ObjectiveTo investigate the effect of quercetin on acute gouty arthritis （GA） in rats by inhibiting the reactive oxygen species （ROS）/NOD-like receptor protein 3 （NLRP3）/interleukin-1β （IL-1β） signaling pathway. MethodsSixty SPF-grade male SD rats were randomized into normal， model， colchicine （0.3 mg·kg^-1）， and low-， medium-， and high-dose （25， 50， 100 mg·kg^-1， respectively） quercetin groups （n=10）. The rats in the dosing groups were administrated with the corresponding drugs （10 mL·kg^-1） by gavage once a day for one week. An equal volume of normal saline was given by gavage to rats in normal and model groups. One hour after drug administration on day 5， an acute GA model was established in other groups except the control group via intra-articular injection of monosodium urate （MSU） suspension into the right posterior ankle joint cavity. The joint swelling and gait were scored at the time points of 6， 12， 24， 48 h after modeling. Histopathological alterations in the ankle joint tissue from each group were assessed by hematoxylin-eosin （HE） staining. Malondialdehyde （MDA）， xanthine oxidase （XOD）， and total superoxide dismutase （T-SOD） assay kits were used to assess the levels of MDA， XOD， and T-SOD in the serum. The levels of tumor interleukin-6 （IL-6）， necrosis factor-α （TNF-α）， and IL-1β in the rat serum， as well as ROS in the ankle joint tissue， were measured by enzyme-linked immunosorbent assay （ELISA）. Western blot was performed to determine the protein levels of NLRP3， thioredoxin-interacting protein （TXNIP）， apoptosis-associated speck-like protein containing a CARD domain （ASC）， precursor cysteinyl aspartate-specific proteinase-1 （pro-Caspase-1）， cleaved Caspase-1 （Caspase-1 p20）， and IL-1β in the ankle joint tissue. Real-time PCR was employed to assess the mRNA levels of TXNIP， NLRP3， ASC， IL-1β， and TNF-α in the ankle joint tissue. ResultsCompared with the normal group， the model group exhibited decreased spontaneous activity， mental fatigue， increased ankle joint swelling and gait scores （P<0.01）， aggravated synovial tissue edema and inflammatory cell infiltration （P<0.01）， elevated levels of XOD， MDA， TNF-α， IL-1β， and IL-6 in the serum and ROS in the joint tissue （P<0.01）， a declined level of T-SOD （P<0.01）， up-regulated protein levels of NLRP3， TXNIP， ASC， pro-Caspase-1， Caspase-1 p20， and IL-1β in the ankle joint tissue （P<0.01）， and up-regulated mRNA levels of NLRP3， TXNIP， ASC， IL-1β， and TNF-α in the ankle joint tissue （P<0.01）. Compared with the model group， the medium- and high-dose quercetin groups showed improved general conditions， decreased gait scores （P<0.05， P<0.01）， reduced joint swelling （P<0.01）， alleviated synovial tissue edema and inflammatory cell infiltration （P<0.05， P<0.01）， lowered levels of XOD， MDA， TNF-α， IL-1β， and IL-6 in the serum and ROS in the joint tissue （P<0.01）， increased levels of T-SOD （P<0.01）， down-regulated protein levels of TXNIP， NLRP3， ASC， pro-Caspase-1， Caspase-1 p20， and IL-1β in the ankle joint tissue （P<0.05， P<0.01）， and down-regulated mRNA levels of TXNIP， NLRP3， ASC， IL-1β， and TNF-α in the ankle joint tissue （P<0.01）. Low-dose quercetin also ameliorated some of the above parameters （P<0.05， P<0.01）. ConclusionQuercetin exerts anti-GA effects by blocking the ROS/NLRP3/IL-1β signaling pathway， downregulating NLRP3 inflammasome activation， and inhibiting the production of pro-inflammatory cytokines including TNF-α， IL-1β， and IL-6.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

Chronic obstructive pulmonary disease （COPD） is a chronic respiratory disease that poses a significant threat to global health， exhibiting high morbidity， disability and mortality rate， with its prevention and treatment situation becoming increasingly critical. The pathogenesis of COPD is complex， and the underlying cellular and molecular biological mechanisms remain incompletely elucidated. Programmed cell death （PCD） is the process wherein cells actively undergo demise to maintain internal environmental stability in response to certain signals or specific stimuli. Contemporary medical research indicates that the dysregulation of PCD patterns such as apoptosis， necroptosis， pyroptosis， autophagy， and ferroptosis is closely related to the onset and progression of COPD. Clarifying the molecular mechanisms of PCD in COPD may provide novel perspectives for in-depth understanding and prevention of the disease. Traditional Chinese medicine （TCM） is characterized by holistic regulation. In recent years， extensive research has been conducted in the TCM field focusing on modulating apoptosis， necroptosis， pyroptosis， autophagy， and ferroptosis for the treatment of COPD， yielding remarkable achievements. Therefore， this study systematically explored the molecular mechanism of PCD in COPD and reviewed the potential mechanisms and intervention status of TCM targeting PCD in COPD， aiming to provide insights and references for the clinical prevention， treatment and in-depth research of COPD.

