AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

ObjectiveBased on transcriptomics， to explore the mechanism of Hei Xiaoyaosan regulating the phosphatidylinositol 3-kinase/protein kinase B （PI3K/Akt） signaling pathway to improve the learning and memory ability of insomnia rats with liver depression syndrome. MethodsSixty 8-week-old male SD rats were randomly divided into the blank group， model group， eszopiclone group （0.09 mg·kg^-1）， and low， medium， and high dose groups of Hei Xiaoyaosan （3.82， 7.65， 15.30 g·kg^-1）， with ten rats in each group. Except for the blank group， the other groups were induced insomnia rat model with liver depression by chronic restraint， tail clamping stimulation and intraperitoneal injection of p-chlorophenylalanine （PCPA）. Each treatment group received intragastric administration according to the specified dosage， once a day for 14 consecutive days. The pentobarbital sodium cooperative sleep test， open field test， and Morris water maze test were used to test the sleep quality， depressive-like behavior， and learning and memory abilities of rats. Additionally， enzyme-linked immunosorbent assay （ELISA） was used to detect the contents of 5-hydroxytryptamine （5-HT）， γ-aminobutyric acid （GABA）， brain-derived neurotrophic factor （BDNF）， glial cell line-derived neurotrophic factor （GDNF） and nitric oxide （NO） in hippocampus. Hematoxylin-eosin （HE） staining was performed to observe pathological changes of the hippocampal tissue， while terminal deoxynucleotidyl transferase deoxyuridine triphosphate （dUTP） nick end labeling （TUNEL） was used to evaluate apoptosis of hippocampal neurons. Transcriptomic sequencing technology was employed to identify differentially expressed genes in hippocampus between the model group and the blank group， as well as between the medium-dose group of Hei Xiaoyaosan and the model group. Gene Ontology （GO） and Kyoto Encyclopedia of Genes and Genomes （KEGG） enrichment analysis were performed on the intersecting genes. Subsequently， the enriched key genes and signaling pathways were analyzed and verified. Real-time fluorescence quantitative polymerase chain reaction （Real-time PCR） was utilized to assess the mRNA expression levels of phosphatase and tensin homolog （PTEN）， B-cell lymphoma-2 （Bcl-2）-like protein 11 （BCL2L11）， and mitogen-activated protein kinase 1 （MAPK1） in hippocampus， and Western blot was employed to evaluate the protein expressions of PI3K， phosphorylation （p）-PI3K， Akt， p-Akt， Bcl-2， Bcl-2-associated X protein （Bax）， and cleaved Caspase-3 in the same tissue. ResultsCompared with the blank group， the model group exhibited a reduction in body weight， an increase in sleep latency， and a decrease in sleep duration （P<0.01）. Additionally， rats showed obvious depression-like behavior， and their learning and memory abilities decreased. Furthermore， the contents of 5-HT， GABA， NO， BDNF and GDNF in hippocampus decreased （P<0.01）. Histological examination revealed a disorganized cell arrangement in the CA1 region of the hippocampus， characterized by irregular cell shapes， a reduced cell count， deeply stained and pyknotic nuclei， increased vacuolar degeneration， and an elevated apoptosis rate （P<0.01）. Compared with the model group， the body weight of the high and medium dose groups of Hei Xiaoyaosan increased， the sleep latency shortened and the sleep time prolonged （P<0.05， P<0.01）. Additionally， depression-like behavior and learning and memory abilities of rats were significantly improved， the levels of 5-HT， GABA， NO， BDNF and GDNF in the hippocampus increased （P<0.05， P<0.01）. These interventions also ameliorated pathological damage in the hippocampal CA1 area and reduced the apoptosis of hippocampal neurons （P<0.01）. Transcriptomic sequencing results indicated that Hei Xiaoyaosan might exert a therapeutic effect by regulating PI3K/Akt pathway through key mRNAs such as PTEN， BCL2L11， and MAPK1. The roles of these key mRNAs and proteins within PI3K/Akt pathway were further validated. In comparison to the blank group， the expression levels of PTEN， BCL2L11 and MAPK1 mRNA in the hippocampus of rats in the model group were increased （P<0.01）， while the protein expression levels of p-PI3K， p-Akt and Bcl-2 were decreased （P<0.01）， and the protein expression levels of PTEN， Bax and cleaved Caspase-3 were increased （P<0.01）. Compared with the model group， the high-dose and medium-dose groups of Hei Xiaoyaosan could down-regulate the expressions of PTEN， BCL2L11 and MAPK1 mRNAs （P<0.01）， up-regulate the expressions of p-PI3K， p-Akt and Bcl-2 proteins （P<0.01）， and down-regulate the protein expressions of PTEN， Bax and cleaved Caspase-3 （P<0.05， P<0.01）. ConclusionHei Xiaoyaosan may regulate PI3K/Akt signaling pathway by down-regulating expressions of key genes such as PTEN， BCL2L11 and MAPK1， and thus improve the learning and memory abilities of insomnia rats with liver depression syndrome.

