AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo investigate the mechanism of Xiezhuo Jiedu prescription in the treatment of ulcerative colitis （UC） by inhibiting ferroptosis and alleviating intestinal mucosal injury based on the nuclear factor E₂ related factor 2/solute carrier family 7 member/glutathione peroxidase 4 （Nrf2/SLC7A11/GPX4） signaling pathway. MethodsA total of 60 male SD rats were divided into a normal group， a model group， high- and low-dose Xiezhuo Jiedu prescription groups （26.64 and 13.32 g·kg^-1， respectively）， a ferroptosis inhibitor group （Ferrostatin-1， 0.005 g·kg^-1）， and a mesalazine group （0.27 g·kg^-1）， with 10 rats in each group. A UC rat model was established by intrarectal administration of trinitrobenzene sulfonic acid （TNBS）-ethanol. The normal group and the model group were intragastrically administered normal saline. The other groups were given intragastric administration according to the corresponding dosage for 7 d. The general condition， disease activity index （DAI） score， colon length， and mucosal injury index （CDMI） score were observed in each group. The pathological changes of colon tissue in each group were observed by hematoxylin-eosin （HE） staining. The intestinal mucosa and mitochondrial morphology in each group were observed by transmission electron microscopy. The expression levels of Occludin， Claudin-1， mucin 2 （MUC2）， and E-cadherin in intestinal tissue were detected by immunofluorescence （IF）. Enzyme-linked immunosorbent assay （ELISA） was used to detect the expression levels of serum tumor necrosis factor-α （TNF-α）， interleukin-6 （IL-6）， and interleukin-10 （IL-10） in each group， and a lactic acid assay kit or ELISA was employed to detect the expression levels of reactive oxygen species （ROS）， ferrous ions （Fe²⁺）， glutathione （GSH）， malondialdehyde （MDA）， 4-hydroxynonenal （4-HNE）， diamine oxidase （DAO）， and D-lactate （D-LA）. Real-time quantitative polymerase chain reaction （Real-time PCR） was applied to detect the mRNA expression levels of Nrf2， SLC7A11， GPX4， Occludin， Claudin-1， MUC2， and E-cadherin in each group， and Western blot was adopted to detect the protein expression levels of Nrf2， p-Nrf2， SLC7A11， and GPX4 in each group. ResultsCompared with the normal group， rats in the model group exhibited listlessness， sluggish response， and mucopurulent and bloody stools. The model group also showed significantly increased DAI score， colon length， CDMI score， and expression levels of TNF-α， IL-6， ROS， Fe²⁺， MDA， 4-HNE， DAO， and D-LA （P<0.01）. In addition， it presented significantly decreased IF values of Occludin， Claudin-1， MUC2， and E-cadherin and mRNA and protein expression levels of IL-10， GSH， Nrf2， p-Nrf2， SLC7A11， and GPX4 （P<0.01）. There were different degrees of improvement in each administration group after treatment， and the improvement was the most significant in the high-dose Xiezhuo Jiedu prescription group （P<0.01）. ConclusionXiezhuo Jiedu prescription may alleviate intestinal mucosal injury by inhibiting ferroptosis of intestinal epithelial cells via regulating the Nrf2/SLC7A11/GPX4 signaling pathway， thereby exhibiting efficacy in the treatment of UC.

OBJECTIVE To conduct a clinical rapid evaluation of the marketed proprotein convertase subtilisin/kexin type 9 （PCSK9） inhibitors in China， including evolocumab， tafolecimab， recaticimab， ebronucimab， ongericimab and inclisiran. METHODS Based on the Rapid Guide for Drug Evaluation and Selection in Chinese Medical Institutions （second edition）， drug instructions， clinical diagnosis and treatment guidelines， and literature for six drugs were retrieved from CNKI， Wanfang Data， VIP， PubMed， Embase， Cochrane Library and related official websites. The clinical rapid evaluation was conducted from five aspects： pharmaceutical characteristics， effectiveness， safety， economy， and other attributes. RESULTS The pharmaceutical characteristics， effectiveness， safety， economy， other attributes， and total score of evolocumab scored 24， 27， 15.7， 10， 5.3， and 82 points， respectively. Tafolecimab scored 23.5， 23， 11.5， 9.97， 4.6， and 72.57 points， respectively. Recaticimab scored 20.5， 22， 15.5， 6.37， 3.5， and 67.87 points. Ebronucimab scored 20， 23， 11， 6.48， 3.5， and 63.98 points. Ongericimab scored 20.5， 23， 8.5， 4.83， 3.5， and 60.33 points. Inclisiran scored 25.5， 24， 13， 6.48， 5， and 73.98 points. CONCLUSIONS Evolocumab is the optimal choice for treating hypercholesterolemia and is recommended as the first-line option. Tafolecimab is the second-line option， and recaticimab is suitable for patients who are sensitive to drug adverse reactions. Inclisiran is suitable for patients with poor compliance. Ebronucimab and ongericimab are weakly recommended due to their later market introduction. Clinicians should make individualized drug selections based on factors such as patient risk level and compliance requirements.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