BACKGROUND:3D-printed bone tissue engineering scaffolds have obvious advantages in the research and clinical treatment of bone defect repair.As one of the important raw materials for 3D printed bone scaffolds,poly-L-lactic acid has a great potential for application in performing bone defect repair,but clinical patients with different bone defect causative factors have different requirements for the comprehensive performance of poly-L-lactic acid bone scaffolds.OBJECTIVE:To summarize and review the development of 3D printing technology and poly-L-lactic acid scaffolds and the design strategies chosen for scaffolds for bone repair in the setting of bone diseases such as osteomyelitis,bone tumor,osteonecrosis,and osteoporosis.METHODS:Literature from CNKI,WanFang,PubMed,Science Direct,and Web of Science databases were searched and screened from 1994 to 2024.Search terms were"3D printing,polylactic acid,bone tissue engineering scaffold,osteomyelitis,bone tumor,osteonecrosis,osteoporosis,bone defect"in Chinese and English.The screened 62 articles were systematically summarized and analyzed.RESULTS AND CONCLUSION:(1)Poly-L-lactic acid is considered to be an ideal raw material for artificial bone scaffold design due to its non-toxicity,processability,biocompatibility,and ability to self-degrade in the human environment.The application of 3D printing technology has enabled poly-L-lactic acid bone scaffolds to meet the multilayered and porous structural design requirements of biomimetic artificial bone repair materials,and to optimize the mechanical properties for better bone repair.(2)According to different bone disease microenvironments,timely adjustment of the functional design of poly-L-lactic acid scaffolds is important for the comprehensive osteogenic efficacy of the scaffolds.The article discusses the application of poly-L-lactic acid scaffolds in bone disease environments such as osteomyelitis,bone tumor,osteonecrosis,and osteoporosis,and highlights the importance of rationally grasping the timing of bone disease treatment and bone tissue regeneration for bone defects caused by different bone diseases.(3)Although poly-L-lactic acid scaffolds show potential in bone repair,there are still some problems,such as the need to further optimize the structural design of the scaffolds to fit new bone regeneration,enhance the bioactivity of the scaffolds,and take into account other functions(e.g.,antimicrobial,anti-tumor,and anti-osteoporosis)in order to adapt to the needs of bone tissue repair in different pathological environments.