OBJECTIVE To explore the mechanism of Shenqi guben formula （SQGB） in improving cancer-related fatigue （CRF） based on network pharmacology and cellular experiments. METHODS Active components of SQGB and CRF-related targets were identified on the basis of databases such as the Traditional Chinese Medicine Systems Pharmacology platform. An in vitro CRF cell model was established by inducing A549 cells with interleukin-17 （IL-17）. Cells were treated with low （1.0 mg/mL） or high （1.5 mg/mL） concentrations of SQGB. The effects on cell viability， migration， apoptosis， inflammatory factors， mRNA expression， apoptosis-related proteins and key proteins 011） of IL-17 signaling pathway were evaluated using scratch assay， flow cytometry， ELISA， real-time fluorescent quantitative PCR and Western blot analysis. RESULTS SQGB contained 84 active components acting on 209 potential CRF targets. Among E-these， quercetin， kaempferol， and luteolin were identified as the core components of the compound. Core targets included tumor protein p53， AKT serine/threonine kinase 1， IL-6， and tumor necrosis factor （TNF）. IL-17， TNF and phosphatidylinositol-3- kinase-serine/threonine protein kinase （PI3K/Akt） signaling pathways were identified as crucial pathways. Compared with IL-17 intervention group， the cell migration rate， B-cell lymphoma 2 （Bcl-2） protein expression， the levels of IL-6 and TNF-α in the supernatant， mRNA expression of IL-17 receptor A （IL-17RA）， TNF-α， and IL-6， as well as the protein expression of IL-17RA and nuclear factor kappa-B p65 subunit （p65）， and phosphorylated （p）-p65/p65 ratio in IL-17+SQGB low- and high- quality concentration groups were all significantly decreased or down-regulation （P＜0.05）； the apoptosis rate， expression levels of Bcl-2 associated X protein （Bax） and cleaved caspase-3 protein， the ratio of Bax/Bcl-2， the expression level of p-p38 protein， and the p- p38/p38 ratio were all significantly increased or up-regulated （P＜0.05）. Moreover， the improvement effects of these indicators were mostly better in the high-quality concentration groups compared to the low-quality concentration groups （P＜0.05）. CONCLUSIONS SQGB ameliorates CRF by regulating the IL-17 signaling pathway， inhibiting the expression of inflammatory factors， and activating p38 MAPK-dependent apoptosis pathway.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

Yinyang Gongji Pills have the effects of strengthening the body resistance to eliminate pathogenic factors, removing stasis, and reducing swelling, which is a commonly used traditional Chinese medicine(TCM) formula for treating intestinal accumulation. A real-world, registered, and single-arm clinical trial was conducted to observe the clinical efficacy and safety of Yinyang Gongji Pills combined with capecitabine in the treatment of advanced colorectal cancer and analyze the clinical characteristics of the patients. A total of 60 patients with advanced colorectal cancer who refused or could not tolerate standard treatment of western medicine were included in the study. They were treated with Yinyang Gongji Pills combined with capecitabine until disease progression or intolerable adverse events occurred. The main observation indicators were progression-free survival(PFS) and safety. The treatment effects of the patients under different baseline characteristics were analyzed. The clinical trial has found that the median PFS of all enrolled patients was 7.3 months, with 30.1% of patients having a PFS exceeding 12.0 months. Layered analysis showed that the median PFS of patients with the onset site being the colon and rectum were respectively 8.4 and 4.7 months. The median PFS of patients with high, medium, and low tumor burden were respectively 7.0, 4.7, and 10.8 months. The median PFS of patients with wild-type and mutant-type RAS/BRAF were respectively 7.9 and 6.9 months. The median PFS of patients with KPS scores ≥80 and ≤70 were respectively 7.9 and 6.5 months. The median PFS of patients treated with Yinyang Gongji Pills for ≥6, 3-6, and ≤3 months were respectively 8.0, 5.2, and 4.2 months. The median PFS of patients with spleen, kidney, liver, and lung syndrome differentiation in TCM were respectively 8.3, 6.7, 7.3, and 5.6 months. The median PFS of patients with TCM pathological factors including phlegm, dampness, and blood stasis were respectively 7.0, 7.3, and 6.5 months. Common adverse reactions include anemia, decreased white blood cells, decreased appetite, fatigue, and hand foot syndrome, with incidence rates being respectively 44.2%, 34.6%, 42.3%, 32.7%, and 17.3%. The results showed that the combination of Yinyang Gongji Pills and capecitabine demonstrated potential clinical efficacy and good safety in this study. The patients have clinical characteristics such as low tumor burden, onset site at the colon, KPS scores ≥ 80, long duration of oral TCM, and TCM syndrome differentiation including spleen or liver.
Humans ; Capecitabine/adverse effects* ; Colorectal Neoplasms/mortality* ; Drugs, Chinese Herbal/adverse effects* ; Male ; Middle Aged ; Female ; Aged ; Adult ; Treatment Outcome

