AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

ObjectiveTo investigate the processing technology of calcined Haematitum based on the concept of quality by design（QbD） and to assess its health risk. MethodsTaking whole iron content， Fe²⁺ dissolution content and looseness as critical quality attributes（CQAs）， and calcination temperature， calcination time， spreading thickness and particle size as critical process parameters（CPPs） determined by the failure mode and effect analysis（FMEA）， the processing technology of calcined Haematitum was optimized by orthogonal test combined with analytic hierarchy process-criteria importance through intercriteria correlation（AHP-CRITIC） hybrid weighting method. The contents of heavy metals and harmful elements were determined by inductively coupled plasma mass spectrometry， and the health risk assessment was carried out by daily exposure（EXP）， target hazard quotient（THQ） and lifetime cancer risk（LCR）， and the theoretical value of the maximum limit was deduced. ResultsThe optimal processing technology for calcined Haematitum was calcination at 650 ℃， calcination time of 1 h， particle size of 0.2-0.5 cm， spreading thickness of 1 cm， and vinegar quenching for 1 time［Haematitum-vinegar（10：3）］. The contents of 5 heavy metals and harmful elements in 13 batches of calcined Haematitum were all decreased with reductions of up to 5-fold. The cumulative THQ of 2 batches of samples was>1， while the cumulative THQ of all batches of Haematitum was>1. The LCR of As in 1 batches of Haematitum was 1×10^-6-1×10^-4， and the LCR of the rest was<1×10^-6， and the LCRs of calcined Haematitum were all<1×10^-6， indicating that the carcinogenic risk of calcined Haematitum was low， but special attention should still be paid to Haematitum medicinal materials. Preliminary theoretical values of the maximum limits of Cu， As， Cd， Pb and Hg were formulated as 1 014， 25， 17， 27， 7 mg·kg^-1. ConclusionThe optimized processing technology of calcined Haematitum is stable and feasible， and the contents of heavy metals and harmful elements are reduced after processing. Preliminary theoretical values of the maximum limits of Cu， As， Cd， Pb and Hg are formulated to provide a scientific basis for the formulation of standards for the limits of harmful elements in Haematitum.

ObjectiveBased on the concept of quality by design（QbD）， the processing process of calcined Pyritum was optimized， and its X-ray diffraction（XRD） fingerprint was established. MethodsThe safety， effectiveness and quality controllability of calcined Pyritum were taken as the quality profile（QTPP）， the color， hardness， metallic luster， phase composition， the contents of heavy metals and hazardous elements were taken as the critical quality attributes（CQAs）， and the calcination temperature， calcination time， paving thickness and particle size were determined as the critical process parameters（CPPs）. Differential thermal analysis， X-ray diffraction（XRD） and inductively coupled plasma mass spectrometry（ICP-MS） were used to analyze the correlation between the calcination temperature and CQAs of calcined Pyritum. Then， based on the criteria importance through intercriteria correlation（CRITIC）-entropy weight method， the optimal processing process of calcined Pyritum was optimized by orthogonal test. Powder XRD was used to analyze the phase of calcined Pyritum samples processed according to the best process， and the mean and median maps of calcined Pyritum were established by the superposition of geometric topological figures， and similarity evaluation and cluster analysis were carried out. ResultsThe results of single factor experiments showed that the physical phase of Pyritum changed from FeS₂ to Fe₇S₈ during the process of temperature increase， the color gradually deepened from dark yellow， and the contents of heavy metals and harmful elements decreased. The optimized processing process of calcined Pyritum was as follows：calcination temperature at 750 ℃， calcination time of 2.5 h， paving thickness of 3 cm， particle size of 0.8-1.2 cm， vinegar quenching 1 time［Pyritum-vinegar（10∶3）］. After calcination， the internal structure of Pyritum was honeycomb-shaped， which was conducive to the dissolution of active ingredients. XRD fingerprints of 13 batches of calcined Pyritum characterized by 10 common peaks were established. The similarities of the relative peak intensities of the XRD fingerprints of the analyzed samples were>0.96， and it could effectively distinguish the raw products and unqualified products. ConclusionTemperature is the main factor affecting the quality of calcined Pyritum. After processing， the dissolution of the effective components in Pyritum increases， and the contents of heavy metals and harmful substances decrease， reflecting the function of processing to increase efficiency and reduce toxicity. The optimized processing process is stable and feasible， and the established XRD fingerprint can be used as one of the quality control standards of calcined Pyritum.