BACKGROUND:Age-related macular degeneration and deep vein thrombosis may share common pathophysiological mechanisms,but there is a lack of direct evidence regarding their relationship.Traditional studies are confounded by confounding factors and reverse causation.OBJECTIVE:To investigate the causal relationship between age-related macular degeneration and deep vein thrombosis based on Mendelian randomization design.METHODS:Through a two-way Mendelian randomization analysis,single nucleotide polymorphisms of exposure and outcomes were obtained from publicly available genome-wide association studies,with deep vein thrombosis data from the FinnGen database in a European population with a sample size of 363 612 and 1 048 575 single nucleotide polymorphisms.In addition,we obtained data on age-related macular degeneration from the IEUOpenGWAS project,also from a European population sample of 105 248 cases covering 11 304 110 single nucleotide polymorphisms.In R4.4.1,we used the TwoSampleMR package(version 0.6.8)to explore the causal effects of exposure factors on outcomes.At the same time,we also conducted a sensitivity analysis via MR-Egger regression,weighted median,weighted model and simple model methods to ensure that the assessment results were robust and reliable.In addition,we used the"heterogeneity"function to test for heterogeneity,and the"horizontal pleiotropy"function and the MR-PRESSO test to further assess horizontal pleotropy.The Cochran's Q test was used to determine whether there was statistical heterogeneity between single nucleotide polymorphisms,and the leave-one-out method was used to assess whether single nucleotide polymorphisms would significantly interfere with Mendelian randomization analysis.Funnel plots were drawn to assess the potential bias of single nucleotide polymorphisms.Forest plots were plotted to show the effect estimates of single nucleotide polymorphisms on exposure and outcomes,and their confidence intervals were plotted.Scatter plots were plotted to evaluate the relationship between the potency of single nucleotide polymorphisms and their causal effect size on outcome estimates.RESULTS AND CONCLUSION:Both forward and reverse studies showed that there was no causal association between age-related macular degeneration and the occurrence of deep vein thrombosis(P＞0.05).Sensitivity analysis showed that the main analysis results were reliable and robust,with no outliers,heterogeneity,and horizontal pleiotropy,and no single nucleotide polymorphism significantly affected the overall effect estimate.Although it is based on European population data,it has methodological reference value for Chinese biomedical research on complex disease associations.In this field,China can carry out multi-center large-sample studies,accurately analyze the internal links between Chinese population-related diseases,and provide a basis for prevention and treatment strategies and clinical practice.

BACKGROUND:The incidence rate of chronic non-specific neck pain is high and the etiology is unknown.Myofascial pain and deep cervical flexor atrophy are the key factors.Extracorporeal shockwave therapy can improve microcirculation,relieve local pain,and delay the degenerative development of the cervical spine,while motion control training can significantly improve neck muscle strength and endurance and reduce neck pain.However,both methods have limited effectiveness when applied individually.OBJECTIVE:To explore the therapeutic efficacy of extracorporeal shock wave intervention combined with motion control training at the upper trapezius muscle on chronic non-specific neck pain.METHODS:Forty-two patients with chronic non-specific neck pain recruited from Shenyang Sport University were randomly divided into three groups:a shock wave group(n=14),in which extracorporeal shockwave intervention at the upper trapezius muscle was given for 10-15 minutes,once a week for 4 weeks;a training group(n=14),in which motion control training was given for 40-50 minutes,three times a week for 4 weeks;and a combination group(n=14),in which extracorporeal shockwave intervention at the upper trapezius muscle combined with motion control training was performed for 4 weeks.Patients were assessed for pain intensity,cervical spine function,upper trapezius muscle thickness,hemodynamic parameters,and serum interleukin 6 and tumor necrosis factor α levels before intervention,1 week and 4 weeks after intervention.RESULTS AND CONCLUSION:(1)Compared with the pre-intervention period,the visual analogue scale scores and neck disability index in the three groups were lower after 1 and 4 weeks of intervention(P＜0.05),and the visual analogue scale scores and neck disability index in the combination group were lower than those of the shock wave group and the training group(P＜0.05).(2)Compared with the pre-intervention period,the upper trapezius thickness increased in the training group and the combination group after 4 weeks of intervention(P＜0.05);the upper trapezius thickness was greater in the combination group than in the shock wave group and the training group after 4 weeks of intervention(P＜0.05).(3)The shock wave group and the combination group had an increase in the peak systolic velocity of the ascending segment of the transverse carotid artery(P＜0.05)and a decrease in the resistance index(P＜0.05)after 1 and 4 weeks of intervention,while the training group showed an increase in the peak systolic velocity of the ascending segment of the transverse carotid artery(P＜0.05)and a decrease in the resistance index(P＜0.05)after 4 weeks of intervention.The peak systolic velocity of the ascending segment of the transverse carotid artery in the combination group was higher(P＜0.05)and the resistance index was lower(P＜0.05)than those in the shockwave group and the training group after 1 and 4 weeks of intervention.(4)Compared with the pre-intervention period,the levels of interleukin 6 and tumor necrosis factor α were reduced in the shock wave and combination groups after 1 and 4 weeks of intervention(P＜0.05),and in the training group after 4 weeks of intervention(P＜0.05).After 1 and 4 weeks of intervention,the levels of interleukin 6 and tumor necrosis factor α were lower in the combination group than in the shock wave group and the training group(P＜0.05).To conclude,extracorporeal shock wave combined with motion control training for chronic non-specific neck pain significantly reduces pain and improves neck function,and the mechanism of action may be to promote the blood flow velocity at the trigger point,reduce blood flow resistance,reduce the serum levels of interleukin 6 and tumor necrosis factor α,and increase the thickness of the upper trapezius muscle.

