AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

OBJECTIVE To conduct a clinical rapid evaluation of the marketed proprotein convertase subtilisin/kexin type 9 （PCSK9） inhibitors in China， including evolocumab， tafolecimab， recaticimab， ebronucimab， ongericimab and inclisiran. METHODS Based on the Rapid Guide for Drug Evaluation and Selection in Chinese Medical Institutions （second edition）， drug instructions， clinical diagnosis and treatment guidelines， and literature for six drugs were retrieved from CNKI， Wanfang Data， VIP， PubMed， Embase， Cochrane Library and related official websites. The clinical rapid evaluation was conducted from five aspects： pharmaceutical characteristics， effectiveness， safety， economy， and other attributes. RESULTS The pharmaceutical characteristics， effectiveness， safety， economy， other attributes， and total score of evolocumab scored 24， 27， 15.7， 10， 5.3， and 82 points， respectively. Tafolecimab scored 23.5， 23， 11.5， 9.97， 4.6， and 72.57 points， respectively. Recaticimab scored 20.5， 22， 15.5， 6.37， 3.5， and 67.87 points. Ebronucimab scored 20， 23， 11， 6.48， 3.5， and 63.98 points. Ongericimab scored 20.5， 23， 8.5， 4.83， 3.5， and 60.33 points. Inclisiran scored 25.5， 24， 13， 6.48， 5， and 73.98 points. CONCLUSIONS Evolocumab is the optimal choice for treating hypercholesterolemia and is recommended as the first-line option. Tafolecimab is the second-line option， and recaticimab is suitable for patients who are sensitive to drug adverse reactions. Inclisiran is suitable for patients with poor compliance. Ebronucimab and ongericimab are weakly recommended due to their later market introduction. Clinicians should make individualized drug selections based on factors such as patient risk level and compliance requirements.

ObjectiveTo investigate the mechanism of Xiezhuo Jiedu prescription in the treatment of ulcerative colitis （UC） by inhibiting ferroptosis and alleviating intestinal mucosal injury based on the nuclear factor E₂ related factor 2/solute carrier family 7 member/glutathione peroxidase 4 （Nrf2/SLC7A11/GPX4） signaling pathway. MethodsA total of 60 male SD rats were divided into a normal group， a model group， high- and low-dose Xiezhuo Jiedu prescription groups （26.64 and 13.32 g·kg^-1， respectively）， a ferroptosis inhibitor group （Ferrostatin-1， 0.005 g·kg^-1）， and a mesalazine group （0.27 g·kg^-1）， with 10 rats in each group. A UC rat model was established by intrarectal administration of trinitrobenzene sulfonic acid （TNBS）-ethanol. The normal group and the model group were intragastrically administered normal saline. The other groups were given intragastric administration according to the corresponding dosage for 7 d. The general condition， disease activity index （DAI） score， colon length， and mucosal injury index （CDMI） score were observed in each group. The pathological changes of colon tissue in each group were observed by hematoxylin-eosin （HE） staining. The intestinal mucosa and mitochondrial morphology in each group were observed by transmission electron microscopy. The expression levels of Occludin， Claudin-1， mucin 2 （MUC2）， and E-cadherin in intestinal tissue were detected by immunofluorescence （IF）. Enzyme-linked immunosorbent assay （ELISA） was used to detect the expression levels of serum tumor necrosis factor-α （TNF-α）， interleukin-6 （IL-6）， and interleukin-10 （IL-10） in each group， and a lactic acid assay kit or ELISA was employed to detect the expression levels of reactive oxygen species （ROS）， ferrous ions （Fe²⁺）， glutathione （GSH）， malondialdehyde （MDA）， 4-hydroxynonenal （4-HNE）， diamine oxidase （DAO）， and D-lactate （D-LA）. Real-time quantitative polymerase chain reaction （Real-time PCR） was applied to detect the mRNA expression levels of Nrf2， SLC7A11， GPX4， Occludin， Claudin-1， MUC2， and E-cadherin in each group， and Western blot was adopted to detect the protein expression levels of Nrf2， p-Nrf2， SLC7A11， and GPX4 in each group. ResultsCompared with the normal group， rats in the model group exhibited listlessness， sluggish response， and mucopurulent and bloody stools. The model group also showed significantly increased DAI score， colon length， CDMI score， and expression levels of TNF-α， IL-6， ROS， Fe²⁺， MDA， 4-HNE， DAO， and D-LA （P<0.01）. In addition， it presented significantly decreased IF values of Occludin， Claudin-1， MUC2， and E-cadherin and mRNA and protein expression levels of IL-10， GSH， Nrf2， p-Nrf2， SLC7A11， and GPX4 （P<0.01）. There were different degrees of improvement in each administration group after treatment， and the improvement was the most significant in the high-dose Xiezhuo Jiedu prescription group （P<0.01）. ConclusionXiezhuo Jiedu prescription may alleviate intestinal mucosal injury by inhibiting ferroptosis of intestinal epithelial cells via regulating the Nrf2/SLC7A11/GPX4 signaling pathway， thereby exhibiting efficacy in the treatment of UC.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

