AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

Background In recent years, the increasingly widespread application of nuclear and medical radiation technologies has resulted in a large number of occupational populations exposed to low-dose ionizing radiation (LDIR). At present, there is no consistent conclusion on the effects of long-term exposure to LDIR on the metabolic health of the occupational population. Objective To explore the association between long-term exposure to LDIR and metabolic syndrome (MetS) among medical radiologists. Methods A cross-sectional study was conducted to enroll 6431 medical radiologists who ordered occupational health checkups from January 2022 to December 2023, and basic information such as demographic characteristics, occupational characteristics, lifestyles, and dietary habits was collected through questionnaires. Physical examinations were conducted using a standardized protocol. Individual dose equivalents of occupational external exposure were monitored by dosimeters worn by medical radiologists. Logistic regression model was used for identifying influencing factors of MetS and sensitivity analysis, and restricted cubic spline model was used to explore the dose-response relationship between cumulative effective dose and MetS. Two-stage linear regression was used to evaluate threshold effect of association between cumulative effective dose and MetS. Results The positive rate of MetS was 13.6% (877/6431) among the enrolled 6431 study participants. The logistic regression showed that gender, age, monthly income, body mass index (BMI), cumulative effective dose, and smoking were influencing factors for MetS. The risk of MetS was higher in males (OR=1.511, 95%CI: 1.209, 1.888); using the < 30 years old group as reference, the risk of MetS was higher in the 30-39 years old (OR=1.509, 95%CI: 1.095, 2.079), 40-49 years old (OR=2.214, 95%CI: 1.551, 3.161), and ≥50 years old (OR=3.480, 95%CI: 2.338, 5.181) groups; using the <10000 yuan group as reference, the risk of MetS was lower in the group with a monthly income of 10000-14999 yuan (OR=0.715, 95%CI: 0.582, 0.878); the risk of MetS was higher in the BMI ≥ 24 kg·m⁻² group (OR=7.548, 95%CI: 6.223, 9.156); using the < 0.76 mSv group as reference, the risk of MetS was higher in the cumulative effective dose of 0.76-2.73 mSv group (OR=1.270, 95%CI: 1.017, 1.586); the risk of MetS was higher in the smoking group (OR=1.734, 95%CI: 1.428, 2.107). The results of restricted cubic spline showed that the cumulative effective dose was nonlinearly correlated with MetS (P _{non-linearity}=0.028), with an inflection point of 1.25 mSv. The risk of developing MetS increased by 34.1% for each unit increase in cumulative effective dose up to 1.25 mSv, whereas above 1.25 mSv, the statistical association was not significant. The sensitivity analysis results showed that after excluding the self-reported hypertensive and diabetic patients, the cumulative effective dose 0.76-2.73 mSv group still had an increased risk of developing MetS compared with the < 0.76 mSv group (P < 0.05), and the results were robust. Conclusion Among medical radiologists, male, age, BMI, and smoking are positively correlated with MetS, and monthly income is negatively correlated with MetS; cumulative effective dose is non-linearly correlated with MetS among medical radiologists.

