AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

Intraoperative cell salvage (IOCS) has been widely applied as an important blood conservation measure in surgical operations. However, there is currently a lack of clinical practice guidelines for the implementation of IOCS in patients with malignant tumors. This report aims to provide clinicians with recommendations on the use of IOCS in patients with malignant tumors based on the review and assessment of the existed evidence. Data were derived from databases such as PubMed, Embase, the Cochrane Library and Wanfang. The guideline development team formulated recommendations based on the quality of evidence, balance of benefits and harms, patient preferences, and health economic assessments. This study constructed seven major clinical questions. The main conclusions of this guideline are as follows: 1) Compared with no perioperative allogeneic blood transfusion (NPABT), perioperative allogeneic blood transfusion (PABT) leads to a more unfavorable prognosis in cancer patients (Recommended); 2) Compared with the transfusion of allogeneic blood or no transfusion, IOCS does not lead to a more unfavorable prognosis in cancer patients (Recommended); 3) The implementation of IOCS in cancer patients is economically feasible (Recommended); 4) Leukocyte depletion filters (LDF) should be used when implementing IOCS in cancer patients (Strongly Recommended); 5) Irradiation treatment of autologous blood to be reinfused can be used when implementing IOCS in cancer patients (Recommended); 6) A careful assessment of the condition of cancer patients (meeting indications and excluding contraindications) should be conducted before implementing IOCS (Strongly Recommended); 7) Informed consent from cancer patients should be obtained when implementing IOCS, with a thorough pre-assessment of the patient's condition and the likelihood of blood loss, adherence to standardized internally audited management procedures, meeting corresponding conditions, and obtaining corresponding qualifications (Recommended). In brief, current evidence indicates that IOCS can be implemented for some malignant tumor patients who need allogeneic blood transfusion after physician full evaluation, and LDF or irradiation should be used during the implementation process.

[Objective] To explore the temperature parameters affecting the polybrene test and determine the optimal temperature conditions for detecting unexpected antibodies of the Rh system. [Methods] The reaction of IgG human anti-D antibody with different dilutions (undiluted, 1∶2, 1∶4, 1∶8, 1∶16, 1∶32，1∶64) with D antigen-positive red blood cells was detected by manual polybrene test (MPT). Different temperatures (25℃ and 37℃) were set, and the reaction time with low ionic medium was 4 minutes. The agglutination integral value of anti-D and red cell depolymerization time were compared to observe the effect of enhanced agglutination reaction, thereby establishing the test temperature reaction conditions for enhancing the MPT. The same reaction condition was applied to 36 blood samples containing unexpected antibodies of the Rh system, and the effect of enhanced MPT was observed in comparison with the polybrene method and the antiglobulin test (column agglutination). [Results] With all other conditions held constant, when low ionic medium was added, the incubation temperature of 25℃ and 37℃ resulted in different total agglutination integral values for anti-D (20.9±2.025 vs 25.5±2.635), and the comparison showed a significant difference (P<0.05). When the antibody dilution was 1∶16, the incubation temperature of 25℃ and 37℃ resulted in different agglutination integral values (3.9±0.738 vs 5.8±0.632), and the comparison showed a significant difference (P<0.05). Erythrocyte depolymerization time (62.8±8.149 vs 90.1±10.713) was significantly different (P<0.05). At a dilution of 1∶32, the incubation temperatures of 25℃ and 37℃ resulted in different agglutination integral values (2.5±0.527 vs 4.3±0.675), as well as different red blood cell dissociation times (35.4±7.792 vs 57.4±10.885)(P<0.05), and the comparison showed a significant difference (P<0.05), with no differences observed in the other groups. In the detection of 36 Rh system unexpected antibody samples, when the antibody titer was ≤2, the enhanced polybrene method had a higher positive rate, and when the antibody titer was ≥4, the detection rates of the three methods were consistent. [Conclusion] The reference temperature condition for the modified MPT is incubation at 37℃ for 4 min after the addition of low ionic medium. The application of this temperature condition to unexpected antibody samples of Rh system could achieve a significant enhancement effect, thereby increasing transfusion safety for the treatment of emergency patients, and is worth popularizing.

Aim To investigate the effect of p-AMPK activity on autophagy in different subtypes of MDA-MB-231(triple-negative breast cancer cells)and MCF-7(estrogen receptor-positive cells)and its regulatory mechanism.Methods MDA-MB-231 cells were trea-ted with EBSS,Baf-A1,and EBSS+Baf-A1 for four hours,and MCF-7 cells for eight hours.The effects of autophagy on cell proliferation and apoptosis were ob-served,mitochondrial morphology was examined,and the expression of autophagy markers LC3B,P62,LAMP1,TOM20,AMPK,p-AMPK,ULK1,and Bec-lin1/VPS34 proteins was detected.The autophagy pathway was validated by inhibiting AMPK activity.Results Breast cancer cells underwent autophagy af-ter starvation induction(EBSS),with inconsistent au-tophagy processes observed in different subtypes of breast cancer cells.Autophagy inhibited cell prolifera-tion.In MDA-MB-231 cells,autophagy led to an in-crease in p-AMPK levels and a decrease in ULK1 lev-els,initiating autophagy through p-AMPK activation of ULK1.In MCF-7 cells,both p-AMPK and ULK1 levels decreased after autophagy,suggesting that autophagy might not be mediated by p-AMPK activation.Conclu-sions MDA-MB-231 cells primarily initiate autophagy by directly activating ULK1 by p-AMPK,independent of the MTOR pathway.In MCF-7 cells autophagy might be triggered by inhibiting MTOR through AMPK activity or directly activating MTOR through other up-stream factors.Regulating p-AMPK activity based on the autophagy pathways in different cell subtypes could enable more precise targeting and treatment of different types of breast cancer.