The thought of medicine and food homology and substances with both edible and medicinal values are an important part of China's excellent traditional culture and medicine treasure, playing an important role in human diet and health maintenance for thousands of years. Substances with both edible and medicinal values are a standardized name governed by existing regulations, and many substances with both edible and medicinal values in the list lack important information such as original plants and edible and medicinal parts. Some substances change as the relevant regulations change, which confuses the use and regulation. According to the definition and inclusion conditions of substances with both edible and medicinal values in the Regulation of Substances with Both Edible and Medicinal Values Catalogue, this paper comprehensively reviewed the first batch of 87 substances with both edible and medicinal values published in 2002 by collecting information and investigating the practical application. Some substances supplemented, deleted, and revised were analyzed and discussed, and a complete revised list was compiled, encompassing a total of 90 substances, which were when combined with the 19 substances of the last three batches(published in 2019, 2023, and 2024), amounted to a total of 109 substances. In addition, the substances not currently in the published list but have both edible and medicinal values according to the latest definition were summarized, which revealed at least 27 other substances. Therefore, there were at least 136 substances with both edible and medicinal values. Additionally, the potential substances that could be included in the list of substances with edible and medicinal values were prospected, providing a focus for future expansion of the list. This paper systematically reviewed and revised the list of substances with both edible and medicinal values to lay a foundation for the regulatory authorities to revise the catalog of these substances and provide basic information for promoting the new quality productive forces in the health field and boosting the orderly and rapid development of the big health industry.
China ; Humans ; Drugs, Chinese Herbal/standards* ; Plants, Medicinal/chemistry* ; Medicine, Chinese Traditional

Based on the pharmacokinetics theory, this study investigated the pharmacokinetic characteristics of albiflorin, paeoniflorin, wogonoside, and wogonin in normal and febrile rats and summarized absorption and elimination rules of Dayuanyin in them to provide reference for further development and clinical application of Dayuanyin. Blood samples were taken from the fundus venous plexus of normal and model rats after intragastric administration of Dayuanyin at different time points. The concentration of each substance in blood was determined by ultra performance liquid chromatography-triple quadrupole mass spectrometry(UPLC-MS/MS) technique at different time points. DAS 2.0, a piece of pharmacokinetics software, was used to calculate the pharmacokinetic parameters of each component. The results show that the 4 components had good linear relationship in their respective ranges, and the results of methodological investigation met the requirements. The pharmacokinetic parameters of C_(max), T_(max), t_(1/2), AUC_(0-t), AUC_(0-∞), and MRT_(0-t) were calculated by the DAS 2.0 non-compartmental model. Compared with those in the normal group, C_(max) and AUC_(0-t) of the 4 components in the model group were significantly increased. There were significant differences in the pharmacokinetic characteristics between the normal and model groups, suggesting that the absorption and elimination of Dayuanyin may be affected by the changes of internal environment of the body in different physiological states.
Animals ; Rats ; Drugs, Chinese Herbal/administration & dosage* ; Male ; Rats, Sprague-Dawley ; Fever/metabolism* ; Tandem Mass Spectrometry ; Chromatography, High Pressure Liquid ; Glucosides/pharmacokinetics* ; Monoterpenes