With the accelerating trend of population aging, the number of elderly patients with lung cancer continues to rise, and the disease burden is becoming increasingly heavy. The clinical management of these patients faces severe challenges due to their decreased physiological reserve, complex comorbidities, and significant individual heterogeneity. Consequently, under traditional diagnosis and treatment models, doctors often struggle to identify the individualized risks of elderly patients in a timely and comprehensive manner, which can easily lead to decision biases such as undertreatment or overtreatment. In view of this, this study advocates for the establishment of an umbrella decision-making model specifically tailored for elderly lung cancer patients. Grounded in a multidisciplinary team (MDT) platform, this model deeply integrates oncological indicators with the comprehensive geriatric assessment (CGA) system. By holistically considering multidimensional variables including tumor burden, organ function, frailty index, cognitive status, and social support, the model establishes an operational mechanism characterized by "single entry, precise stratification, and targeted selection". Accordingly, patients can be scientifically triaged into distinct intervention tiers, such as active surveillance, minimally invasive surgery, drug therapy, radiotherapy, and best supportive care, thereby achieving real-time alignment between treatment intensity and patient fitness. This article elaborates on the construction logic and key operational procedures of this novel decision-making framework, aiming to guide clinical practice beyond the limitations of a tumor-centric perspective toward a holistic, dynamic, whole-course management strategy. This transition seeks to ensure optimal quality of life and clinical net benefit for elderly patients alongside survival prolongation.

Objective To explore the principle of antibacterial drug therapy and the strategy of program optimization in elderly patients with Helicobacter pylori（Hp）. Methods The common therapeutic regimen of Hp was summarized, and the better therapeutic regimen of elderly Hp patients was screened ultimately. Results Amoxicillin and cefuroxime were relatively safe compared with other recommended antibacterial drugs. Using other commonly antibiotics for Hp should pay attention to the disease of patients and current drug. Conclusion Elderly patients usually suffered from a variety of diseases and required multiple drugs. The application of therapeutic regimen for elderly patients with Hp should be supposed to fully weigh the risks and benefits.

Objective To investigate the effects of light-at-night exposure on anxiety and depression behaviors in mice and to explore the underlying neural mechanisms.Methods Six-week-old male C57BL/6J mice were randomly assigned to a control(Ctrl)group and a light-at-night exposure(LAN)group.Mice in the LAN group were exposed to 460 nm blue light for 1 h daily during the zeitgeber time(ZT)13-14 while the Ctrl group mice were maintained under a 12-h light/12-h dark cycle.Behavioral tests were conducted at different time points following LAN exposure to evaluate anxiety and depression behaviors in the mice.Immunofluorescence staining was used to observe the effect of LAN on c-fos expressions in the medial prefrontal cortex(mPFC),basal ateral amygdala(BLA),paraventricular nucleus(PVN)and paraventricular thalamus(PVT).ELISA was performed to measure changes in serum corticosterone,adrenocorticotropic hormone(ACTH)and corticotropin-releasing hormone(CRH)levels.Golgi staining was applied to measurethe dendritic spine density and morphology from mPFC and CA1.Western blotting analysis was conducted to detect expression levels of brain-derived neurotrophic factors(BDNFs),phosphorylated tropomyosin receptor kinase B(p-TrkB)/TrkB,postsynaptic density protein 95(PSD95)and synaptophysin(SYP)in the mPFC.Results Mice exhibited anxiety-like behaviors after 14 days of LAN exposure,with depression-like behaviors emerging after 28 days.LAN exposure of 28 days led to a significant increase in the number of c-fos-positive neurons in the mPFC,BLA,PVN and PVT(P＜0.05),resulted in elevated serum corticosterone levels(P＜0.01)and reduced protein expression levels of BDNF and SYP(P＜0.05).Furthermore,there was a marked decrease in synapse numbers and synaptic density in the mPFC(P＜0.01).Conclusion Prolonged exposure to blue light at night enhances neuronal activity in the mPFC and BLA and suppresses the BDNF/TrkB signaling pathway by activating the hypothalamic-pituitary-adrenal axis(HPA),thus leading to synaptic structural and functional damage and inducing anxiety and depression behaviors in mice.