ObjectivePancreatic ductal adenocarcinoma (PDAC) exhibits a limited response to current treatments due to its dense fibrotic stroma and highly immunosuppressive tumor microenvironment. In recent years, advancements in cellular immunotherapy, particularly chimeric antigen receptor macrophage (CAR-M) therapy, have offered new hope for pancreatic cancer treatment. Although CAR-M therapy demonstrates dual potential in directly killing tumor cells and remodeling the immune microenvironment, it still faces challenges such as complex in vitro preparation processes and low in vivo targeting and delivery efficiency. Therefore, developing strategies for efficient and targeted in vivo delivery of CAR genes has become crucial for overcoming current therapeutic limitations. This study aims to develop an orally administrable nano-gene delivery system for the targeted delivery of CAR genes to pancreatic tumor sites. MethodsCore nano-gene particles (PNP/pCAR) were constructed by loading plasmid DNA encoding CAR (pCAR) with cationic polypeptides (PNP). Subsequently, PNP/pCAR was surface-modified with β-glucan to prepare the targeted nanoparticles (βGlus-PNP/pCAR). The loading efficiency of PNP for pCAR was quantitatively assessed by gel retardation assay. The particle size, Zeta potential, morphology, and storage stability of PNP/pCAR were characterized using a Malvern particle size analyzer and transmission electron microscopy. At the cellular level, RAW 264.7 macrophages were selected. The cytotoxicity of PNP/pCAR was evaluated using the CCK-8 assay. The cellular uptake efficiency and lysosomal escape ability of the nanoparticles were assessed via flow cytometry and confocal microscopy. Transfection efficiency was quantitatively evaluated by detecting the expression of the reporter gene GFP using flow cytometry. At the in vivo level, an orthotopic pancreatic cancer mouse model was established. Cy7-labeled βGlus-PNP/pCAR nanoparticles were administered orally, and the fluorescence distribution in mice was dynamically monitored at 1, 2, 4, 8, and 16 h post-administration using a small animal in vivo imaging system. Forty-eight hours after oral gavage, the mice were euthanized, and pancreatic tumor tissues were collected for further analysis of intratumoral fluorescence signals using the imaging system. Additionally, βGlus-PNP/pCAR-GFP nanoparticles loaded with the reporter gene (GFP) were administered orally. Forty-eight hours post-administration, pancreatic tumor tissues were harvested to prepare frozen sections, and GFP expression was observed and analyzed under a fluorescence microscope. ResultsThe PNP carrier exhibited a high loading capacity for pCAR. The successfully prepared PNP/pCAR nanoparticles were regular spheres with a hydrodynamic diameter of approximately (120±10) nm and a Zeta potential of about +(6±1) mV. They maintained good structural stability after incubation in PBS buffer for 7 d. Cell experiments demonstrated that PNP/pCAR exhibited no significant cytotoxicity in RAW 264.7 cells while being efficiently internalized and effectively escaping lysosomal degradation. The transfection positive rate of PNP/pCAR-GFP in RAW 264.7 cells reached (25±3)%, surpassing that of Lipofectamine 2000-loaded pCAR-GFP (Lipo/pCAR-GFP), which was (20±1)%.In vivo experiments revealed that, compared to unmodified PNP/pCAR, βGlus-PNP/pCAR exhibited strongerin situ pancreatic tumor targeting ability after oral administration. Furthermore, oral administration of βGlus-PNP/pCAR-GFP resulted in significant GFP protein expression detectable within pancreatic tumor tissues. ConclusionThis study successfully constructed and validated an orally administrable, pancreatic cancer-targeting polypeptide-based nano-gene delivery system. It provides an important technological foundation in delivery systems and experimental basis for the subsequent development of in situ CAR-M-based therapeutic strategies for pancreatic cancer.

