1.Effect of Feiyanning Granules on Inducing Ferroptosis in Lung Cancer Cells and Its Regulatory Function onNrf2/SLC7A11/GPX4 Signaling Pathway
Xin LIU ; Wenjie WANG ; Zhenye XU ; Zhan ZHENG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(2):100-107
ObjectiveThis study aims to explore the effect of Feiyanning granules on ferroptosis in lung cancer cells and its regulatory function within the nuclear transcription factor E2-related factor 2 (Nrf2)/mouse solute carrier family 7 member 11 (SLC7A11)/glutathione peroxidase 4 (GPX4) signaling pathway. MethodsThe cell counting kit-8 (CCK-8) method was used to detect the effect of Feiyanning granule on the proliferation of A549 lung cancer cells. A549 lung cancer cells were categorized into a blank group, a ferroptosis inhibitor-1 (Fer-1) group (10 μmol·L-1), a Feiyanning granules (600 mg·L-1) group, and a Feiyanning granules + Fer-1 group. After 48 hours of intervention, the activity and morphology of the cells were observed. The CCK-8 method was employed to measure cell viability. Biochemical assays were carried out to measure the levels of reactive oxygen species (ROS), malondialdehyde (MDA), glutathione (GSH), and ferrous ions (Fe²⁺) in A549 cells. Western blot was utilized to evaluate the expression levels of Kelch-like ECH-associated protein 1 (Keap1), Nrf2, SLC7A11, and GPX4 proteins. A549 lung cancer cells were categorized into a blank group and a Feiyanning Granule group (600 mg·L-1), and mitochondrial morphology was examined via transmission electron microscopy (TEM). ResultsAfter the intervention of Feiyaning granules, the proliferation of A549 cells was significantly inhibited in a concentration-dependent manner compared with that in the blank group (P<0.01). Compared with the blank group, the Feiyanning granules group exerted an significantly inhibitory effect on the viability of lung cancer cells (P<0.01). Compared with that in the Feiyanning granules group, the cell viability in the Feiyanning granules +Fer-1 group was obviously restored (P<0.05). Compared with the blank group, the Feiyanning Granule group showed a significant increase in the levels of ROS, MDA, and Fe²⁺ (P<0.01), a significant decrease in the GSH level (P<0.01), and facilitated ferroptosis. Compared with the blank group, the Feiyanning granules group showed significantly decreased expression of Nrf2, SLC7A11, and GPX4 proteins and enhanced expression of Keap1 (P<0.01). Compared with those in the Feiyanning Granule group, the protein levels of Nrf2, SLC7A11, and GPX4 increased significantly (P<0.01), and the expression of Keap1 decreased significantly in the Feiyanning granules + Fer-1 group (P<0.01). Compared with the blank group, the Feiyaning granules group exhibited reduced mitochondrial size and increased matrix electron density. ConclusionFeiyanning granules can induce ferroptosis in lung cancer cells, and its underlying mechanism might be associated with the inhibition of the Nrf2/SLC7A11/GPX4 signaling pathway.
2.Quercetin Ameliorates Gouty Arthritis in Rats via ROS/NLRP3/IL-1β Signaling Pathway
Baowei FENG ; Yan WANG ; Chang LI ; Yujing ZHANG ; Dingxing FAN ; Xin LI
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(2):145-153
ObjectiveTo investigate the effect of quercetin on acute gouty arthritis (GA) in rats by inhibiting the reactive oxygen species (ROS)/NOD-like receptor protein 3 (NLRP3)/interleukin-1β (IL-1β) signaling pathway. MethodsSixty SPF-grade male SD rats were randomized into normal, model, colchicine (0.3 mg·kg-1), and low-, medium-, and high-dose (25, 50, 100 mg·kg-1, respectively) quercetin groups (n=10). The rats in the dosing groups were administrated with the corresponding drugs (10 mL·kg-1) by gavage once a day for one week. An equal volume of normal saline was given by gavage to rats in normal and model groups. One hour after drug administration on day 5, an acute GA model was established in other groups except the control group via intra-articular injection of monosodium urate (MSU) suspension into the right posterior ankle joint cavity. The joint swelling and gait were scored at the time points of 6, 12, 24, 48 h after modeling. Histopathological alterations in the ankle joint tissue from each group were assessed by hematoxylin-eosin (HE) staining. Malondialdehyde (MDA), xanthine oxidase (XOD), and total superoxide dismutase (T-SOD) assay kits were used to assess the levels of MDA, XOD, and T-SOD in the serum. The levels of tumor interleukin-6 (IL-6), necrosis factor-α (TNF-α), and IL-1β in the rat serum, as well as ROS in the ankle joint tissue, were measured by enzyme-linked immunosorbent assay (ELISA). Western blot was performed to determine the protein levels of NLRP3, thioredoxin-interacting protein (TXNIP), apoptosis-associated speck-like protein containing a CARD domain (ASC), precursor cysteinyl aspartate-specific proteinase-1 (pro-Caspase-1), cleaved Caspase-1 (Caspase-1 p20), and IL-1β in the ankle joint tissue. Real-time PCR was employed to assess the mRNA levels of TXNIP, NLRP3, ASC, IL-1β, and TNF-α in the ankle joint tissue. ResultsCompared with the normal group, the model group exhibited decreased spontaneous activity, mental fatigue, increased ankle joint swelling and gait scores (P<0.01), aggravated synovial tissue edema and inflammatory cell infiltration (P<0.01), elevated levels of XOD, MDA, TNF-α, IL-1β, and IL-6 in the serum and ROS in the joint tissue (P<0.01), a declined level of T-SOD (P<0.01), up-regulated protein levels of NLRP3, TXNIP, ASC, pro-Caspase-1, Caspase-1 p20, and IL-1β in the ankle joint tissue (P<0.01), and up-regulated mRNA levels of NLRP3, TXNIP, ASC, IL-1β, and TNF-α in the ankle joint tissue (P<0.01). Compared with the model group, the medium- and high-dose quercetin groups showed improved general conditions, decreased gait scores (P<0.05, P<0.01), reduced joint swelling (P<0.01), alleviated synovial tissue edema and inflammatory cell infiltration (P<0.05, P<0.01), lowered levels of XOD, MDA, TNF-α, IL-1β, and IL-6 in the serum and ROS in the joint tissue (P<0.01), increased levels of T-SOD (P<0.01), down-regulated protein levels of TXNIP, NLRP3, ASC, pro-Caspase-1, Caspase-1 p20, and IL-1β in the ankle joint tissue (P<0.05, P<0.01), and down-regulated mRNA levels of TXNIP, NLRP3, ASC, IL-1β, and TNF-α in the ankle joint tissue (P<0.01). Low-dose quercetin also ameliorated some of the above parameters (P<0.05, P<0.01). ConclusionQuercetin exerts anti-GA effects by blocking the ROS/NLRP3/IL-1β signaling pathway, downregulating NLRP3 inflammasome activation, and inhibiting the production of pro-inflammatory cytokines including TNF-α, IL-1β, and IL-6.
3.Active Ingredients of Bupleuri Radix in Treatment of Central Nervous System: A Review
Shuhuan YANG ; Xin JIANG ; Runda YUAN ; Fang LU
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(2):325-334
Diseases of the central nervous system have become a growing global health concern. At present, there are many adverse reactions in the treatment with Western medicine. In contrast, traditional Chinese medicine has shown unique efficacy and rich clinical practice accumulation in diseases of the central nervous system. As a traditional Chinese medicine, Bupleuri Radix has played an important role in the treatment of neurological diseases through multi-target regulation, multi-pathway intervention, and multi-pathway mechanism of action. In recent years, with the in-depth study of the pharmacological effects of Bupleuri Radix, it has been found that the active ingredients such as saikosaponin, baicalin, quercetin, and kaempferol in Bupleuri Radix can be used as the main material basis for the treatment of neurological diseases. The results of this study showed that in neurodegenerative diseases, active ingredients of Bupleuri Radix can inhibit β-amyloid (Aβ) deposition and abnormal phosphorylation of microtubule-associated protein (Tau protein) in Alzheimer's disease, regulate the nuclear factor-κB/nuclear factor E2 related factor 2 (NF-κB/Nrf2) pathway to play the anti-inflammatory role, and alleviate α-Synuclein (α-Syn) aggregation and mitochondrial damage in Parkinson's disease. In epilepsy, depression, and cerebral ischemia, they can improve symptoms by regulating neurotransmitters, oxidative stress, and apoptosis pathways, and inhibit brain glioma proliferation. However, the mechanism of action has not been fully elucidated, and the complexity of compound components and poor blood-brain barrier penetration limit their clinical application. In the future, it is necessary to integrate multi-omics, network pharmacology, and nano-delivery technologies, focus on the optimization of active ingredient group compounds and the precise guidance of biomarkers, accelerate the development of innovative therapies for Alzheimer's disease, Parkinson's disease, and other diseases for laying a solid theoretical foundation for further development and application and inspiring new research ideas.