Objective To investigate the induction of senescence in L02 hepatocytes by low-dose fractionated X-ray radiation and its effects on oxidative stress, oxidative damage, and nuclear factor-κB (NF-κB) pathway protein levels. Methods L02 cells were subjected to fractionated X-ray irradiation at doses of 0.1, 0.2, and 0.5 Gy per fraction for a total of six fractions. Assays were performed 24 hours after the final irradiation. Measurements included SA-β-gal staining, the mRNAs of senescence-related genes p53 and p21 and their encoded proteins, mRNAs of genes encoding senescence-associated secretory phenotype factors (IL-6, IL-8, GM-CSF, MMP-15), reactive oxygen species, oxidative and anti-oxidative markers (malondialdehyde, glutathione, superoxide dismutase), DNA oxidative damage markers (8-OHdG and γ-H2AX), and NF-κB pathway protein levels. Results Compared with the control group, at 24 hours after the end of six irradiations, the number of cells positive in SA-β-gal staining was significantly increased in all dose groups. The mRNA and protein levels of p21 and p53 were significantly elevated in the 0.2 Gy × 6 and 0.5 Gy × 6 groups (P < 0.05). The mRNA levels of genes encoding IL-6, GM-CSF, and MMP-15 were significantly increased in all dose groups (P < 0.05). The mRNA levels of the gene encoding IL-8 were significantly increased in the 0.2 Gy × 6 and 0.5 Gy × 6 groups (P < 0.05). The levels of reactive oxygen species, malondialdehyde, and glutathione were significantly increased in all dose groups (P < 0.01). The level of superoxide dismutase was significantly increased in the 0.5 Gy × 6 group (P < 0.01). The levels of 8-OHdG were significantly increased in all dose groups (P < 0.05). In both the 0.2 Gy × 6 and 0.5 Gy × 6 groups, the expression levels of γ-H2AX and p-NF-κB p65 were significantly increased (P < 0.05), and the levels of IκBα were significantly decreased (P < 0.05). Conclusion Low-dose fractionated X-ray radiation can induce senescence and cause alterations in oxidative stress, oxidative damage, and the levels of NF-κB pathway proteins in L02 hepatocytes.

High-performance liquid chromatography(HPLC) was used to determine the content of three major components in Citri Reticulatae Semen(CRS), including limonin, nomilin, and obacunone. The chromaticity of the CRS sample during salt processing and stir-frying was measured using a color difference meter. Next, the relationship between the color and content of the salt-processed CRS sample was investigated through correlation analysis. By integrating the oil bath technique for processing simulation with HPLC, the changes in the relative content of nomilin and its transformation products were analyzed, with its structural transformation pattern during processing identified. Additionally, RAW264.7 cells were induced with lipopolysaccharides(LPSs) to establish an inflammatory model, and the anti-inflammatory activity of nomilin and its transformation product, namely obacunone was evaluated. The results indicated that as processing progressed, E~*ab and L~* values showed a downward trend; a~* values exhibited a slow increase over a certain period, followed by no significant changes, and b~* values remained stable with no significant changes over a certain period and then started to decrease. The limonin content remained barely unchanged; the nomilin content decreased, and the obacunone increased significantly. The changing trends in content and color parameters during salt-processing and stir-frying were basically consistent. The content of nomilin and obacunone was significantly correlated with the colorimetric values(L~*, a~*, b~*, and E~*ab), while limonin content showed no significant correlation with these values. By analyzing HPLC patterns of nomylin at different heating temperatures and time, it was found that under conditions of 200-250 ℃ for heating of 5-60 min, the content of nomilin significantly decreased, while the obacunone content increased pronouncedly. The in vitro anti-inflammatory activity results indicated that compared to the model group, the group with a high concentration of nomilin and the groups with varying concentrations of obacunone showed significantly reduced release of nitric oxide(NO)(P<0.01). When both were at the same concentration, obacunone showed better performance in inhibiting NO release. In this study, the obvious correlation between the color and content of major components during the processing of CRS samples was identified, and the dynamic patterns of quality change in CRS samples during processing were revealed. Additionally, the study revealed and confirmed the transformation of nomilin into obacunone during processing, with the in vitro anti-inflammatory activity of obacunone significantly greater than that of nomilin. These findings provided a scientific basis for CRS processing optimization, tablet quality control, and its clinical application.
Mice ; Animals ; Drugs, Chinese Herbal/pharmacology* ; RAW 264.7 Cells ; Limonins/chemistry* ; Chromatography, High Pressure Liquid ; Citrus/chemistry* ; Color ; Benzoxepins/chemistry* ; Anti-Inflammatory Agents/chemistry*