ObjectivePancreatic ductal adenocarcinoma (PDAC) exhibits a limited response to current treatments due to its dense fibrotic stroma and highly immunosuppressive tumor microenvironment. In recent years, advancements in cellular immunotherapy, particularly chimeric antigen receptor macrophage (CAR-M) therapy, have offered new hope for pancreatic cancer treatment. Although CAR-M therapy demonstrates dual potential in directly killing tumor cells and remodeling the immune microenvironment, it still faces challenges such as complex in vitro preparation processes and low in vivo targeting and delivery efficiency. Therefore, developing strategies for efficient and targeted in vivo delivery of CAR genes has become crucial for overcoming current therapeutic limitations. This study aims to develop an orally administrable nano-gene delivery system for the targeted delivery of CAR genes to pancreatic tumor sites. MethodsCore nano-gene particles (PNP/pCAR) were constructed by loading plasmid DNA encoding CAR (pCAR) with cationic polypeptides (PNP). Subsequently, PNP/pCAR was surface-modified with β-glucan to prepare the targeted nanoparticles (βGlus-PNP/pCAR). The loading efficiency of PNP for pCAR was quantitatively assessed by gel retardation assay. The particle size, Zeta potential, morphology, and storage stability of PNP/pCAR were characterized using a Malvern particle size analyzer and transmission electron microscopy. At the cellular level, RAW 264.7 macrophages were selected. The cytotoxicity of PNP/pCAR was evaluated using the CCK-8 assay. The cellular uptake efficiency and lysosomal escape ability of the nanoparticles were assessed via flow cytometry and confocal microscopy. Transfection efficiency was quantitatively evaluated by detecting the expression of the reporter gene GFP using flow cytometry. At the in vivo level, an orthotopic pancreatic cancer mouse model was established. Cy7-labeled βGlus-PNP/pCAR nanoparticles were administered orally, and the fluorescence distribution in mice was dynamically monitored at 1, 2, 4, 8, and 16 h post-administration using a small animal in vivo imaging system. Forty-eight hours after oral gavage, the mice were euthanized, and pancreatic tumor tissues were collected for further analysis of intratumoral fluorescence signals using the imaging system. Additionally, βGlus-PNP/pCAR-GFP nanoparticles loaded with the reporter gene (GFP) were administered orally. Forty-eight hours post-administration, pancreatic tumor tissues were harvested to prepare frozen sections, and GFP expression was observed and analyzed under a fluorescence microscope. ResultsThe PNP carrier exhibited a high loading capacity for pCAR. The successfully prepared PNP/pCAR nanoparticles were regular spheres with a hydrodynamic diameter of approximately (120±10) nm and a Zeta potential of about +(6±1) mV. They maintained good structural stability after incubation in PBS buffer for 7 d. Cell experiments demonstrated that PNP/pCAR exhibited no significant cytotoxicity in RAW 264.7 cells while being efficiently internalized and effectively escaping lysosomal degradation. The transfection positive rate of PNP/pCAR-GFP in RAW 264.7 cells reached (25±3)%, surpassing that of Lipofectamine 2000-loaded pCAR-GFP (Lipo/pCAR-GFP), which was (20±1)%.In vivo experiments revealed that, compared to unmodified PNP/pCAR, βGlus-PNP/pCAR exhibited strongerin situ pancreatic tumor targeting ability after oral administration. Furthermore, oral administration of βGlus-PNP/pCAR-GFP resulted in significant GFP protein expression detectable within pancreatic tumor tissues. ConclusionThis study successfully constructed and validated an orally administrable, pancreatic cancer-targeting polypeptide-based nano-gene delivery system. It provides an important technological foundation in delivery systems and experimental basis for the subsequent development of in situ CAR-M-based therapeutic strategies for pancreatic cancer.