Gastric contrast-enhanced ultrasound includes oral contrast-enhanced ultrasound (OCUS) and double contrast-enhanced ultrasound (DCEUS),which can provide valuable clinical information about tumor morphology,vascular characteristics,and treatment responses.OCUS can clearly identify the gastric wall structure and the extent and depth of lesions by applying oral contrast agents.DCEUS,based on OCUS combined with venography,can display the anatomical and perfusion characteristics of lesions.In recent years,gastric contrast agents and imaging techniques have developed rapidly.However,the clinical application of gastric contrast-enhanced ultrasound is still in the developmental stage.This article reviews the clinical status of OCUS and DCEUS in the screening,diagnosis,staging,pathological typing,and treatment evaluation of gastric cancer.Studies have shown that gastric contrast-enhanced ultrasound has high sensitivity and specificity in the assessment of diagnosis and T-staging of gastric cancer.Furthermore,gastric contrast-enhanced ultrasound has the advantages of being cost-effective,convenient,non-invasive,free from radiation exposure,real-time,and easy to repeat.In the diagnosis and treatment of gastric cancer,it is expected to become one of the important imaging assessment tools.
Humans ; Stomach Neoplasms/diagnostic imaging* ; Contrast Media ; Ultrasonography/methods*

Objective:To investigate the factors associated with chromosomal abnormalities in embryos of patients with recurrent miscarriage in the in vitro fertilization/intracytoplasmic sperm injection and embryo transfer (IVF/ICSI-ET) population, and to establish a prediction model for chromosomal abnormalities. Methods:This was a retrospective case-control study, aborted tissues were collected from 349 patients who attended the Reproductive and Genetic Laboratory Sports New Town Ward of Dalian Women's and Children's Medical Center (Group) after IVF/ICSI from September 2019 to October 2024, and the samples were examined by copy number variation sequencing (CNV-seq) combined with short tandem repeat (STR) technology. According to the test results, the aborted tissues were divided into chromosome normal and chromosome abnormal groups. Factors affecting the occurrence of chromosomal abnormalities were analyzed by univariate analysis and multifactorial logistic regression.Results:1) By CNV-seq combined with STR method, a total of 252 cases (72.21%, 252/349) of chromosomal abnormalities were detected, while 97 cases had normal chromosomes. 2) The results of univariate analysis showed that the differences in female age, female body mass index (BMI), gestational week, number of miscarriages, progesterone level after 14 d post-transplantation, ovarian reserve function, male age, and male BMI were statistically significant between the chromosome normal group and the chromosome abnormal group (all P<0.05). 3) The results of the multifactorial logistic regression model showed that female age ( OR=1.261, 95% CI: 1.137-1.398, P<0.001), female BMI ( OR=1.121, 95% CI: 1.038-1.227, P=0.004), gestational week ( OR=1.406, 95% CI: 1.155-1.711, P=0.001), progesterone level 14 d after transplantation ( OR=1.016, 95% CI: 1.000-1.031, P=0.043), and BMI of the male partner ( OR=1.132, 95% CI: 1.050-1.220, P=0.001) were the independent risk factors of chromosomal abnormalities. 4) There were statistically significant differences in female age, female BMI, gestational week, progesterone level 14 d after transplantation, and male BMI between patients with normal chromosomes and those with trisomy chromosomes in aborted tissues (all P<0.05).Advanced female age was correlated with the occurrence of trisomy 22 ( P<0.05), and there was a correlation between advanced female age and increased male BMI and the occurrence of trisomy 16 (all P<0.05). Conclusion:The increase in maternal age, BMI, gestational age, progesterone levels 14 d after transplantation, and male BMI can all lead to an increase in the rate of chromosomal abnormalities and an increase in the incidence of trisomy. The advanced age of the female, can lead to the occurrence of trisomy 22. The age of the female and the BMI of the male are positively correlated with the abnormality rate of trisomy 16.