Guided by the concept of quality by design(QbD), this study optimizes the calcination and quenching process of calcined Magnetitum and establishes the XRD characteristic spectra of calcined Magnetitum, providing a scientific basis for the formulation of quality standards. Based on the processing methods and quality requirements of Magnetitum in the Chinese Pharmacopoeia, the critical process parameters(CPPs) identified were calcination temperature, calcination time, particle size, laying thickness, and the number of vinegar quenching cycles. The critical quality attributes(CQAs) included Fe mass fraction, Fe~(2+) dissolution, and surface color. The weight coefficients were determined by combining Analytic Hierarchy Process(AHP) and the criteria importance though intercrieria correlation(CRITIC) method, and the calcination process was optimized using orthogonal experimentation. Surface color was selected as a CQA, and based on the principle of color value, the surface color of calcined Magnetitum was objectively quantified. The vinegar quenching process was then optimized to determine the best processing conditions. X-ray diffraction(XRD) was used to establish the characteristic spectra of calcined Magnetitum, and methods such as similarity evaluation, cluster analysis, and orthogonal partial least squares-discriminant analysis(OPLS-DA) were used to evaluate the quality of the spectra. The optimized calcined Magnetitum preparation process was found to be calcination at 750 ℃ for 1 h, with a laying thickness of 4 cm, a particle size of 0.4-0.8 cm, and one vinegar quenching cycle(Magnetitum-vinegar ratio 10∶3), which was stable and feasible. The XRD characteristic spectra analysis method, featuring 9 common peaks as fingerprint information, was established. The average correlation coefficient ranged from 0.839 5-0.988 1, and the average angle cosine ranged from 0.914 4 to 0.995 6, indicating good similarity. Cluster analysis results showed that Magnetitum and calcined Magnetitum could be grouped together, with similar compositions. OPLS-DA discriminant analysis identified three key characteristic peaks, with Fe_2O_3 being the distinguishing component between the two. The final optimized processing method is stable and feasible, and the XRD characteristic spectra of calcined Magnetitum was initially established, providing a reference for subsequent quality control and the formulation of quality standards for calcined Magnetitum.
X-Ray Diffraction/methods* ; Drugs, Chinese Herbal/chemistry* ; Quality Control ; Particle Size

OBJECTIVES: To evaluate the efficacy and safety of avatrombopag in promoting platelet engraftment after allogeneic hematopoietic stem cell transplantation (allo-HSCT) in children, compared with recombinant human thrombopoietin (rhTPO). METHODS: A retrospective analysis was conducted on 53 pediatric patients who underwent allo-HSCT at the Institute of Hematology and Blood Diseases Hospital, Chinese Academy of Medical Sciences from April 2023 to August 2024. Based on medications used during the periengraftment period, patients were divided into two groups: the avatrombopag group (n=15) and the rhTPO group (n=38). RESULTS: At days 14, 30, and 60 post-transplant, platelet engraftment was achieved in 20% (3/15), 60% (9/15), and 93% (14/15) of patients in the avatrombopag group, and in 39% (15/38), 82% (31/38), and 97% (37/38) in the rhTPO group, respectively. There were no significant differences between the two groups in platelet engraftment rates at each time point, cumulative incidence of platelet engraftment, overall survival, and relapse-free survival (all P>0.05). Multivariable Cox proportional hazards analysis indicated that acute graft-versus-host disease was an independent risk factor for delayed platelet engraftment (P=0.043). CONCLUSIONS In children undergoing allo-HSCT, avatrombopag effectively promotes platelet engraftment, with efficacy and safety comparable to rhTPO, and represents a viable therapeutic option.
Humans ; Retrospective Studies ; Hematopoietic Stem Cell Transplantation/adverse effects* ; Male ; Female ; Child ; Child, Preschool ; Infant ; Adolescent ; Transplantation, Homologous ; Blood Platelets/drug effects* ; Thiazoles/therapeutic use* ; Thrombopoietin/therapeutic use* ; Thiophenes