4.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
5.Yimei Baijiang Formula Treats Colitis-associated Colorectal Cancer in Mice via NF-κB Signaling Pathway
Qian WU ; Xin ZOU ; Chaoli JIANG ; Long ZHAO ; Hui CHEN ; Li LI ; Zhi LI ; Jianqin LIU
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(3):119-130
ObjectiveTo explore the effects of Yimei Baijiang formula (YMBJF) on colitis-associated colorectal cancer (CAC) and the nuclear factor kappaB (NF-κB) signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups: Normal, model, capecitabine (0.83 g
6.Molecular Mechanism of Programmed Cell Death in Chronic Obstructive Pulmonary Disease and Traditional Chinese Medicine Intervention: A Review
Xin PENG ; Yunhui LI ; Lei LIANG ; Zheyu LUAN ; Hanxiao WANG ; Haotian XU ; Ziming DANG ; Jihong FENG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(3):304-313
Chronic obstructive pulmonary disease (COPD) is a chronic respiratory disease that poses a significant threat to global health, exhibiting high morbidity, disability and mortality rate, with its prevention and treatment situation becoming increasingly critical. The pathogenesis of COPD is complex, and the underlying cellular and molecular biological mechanisms remain incompletely elucidated. Programmed cell death (PCD) is the process wherein cells actively undergo demise to maintain internal environmental stability in response to certain signals or specific stimuli. Contemporary medical research indicates that the dysregulation of PCD patterns such as apoptosis, necroptosis, pyroptosis, autophagy, and ferroptosis is closely related to the onset and progression of COPD. Clarifying the molecular mechanisms of PCD in COPD may provide novel perspectives for in-depth understanding and prevention of the disease. Traditional Chinese medicine (TCM) is characterized by holistic regulation. In recent years, extensive research has been conducted in the TCM field focusing on modulating apoptosis, necroptosis, pyroptosis, autophagy, and ferroptosis for the treatment of COPD, yielding remarkable achievements. Therefore, this study systematically explored the molecular mechanism of PCD in COPD and reviewed the potential mechanisms and intervention status of TCM targeting PCD in COPD, aiming to provide insights and references for the clinical prevention, treatment and in-depth research of COPD.
7.Yimei Baijiang Formula Treats Colitis-associated Colorectal Cancer in Mice via NF-κB Signaling Pathway
Qian WU ; Xin ZOU ; Chaoli JIANG ; Long ZHAO ; Hui CHEN ; Li LI ; Zhi LI ; Jianqin LIU
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(3):119-130
ObjectiveTo explore the effects of Yimei Baijiang formula (YMBJF) on colitis-associated colorectal cancer (CAC) and the nuclear factor kappaB (NF-κB) signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups: Normal, model, capecitabine (0.83 g
8.Molecular Mechanism of Programmed Cell Death in Chronic Obstructive Pulmonary Disease and Traditional Chinese Medicine Intervention: A Review
Xin PENG ; Yunhui LI ; Lei LIANG ; Zheyu LUAN ; Hanxiao WANG ; Haotian XU ; Ziming DANG ; Jihong FENG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(3):304-313
Chronic obstructive pulmonary disease (COPD) is a chronic respiratory disease that poses a significant threat to global health, exhibiting high morbidity, disability and mortality rate, with its prevention and treatment situation becoming increasingly critical. The pathogenesis of COPD is complex, and the underlying cellular and molecular biological mechanisms remain incompletely elucidated. Programmed cell death (PCD) is the process wherein cells actively undergo demise to maintain internal environmental stability in response to certain signals or specific stimuli. Contemporary medical research indicates that the dysregulation of PCD patterns such as apoptosis, necroptosis, pyroptosis, autophagy, and ferroptosis is closely related to the onset and progression of COPD. Clarifying the molecular mechanisms of PCD in COPD may provide novel perspectives for in-depth understanding and prevention of the disease. Traditional Chinese medicine (TCM) is characterized by holistic regulation. In recent years, extensive research has been conducted in the TCM field focusing on modulating apoptosis, necroptosis, pyroptosis, autophagy, and ferroptosis for the treatment of COPD, yielding remarkable achievements. Therefore, this study systematically explored the molecular mechanism of PCD in COPD and reviewed the potential mechanisms and intervention status of TCM targeting PCD in COPD, aiming to provide insights and references for the clinical prevention, treatment and in-depth research of COPD.