Background In recent years, the increasingly widespread application of nuclear and medical radiation technologies has resulted in a large number of occupational populations exposed to low-dose ionizing radiation (LDIR). At present, there is no consistent conclusion on the effects of long-term exposure to LDIR on the metabolic health of the occupational population. Objective To explore the association between long-term exposure to LDIR and metabolic syndrome (MetS) among medical radiologists. Methods A cross-sectional study was conducted to enroll 6431 medical radiologists who ordered occupational health checkups from January 2022 to December 2023, and basic information such as demographic characteristics, occupational characteristics, lifestyles, and dietary habits was collected through questionnaires. Physical examinations were conducted using a standardized protocol. Individual dose equivalents of occupational external exposure were monitored by dosimeters worn by medical radiologists. Logistic regression model was used for identifying influencing factors of MetS and sensitivity analysis, and restricted cubic spline model was used to explore the dose-response relationship between cumulative effective dose and MetS. Two-stage linear regression was used to evaluate threshold effect of association between cumulative effective dose and MetS. Results The positive rate of MetS was 13.6% (877/6431) among the enrolled 6431 study participants. The logistic regression showed that gender, age, monthly income, body mass index (BMI), cumulative effective dose, and smoking were influencing factors for MetS. The risk of MetS was higher in males (OR=1.511, 95%CI: 1.209, 1.888); using the < 30 years old group as reference, the risk of MetS was higher in the 30-39 years old (OR=1.509, 95%CI: 1.095, 2.079), 40-49 years old (OR=2.214, 95%CI: 1.551, 3.161), and ≥50 years old (OR=3.480, 95%CI: 2.338, 5.181) groups; using the <10000 yuan group as reference, the risk of MetS was lower in the group with a monthly income of 10000-14999 yuan (OR=0.715, 95%CI: 0.582, 0.878); the risk of MetS was higher in the BMI ≥ 24 kg·m⁻² group (OR=7.548, 95%CI: 6.223, 9.156); using the < 0.76 mSv group as reference, the risk of MetS was higher in the cumulative effective dose of 0.76-2.73 mSv group (OR=1.270, 95%CI: 1.017, 1.586); the risk of MetS was higher in the smoking group (OR=1.734, 95%CI: 1.428, 2.107). The results of restricted cubic spline showed that the cumulative effective dose was nonlinearly correlated with MetS (P _{non-linearity}=0.028), with an inflection point of 1.25 mSv. The risk of developing MetS increased by 34.1% for each unit increase in cumulative effective dose up to 1.25 mSv, whereas above 1.25 mSv, the statistical association was not significant. The sensitivity analysis results showed that after excluding the self-reported hypertensive and diabetic patients, the cumulative effective dose 0.76-2.73 mSv group still had an increased risk of developing MetS compared with the < 0.76 mSv group (P < 0.05), and the results were robust. Conclusion Among medical radiologists, male, age, BMI, and smoking are positively correlated with MetS, and monthly income is negatively correlated with MetS; cumulative effective dose is non-linearly correlated with MetS among medical radiologists.