Objective:To explore the factors influencing adherence to voice therapy among patients with voice disorders in China. Methods:Patients with voice disorders who visited the Voice Therapy Center at Sun Yat-sen Memorial Hospital, Sun Yat-sen University, from February to May 2022 were enrolled in the study. Adherence was assessed using the URICA-Voice scale, while influencing factors were assessed through the Voice Handicap Index（VHI） scale and a general information questionnaire. Correlation analysis was conducted using univariate and multivariate logistic regression analysis. Results:A total of 247 patients were included in the study, comprising 57 males（23.08%） and 190 females（76.92%）. The results revealed that: ①Female patients demonstrated higher likelihood of being in the contemplation stage（OR=0.22） compared to males. ②Patients with a monthly family income per capita>6 000 yuan were more likely to be in the contemplation stage than those with<3 000 yuan with an OR = 13.94. ③High vocal-demand occupations increased contemplation stage probability（OR=7.70） compared to moderate-demand occupations. ④Residence within 30-minute commute predicted action/maintenance stages（OR=7.14） versus≥60-minute commute. ⑤Patients whose occupations had high voice demands were more likely to be in the action and maintenance stages than those with average voice demands, with an OR of 16.20. Conclusion:Gender, monthly family income per capita, occupational voice demands, and distance to the hospital significantly impact the URICA-Voice compliance stages of patients. Patients who are female, have higher family income, have occupations with high voice demands, and live closer to the hospital exhibit higher compliance with voice training.
Humans ; Male ; Female ; Voice Disorders/therapy* ; Patient Compliance ; Voice Training ; Surveys and Questionnaires ; China ; Middle Aged ; Adult ; Voice Quality ; Logistic Models ; Aged

Objective:To compare the efficacy of gasless robotic surgery via transaxillary approach and combined axillary-retroauricular approach for unilateral N1b PTC, and to explore the safety and effectiveness of gasless robotic surgery via transaxillary approach for unilateral N1b PTC. Methods:Unilateral N1b PTC patients who underwent surgery in the Department of Otolaryngology, Sun Yat Sen Memorial Hospital, Sun Yat sen University between July 2016 and December 2024 were included and analyzed. According to the inclusion and exclusion criteria and the differences of surgical approaches, the patients were divided into the transaxillary approach（TA） group and the combined axillary-retroauricular approach（TARA） group. The demographic data, operation time, intraoperative blood loss, postoperative drainage volume, postoperative complications, shoulder function evaluation, postoperative visual analogue scale（VAS） of neck aesthetics and recurrence of the two groups were statistically analyzed. Results:A total of 88 patients undergoing gasless robotic surgery were included in this study, including 23 cases in the TA group and 65 cases in the TARA group. The proportion of males in the TA group was significantly higher than that in the TARA group（56.5% vs 21.5%, χ²=9.776, P=0.002）. The total operation time in the TA group was significantly lower than that in the TARA Group（180.00[155.00, 220.00]min vs 220.00[177.50, 272.50]min, z=-2.775, P=0.006）, and the postoperative blood loss in the TA group was significantly lower than that in the TARA Group（30.00[20.00, 50.00]ml vs 50.00[30.00, 60.00]ml, Z=-2.127, P=0.033）. The proportion of area Ⅱ-Ⅴ in the TA group and the TARA group was 87.0% and 70.8%, respectively, and there was no significant difference between the two groups（P>0.05）. There was no significant difference in lateral cervical lymph node dissection and central lymph node dissection between the two groups（P>0.05）. During the follow-up period, no recurrence was found in the two groups, and there was no significant difference in the incidence of complications between the two groups（P>0.05）. According to the stratification of dynamic recurrence risk assessment, it can be seen that the proportion of curative effect satisfaction in the TA group was as high as 95.7%, and that in the TARA group was as high as 81.5%, with no significant difference between the two groups. There was no significant difference in VAS score of neck, Constant Shoulder Score and NDⅡ scale between the two groups（P>0.05）. Conclusion:Gasless robotic surgery via transaxillary approach for unilateral N1b PTC is safe and feasible, and the amount postoperative lymph node acquisition is equivalent to that of combined axillary-retroauricular approach, which can provide a new choice for the treatment of unilateral N1b PTC patients.
Humans ; Robotic Surgical Procedures/methods* ; Axilla/surgery* ; Male ; Female ; Operative Time ; Middle Aged ; Adult ; Treatment Outcome ; Postoperative Complications