How to use family doctors as a starting point to improve the level of chronic disease management is still a ma-jor challenge in China.This study summarizes the current chronic disease management models,family doctor contract service models,and new digital health technologies in China.It expounds the connection between the three and explores the advantages of new digital health technologies in chronic disease management and family doctor contract services,aiming to provide a solid theoretical foundation for improving the level of chronic disease management.

AIM To study the chemical constituents from ethyl acetate fraction of Balanophora harlandii Hook.f.and their tyrosinase inhibitory activity.METHODS Separation and purification were performed using silica gel,MCI,ODS,Sephadex LH-20 and semi-preparative HPLC,then the structures of obtained compounds were identified by physicochemical properties and spectral data.The monophenolase inhibitory activity was determined by the tyrosinase-catalyzed oxidation of L-tyrosine.RESULTS Twenty-four compounds were isolated and identified as sesamin(1),methyl caffeate(2),quercetin(3),5,7-dihydroxychromanone(4),methyl 3,4-dihydroxybenzoate(5),esculetin(6),kaempferol(7),naringenin(8),pyrogallic acid(9),pinosylvin(10),methyl propionate(11),caffeic acid(12),saccharinol(13),ferulic acid(14),trans-p-hydroxycinnamic acid(15),cinnamic acid(16),vanillic acid(17),vanillin(18),4-hydroxyacetophenone(19),4-hydroxybenzaldehyde(20),apigenin(21),(-)-isolariciresinol(22),(-)-secoisolariciresinol(23)and meso-2,3-di(3′,4′-methylenedioxybenzyl)butane-1,4-diol(24).The IC50 values of compounds 3,5,7,8,19,and 20 ranged from(0.246 5±0.028 3)to(1.278 2±0.021 3)mmol/L.CONCLUSION Compounds 1-9、11、15、17-21、24 are isolated from this plant for the first time,and 1,6,9,17-19,24 are first isolated from genus Balanophora.Compounds 3、5、7、8、19 and 20 have tyrosinase inhibitory activity.

Objective To explore the relationship between triglyceride-glucose(TyG)index and hypertension in patients with cerebral hemorrhage.Methods A total of 1718 patients with cere-bral hemorrhage admitted to our hospital from January,2013 to May,2023 were enrolled in this study.According to the TyG index quartile,437 cases were assigned into Q1 group(≤8.375),424 cases into Q2 group(TyG index 8.376～8.737),429 cases into Q3 group(TyG index 8.738～9.087),and 428 cases into Q4 group(≥9.088).The general clinical data were compared in the four groups.Logistic regression analysis was used to study the correlation between TyG index and hy-pertension.Results There were significant differences among the four groups in terms of age,hy-pertension,diabetes,SBP,DBP,TC,TG,HDL-C,LDL-C,FBG,glycated hemoglobin and TyG in-dex(P＜0.05,P＜0.01).Logistic regression analysis showed that when the TyG index was a con-tinuous variable,it was significantly correlated with the risk of hypertension(OR=1.999,95％CI:1.393-2.869,P=0.001).When the index was used as a categorical variable,with Q1as a ref-erence,TyG index in Q3 and Q4 was associated with an increase in OR of hypertension(OR=1.869,95％CI:1.220-2.865,P=0.004;OR=1.844,95％CI:1.125-3.020,P=0.015).After ad-justing cofounders,the association of TyG index and risk of hypertension was stronger in the fe-males(OR=2.618,95％CI:1.312-5.221,P=0.006)than the males(OR=1.783,95％CI:1.151-2.761,P=0.010),and in the patients ≥65 years old(OR=3.277,95％CI:1.600-6.741,P=0.001)than those＜65 years old(OR=1.782,95％CI:1.076-2.949,P=0.025).Conclusion TyG index is closely associated with hypertension in patients with cerebral hemorrhage,especially in women and elderly.

Aim To investigate the effect of p-AMPK activity on autophagy in different subtypes of MDA-MB-231(triple-negative breast cancer cells)and MCF-7(estrogen receptor-positive cells)and its regulatory mechanism.Methods MDA-MB-231 cells were trea-ted with EBSS,Baf-A1,and EBSS+Baf-A1 for four hours,and MCF-7 cells for eight hours.The effects of autophagy on cell proliferation and apoptosis were ob-served,mitochondrial morphology was examined,and the expression of autophagy markers LC3B,P62,LAMP1,TOM20,AMPK,p-AMPK,ULK1,and Bec-lin1/VPS34 proteins was detected.The autophagy pathway was validated by inhibiting AMPK activity.Results Breast cancer cells underwent autophagy af-ter starvation induction(EBSS),with inconsistent au-tophagy processes observed in different subtypes of breast cancer cells.Autophagy inhibited cell prolifera-tion.In MDA-MB-231 cells,autophagy led to an in-crease in p-AMPK levels and a decrease in ULK1 lev-els,initiating autophagy through p-AMPK activation of ULK1.In MCF-7 cells,both p-AMPK and ULK1 levels decreased after autophagy,suggesting that autophagy might not be mediated by p-AMPK activation.Conclu-sions MDA-MB-231 cells primarily initiate autophagy by directly activating ULK1 by p-AMPK,independent of the MTOR pathway.In MCF-7 cells autophagy might be triggered by inhibiting MTOR through AMPK activity or directly activating MTOR through other up-stream factors.Regulating p-AMPK activity based on the autophagy pathways in different cell subtypes could enable more precise targeting and treatment of different types of breast cancer.