This study systematically reviewed the randomized controlled trial(RCT) of traditional Chinese medicine(TCM) treatment of post-stroke depression(PSD) and analyzed the clinical study characteristics and outcome indicators, aiming to optimize the design and establish the core outcome set in the future clinical trials of the TCM treatment of PSD. PubMed, Web of Science, Cochrane Library, EMbase, CNKI, VIP, Wanfang, and SinoMed were searched for the relevant RCT published in recent 3 years. The basic characteristics, intervention measures, and outcome indicators of the included RCT were extracted, and the descriptive analysis was carried out. A total of 76 RCTs were eventually included, with the sample size concentrated in 80-100 cases. The most frequent TCM syndromes were liver depression and Qi stagnation(15 times, 31.91%) and phlegm combined with stasis(5 times, 10.63%). The frequency of intervention methods followed a descending trend of TCM decoction(35 times, 46.05%) and TCM decoction + acupuncture(4 times, 5.26%), Chinese patent medicine(3 times, 3.94%), and the intervention mainly lasted for 1 to 3 months(43 times, 60.56%). The adverse reactions of patients were mainly digestive system reaction(150 patients, 39.37%) and nervous system reaction(112 patients, 29.39%). Most of the included studies had unclear risk of bias, involving 84 outcome indicators, which belonged to 8 indicator domains. The RCTs of TCM treatment of PSD showed a variety of problems, such as non-standard TCM syndrome differentiation, inconsistent names of TCM syndrome scores and measurement tools, low quality, unclear risk of bias, neglect of endpoint indicators, unreasonable selection of substitute indicators, lack of differentiation between primary and secondary outcome indicators, non-standard reporting of safety indicators, insufficient attention to economic indicators, and lack of long-term prognosis evaluation. It is suggested that the future research should improve the quality of methodology and build a standardized core outcome set to promote the development of high-quality clinical research in this field.
Humans ; Randomized Controlled Trials as Topic ; Drugs, Chinese Herbal/administration & dosage* ; Stroke/psychology* ; Depression/etiology* ; Treatment Outcome ; Medicine, Chinese Traditional

Fermented traditional Chinese medicine(TCM) has a long history of medicinal use, such as Sojae Semen Praeparatum, Arisaema Cum Bile, Pinelliae Rhizoma Fermentata, red yeast rice, and Jianqu. Fermentation technology was recorded in the earliest TCM work, Shen Nong's Classic of the Materia Medica. Microorganisms are essential components of the fermentation process. However, the contamination of fermented TCM by toxigenic fungi and mycotoxins due to unstandardized fermentation processes seriously affects the quality of TCM and poses a threat to the life and health of consumers. In this paper, the characteristics, microbial composition, and mycotoxin profile of fermented TCM are systematically summarized to provide a theoretical basis for its quality and safety control.
Fermentation ; Mycotoxins/analysis* ; Drugs, Chinese Herbal/analysis* ; Fungi/classification* ; Bacteria/genetics* ; Drug Contamination ; Medicine, Chinese Traditional

This study investigated the effects of Rehmanniae Radix Praeparata on striatal neuronal apoptosis in rats with attention deficit hyperactivity disorder(ADHD) based on the B-cell lymphoma-2(Bcl-2)/Bcl-2-associated X protein(Bax)/caspase-3 signaling pathway. Twenty-four 3-week-old male spontaneously hypertensive rats(SHR) were randomly divided into a model group, a methylphenidate group(2 mg·kg~(-1)·d~(-1)), and a Rehmanniae Radix Praeparata group(2.4 mg·kg~(-1)·d~(-1)). Age-matched male Wistar Kyoto(WKY) rats were used as the normal control group, with 8 rats in each group. The rats were administered by gavage for 28 days. Body weight and food intake were recorded for each group. The open field test and elevated plus maze test were used to assess hyperactivity and impulsive behaviors. Nissl staining was used to detect changes in striatal neurons and Nissl bodies. Terminal deoxynucleotidyl transferase dUTP nick end labeling(TUNEL) fluorescence staining was used to detect striatal cell apoptosis. Western blot was employed to detect the expression levels of Bcl-2, Bax, and caspase-3 proteins in the striatum. The results showed that compared with the model group, Rehmanniae Radix Praeparata significantly reduced the total movement distance, average movement speed, and central area residence time in the open field test, and significantly reduced the ratio of open arm entries, open arm stay time, and head dipping in the elevated plus maze test. Furthermore, it increased the number of Nissl bodies in striatal neurons, significantly downregulated the apoptosis index, significantly increased Bcl-2 protein expression and the Bcl-2/Bax ratio, and reduced Bax and caspase-3 protein expression. In conclusion, Rehmanniae Radix Praeparata can reduce hyperactivity and impulsive behaviors in ADHD rats. Its mechanism may be related to the regulation of the Bcl-2/Bax/caspase-3 signaling pathway in the striatum, enhancing the anti-apoptotic capacity of striatal neurons.
Animals ; Male ; Apoptosis/drug effects* ; Rats ; Drugs, Chinese Herbal/administration & dosage* ; Caspase 3/genetics* ; Proto-Oncogene Proteins c-bcl-2/genetics* ; bcl-2-Associated X Protein/genetics* ; Rehmannia/chemistry* ; Attention Deficit Disorder with Hyperactivity/physiopathology* ; Signal Transduction/drug effects* ; Neurons/cytology* ; Rats, Inbred SHR ; Rats, Inbred WKY ; Humans ; Corpus Striatum/cytology* ; Plant Extracts