-13 in BALF(P<0.05,P<0.01);and decreased mRNA expressions of IL-25 and TRAF6,and pulmonary protein expressions of IL-25,TRAF6,p-IκBα/IκBα and p-NF-κB p65/NF-κB p65(P<0.01).CONCLUSION Yiqi Wenyang Huwei Decoction can inhibit the airway inflammation in the rat model of bronchial asthma,which may be related to the inhibited activation of IL-25/NF-κB signaling pathway and the reduced expression of inflammatory factors.