Objective To investigate the induction of senescence in L02 hepatocytes by low-dose fractionated X-ray radiation and its effects on oxidative stress, oxidative damage, and nuclear factor-κB (NF-κB) pathway protein levels. Methods L02 cells were subjected to fractionated X-ray irradiation at doses of 0.1, 0.2, and 0.5 Gy per fraction for a total of six fractions. Assays were performed 24 hours after the final irradiation. Measurements included SA-β-gal staining, the mRNAs of senescence-related genes p53 and p21 and their encoded proteins, mRNAs of genes encoding senescence-associated secretory phenotype factors (IL-6, IL-8, GM-CSF, MMP-15), reactive oxygen species, oxidative and anti-oxidative markers (malondialdehyde, glutathione, superoxide dismutase), DNA oxidative damage markers (8-OHdG and γ-H2AX), and NF-κB pathway protein levels. Results Compared with the control group, at 24 hours after the end of six irradiations, the number of cells positive in SA-β-gal staining was significantly increased in all dose groups. The mRNA and protein levels of p21 and p53 were significantly elevated in the 0.2 Gy × 6 and 0.5 Gy × 6 groups (P < 0.05). The mRNA levels of genes encoding IL-6, GM-CSF, and MMP-15 were significantly increased in all dose groups (P < 0.05). The mRNA levels of the gene encoding IL-8 were significantly increased in the 0.2 Gy × 6 and 0.5 Gy × 6 groups (P < 0.05). The levels of reactive oxygen species, malondialdehyde, and glutathione were significantly increased in all dose groups (P < 0.01). The level of superoxide dismutase was significantly increased in the 0.5 Gy × 6 group (P < 0.01). The levels of 8-OHdG were significantly increased in all dose groups (P < 0.05). In both the 0.2 Gy × 6 and 0.5 Gy × 6 groups, the expression levels of γ-H2AX and p-NF-κB p65 were significantly increased (P < 0.05), and the levels of IκBα were significantly decreased (P < 0.05). Conclusion Low-dose fractionated X-ray radiation can induce senescence and cause alterations in oxidative stress, oxidative damage, and the levels of NF-κB pathway proteins in L02 hepatocytes.

How to use family doctors as a starting point to improve the level of chronic disease management is still a ma-jor challenge in China.This study summarizes the current chronic disease management models,family doctor contract service models,and new digital health technologies in China.It expounds the connection between the three and explores the advantages of new digital health technologies in chronic disease management and family doctor contract services,aiming to provide a solid theoretical foundation for improving the level of chronic disease management.

In order to study whether there is a direct interaction between the key variant gene(AP-PV-YN-Mut)protein of atypical porcine pestivirus(APPV)Yunnan strain and the host protein signal sequence receptor subunit 4(SSR4),the physical and chemical properties,spatial structure and subcellular localization of SSR4 protein were analyzed and predicted using online software such as ProtParam,PredictProtein and TMHMM.The recombinant vectors pCMV-Tag4A-SSR4 and pET-GST-Mut were constructed for GST pull-down test in vitro.The recombinant vectors pBiFC-VN173-SSR4 and pBiFC-VC155-Mut were constructed and the bimolecular fluorescence comple-mentary test(BiFC)was performed in cells to verify whether there was direct interaction between APPV-YN-Mut and host protein SSR4 in vitro and in cells.The results showed that SSR4 protein was a hydrophobic stable protein with no transmembrane structure and signal peptide.The second-ary structure was mainly irregular curl,and the tertiary structure was stable,mainly located in the endoplasmic reticulum.GST pull-down and BiFC experiments showed that APPV-YN-Mut interac-ted directly with host protein SSR4 in vitro and in cells.

Objective:To explore the factors influencing adherence to voice therapy among patients with voice disorders in China. Methods:Patients with voice disorders who visited the Voice Therapy Center at Sun Yat-sen Memorial Hospital, Sun Yat-sen University, from February to May 2022 were enrolled in the study. Adherence was assessed using the URICA-Voice scale, while influencing factors were assessed through the Voice Handicap Index（VHI） scale and a general information questionnaire. Correlation analysis was conducted using univariate and multivariate logistic regression analysis. Results:A total of 247 patients were included in the study, comprising 57 males（23.08%） and 190 females（76.92%）. The results revealed that: ①Female patients demonstrated higher likelihood of being in the contemplation stage（OR=0.22） compared to males. ②Patients with a monthly family income per capita>6 000 yuan were more likely to be in the contemplation stage than those with<3 000 yuan with an OR = 13.94. ③High vocal-demand occupations increased contemplation stage probability（OR=7.70） compared to moderate-demand occupations. ④Residence within 30-minute commute predicted action/maintenance stages（OR=7.14） versus≥60-minute commute. ⑤Patients whose occupations had high voice demands were more likely to be in the action and maintenance stages than those with average voice demands, with an OR of 16.20. Conclusion:Gender, monthly family income per capita, occupational voice demands, and distance to the hospital significantly impact the URICA-Voice compliance stages of patients. Patients who are female, have higher family income, have occupations with high voice demands, and live closer to the hospital exhibit higher compliance with voice training.
Humans ; Male ; Female ; Voice Disorders/therapy* ; Patient Compliance ; Voice Training ; Surveys and Questionnaires ; China ; Middle Aged ; Adult ; Voice Quality ; Logistic Models ; Aged