Since its emergence in the 1980s, the human immunodeficiency virus (HIV) has caused a global pandemic, posing a severe threat to human life and health as well as social development. Although pre-exposure prophylaxis (PrEP) effectively curbs HIV transmission and antiretroviral therapy (ART) significantly extends the lifespan of patients, vaccines remain a pivotal tool for blocking transmission and ending the pandemic. The high genetic variability of HIV-1, the glycan shield of its envelope glycoproteins, and the long-term persistence of latent reservoirs have repeatedly led to bottlenecks in traditional vaccine strategies. In recent years, mRNA technology has offered a novel approach to addressing these challenges, leveraging advantages such as sequence programmability, short production cycles, native conformational expression of antigens, and self-adjuvant effects. In recent years, mRNA vaccine technology has emerged as a transformative solution to longstanding vaccinology challenges, characterized by its sequence programmability, rapid production cycles, native conformational antigen expression, and intrinsic self-adjuvanting properties. Unlike traditional platforms reliant on pathogen culture or recombinant proteins, mRNA vaccines can be expeditiously designed and updated based solely on viral genomic sequences. Lipid nanoparticle (LNP)-encapsulated mRNA facilitates endogenous antigen expression and presentation, simultaneously eliciting potent humoral and cellular immune responses. Within this landscape, self-amplifying mRNA (saRNA) further extends in vivo antigen expression to enhance the persistence of immune responses. Moreover, the LNP delivery system not only protects mRNA from degradation and mediates endosomal escape but also synergizes with mRNA to optimize immune activation via self-adjuvant effects. Importantly, mRNA platforms circumvent the pre-existing immunity associated with viral vectors and the genomic integration risks of DNA vaccines, positioning them as a cornerstone for global pandemic preparedness. This review systematically delineates recent advances in mRNA technology for HIV-1 vaccine development, focusing on four pivotal research frontiers. First, mRNA innovations building upon the RV144 trial optimize antigens through codon modification and multivalent designs to induce more durable and broad-spectrum immunity. Second, particulate mRNA vaccine strategies, utilizing virus-like particles (VLPs) and ferritin nanoparticles, achieve in situ antigen self-assembly, significantly enhancing B cell activation and reducing infection risks in non-human primate models. Third, germline-targeting mRNA vaccines address the low-affinity barrier of broadly neutralizing antibody (bNAp) precursors, efficiently activating rare precursor B cells and promoting affinity maturation. Fourth, therapeutic mRNA vaccines offer unique advantages for an HIV functional cure; combining immunogens with mRNA-encoded adjuvants potentiates cellular immunity, while LNP-mediated “shock-and-kill” strategies specifically activate latent reservoirs to guide immune clearance. Comparative analyses with traditional platforms reveal that mRNA technology redefines antigen production and presentation, simulating chronic infection through sustained expression and enabling dual-pathway presentation via endogenous synthesis. Furthermore, we explore the mechanistic innovations of mRNA vaccines in inducing bNAps: sustained in vivo production prolongs the activation window for precursor B cells and maintains germinal center (GC) reactions; endogenously expressed antigens adopt native conformations to expose conserved epitopes; and self-adjuvanting effects modulate the functions of antigen-presenting cells (APCs) and follicular helper T cells (Tfh), driving somatic hypermutation and affinity maturation. We also address critical clinical translation challenges, including immune durability, adaptability to special populations, and large-scale LNP manufacturing, while proposing targeted optimization strategies. In conclusion, this review establishes a theoretical framework for utilizing mRNA technology to overcome HIV-1 immune escape, transitioning from a descriptive paradigm to a problem-solving-based synthesis of evidence. By integrating preclinical and early clinical data, we bridge the gap between basic design and translational verification. mRNA technology is poised to become a central pillar inHIV-1 prevention and therapy, providing a robust toolset to achieve the global goal of ending the AIDS pandemic and offering a blueprint for vaccine development against other recalcitrant infectious diseases.