9.Multicenter machine learning-based construction of a model for predicting potential organ donors and validation with decision curve analysis
Xu WANG ; Wenxiu LI ; Fenghua WANG ; Shuli WU ; Dong JIA ; Xin GE ; Zhihua SHAN ; Tongzuo LI
Organ Transplantation 2026;17(1):106-115
Objective To evaluate the predictive value of different machine learning models constructed in a multicenter environment for potential organ donors and verify their clinical application feasibility. Methods The study included 2 000 inpatients admitted to five domestic tertiary hospitals from January 2020 to December 2023, who met the criteria for potential organ donation assessment. They were randomly divided into a training set and an internal validation set (7∶3). Another 300 similar patients admitted to the First Affiliated Hospital of Harbin Medical University from January 2024 to April 2025 were included as an external validation set. The area under the curve (AUC), sensitivity, specificity, accuracy and F1-score of three models were compared, and the consistency of the potential organ donor determination process was tested. Multivariate logistic regression analysis was used to identify predictive factors of potential organ donors. Decision curve analysis (DCA) was employed to verify the resource efficiency of each model, and the threshold interval and intervention balance point were assessed. Results Apart from age, there were no significant differences in other basic characteristics among the centers (all P>0.05). The consistency of the potential organ donor determination process among researchers in each center was good [all 95% confidence interval (CI) lower limits >0]. In the internal validation set, the XGBoost model had the best predictive performance (AUC=0.92, 95% CI 0.89-0.94) and the best calibration (P=0.441, Brier score 0.099). In the external validation set, the XGBoost model also had the best predictive performance (AUC=0.91, 95% CI 0.88-0.94), outperforming logistic regression and random forest models. Multivariate logistic regression showed that mechanical ventilation had the greatest impact (odds ratio=2.06, 95% CI 1.54-2.76, P<0.001). DCA indicated that the XGBoost model had the highest net benefit in the threshold interval of 0.2-0.6. The “treat all” strategy only had a slight advantage at extremely low thresholds. The recommended threshold interval, which balances intervention costs and clinical benefits, considers ≥50% positive predictive value (PPV) and ≤50 referrals per 100 high-risk patients. Conclusions The XGBoost model established in a multicenter environment is accurate and well-calibrated in predicting potential organ donors. Combined with DCA, it may effectively guide the timing of clinical interventions and resource allocation, providing new ideas for the assessment and management of organ donation after brain death.
10.Correlation of short sleep duration and screening myopia among primary and middle school students in Beijing
WANG Lu, ZHAO Hai, SUN Bingjie, XIA Zhiwei, GUO Xin
Chinese Journal of School Health 2025;46(1):14-17
Objective:
To study the correlation between short sleep duration and screening myopia among primary and middle school students in Beijing, so as to provide a scientific basis for the comprehensive prevention and control of myopia among students.
Methods:
Using a stratified cluster random sampling, 25 593 primary and middle school students from 16 districts of Beijing were selected from September to November 2023. The National Common Diseases and Health Influencing Factors Monitoring Survey Questionnaire was used to conduct a questionnaire survey, and visual acuity was tested according to the Specification for the Screening of Refractive Error in Primary and Middle School Students. The reporting rates of short sleep duration and detection rates of screening myopia among primary and middle school students were compared using the Chi square test. Binary Logistic regression was used to analyze the correlation between short sleep duration and screening myopia.
Results:
About 68.63% of students reported short sleep duration. There was a statistically significant difference in the reporting rate of short sleep duration among students in different school stages ( χ 2=981.18, P <0.01), with the lowest reporting rate of vocational high school students (47.07%) and the highest reporting rate of ordinary high school students (76.17%). The detection rates of screening myopia among primary school students ( 57.09% ) and middle school students (76.53%) who reported short sleep duration were higher than those who reported enough sleep duration (52.65%, 71.94%), with satistically significant differences ( χ 2=14.83, 17.96, P <0.01). The results of binary Logistic regression analysis showed that primary and middle school students with short sleep duration had a higher risk of developing screening myopia, compared to students with enough sleep duration ( OR =1.25); after adjusting for confounding factors such as educational stage, gender, region, boarding situation, primary and secondary school students with short sleep duration still had a higher risk of screening myopia ( OR =1.26) ( P <0.01). The analysis results stratified by educational stage showed that primary school students from grades 4-6 and middle school students with short sleep duration had a higher risk of screening myopia ( OR=1.18, 1.20, P <0.01).
Conclusions
Primary and secondary school students in Beijing with short sleep duration sleep have a higher risk of developing screening myopia. Families, schools, and society should ensure enough sleep duration to reduce the occurrence of myopia among students.


Result Analysis
Print
Save
E-mail