In order to compare the differences in growth and secondary metabolite accumulation of Panax quinquefolius between understory and field planting, growth indexes, photosynthetic characteristics, soil enzyme activities, secondary metabolite contents, and antioxidant activities of P. quinquefolius under different planting modes were examined and compared, and One-way analysis of variance(ANOVA) and correlation analyses were carried out by using the software SPSS 25.0 and GraphPad Prism 9.5. The Origin 2021 software was used for plotting. The results showed that compared with those under field planting, the plant height, leaf length, leaf width, photosynthetic rate, and chlorophyll content of P. quinquefolius under understory planting were significantly reduced, and arbuscular mycorrhizal fungi(AMF) infestation rate and infestation intensity, ginsenoside content, and antioxidant activity were significantly increased. The activities of inter-root soil urease, sucrase, and catalase increased, while the activities of non-inter-root soil urease and alkaline phosphatase increased. Correlation analyses showed that the plant height and leaf length of P. quinquefolius plant were significantly positively correlated with net photosynthetic rate, transpiration rate, chlorophyll content, and electron transfer rate(P<0.05), while ginsenoside content was significantly negatively correlated with net photosynthetic rate, chlorophyll content, and electron transfer rate(P<0.05) and significantly positively correlated with AMF infestation rate and infestation intensity(P<0.05). In addition, ginsenoside content was significantly positively correlated with the activities of inter-root soil sucrase, urease, and catalase(P<0.05). This study provides basic data for revealing the mechanism of secondary metabolite accumulation in P. quinquefolius under understory planting and for exploring and practicing the ecological mode of P. quinquefolius under understory planting.
Panax/microbiology* ; China ; Secondary Metabolism ; Soil/chemistry* ; Photosynthesis ; Plant Leaves/metabolism* ; Chlorophyll/metabolism* ; Mycorrhizae

Guided by the concept of quality by design(QbD), this study optimizes the calcination and quenching process of calcined Magnetitum and establishes the XRD characteristic spectra of calcined Magnetitum, providing a scientific basis for the formulation of quality standards. Based on the processing methods and quality requirements of Magnetitum in the Chinese Pharmacopoeia, the critical process parameters(CPPs) identified were calcination temperature, calcination time, particle size, laying thickness, and the number of vinegar quenching cycles. The critical quality attributes(CQAs) included Fe mass fraction, Fe~(2+) dissolution, and surface color. The weight coefficients were determined by combining Analytic Hierarchy Process(AHP) and the criteria importance though intercrieria correlation(CRITIC) method, and the calcination process was optimized using orthogonal experimentation. Surface color was selected as a CQA, and based on the principle of color value, the surface color of calcined Magnetitum was objectively quantified. The vinegar quenching process was then optimized to determine the best processing conditions. X-ray diffraction(XRD) was used to establish the characteristic spectra of calcined Magnetitum, and methods such as similarity evaluation, cluster analysis, and orthogonal partial least squares-discriminant analysis(OPLS-DA) were used to evaluate the quality of the spectra. The optimized calcined Magnetitum preparation process was found to be calcination at 750 ℃ for 1 h, with a laying thickness of 4 cm, a particle size of 0.4-0.8 cm, and one vinegar quenching cycle(Magnetitum-vinegar ratio 10∶3), which was stable and feasible. The XRD characteristic spectra analysis method, featuring 9 common peaks as fingerprint information, was established. The average correlation coefficient ranged from 0.839 5-0.988 1, and the average angle cosine ranged from 0.914 4 to 0.995 6, indicating good similarity. Cluster analysis results showed that Magnetitum and calcined Magnetitum could be grouped together, with similar compositions. OPLS-DA discriminant analysis identified three key characteristic peaks, with Fe_2O_3 being the distinguishing component between the two. The final optimized processing method is stable and feasible, and the XRD characteristic spectra of calcined Magnetitum was initially established, providing a reference for subsequent quality control and the formulation of quality standards for calcined Magnetitum.
X-Ray Diffraction/methods* ; Drugs, Chinese Herbal/chemistry* ; Quality Control ; Particle Size

This study aims to investigate the protective effects and mechanisms of polysaccharide extract PCP1 from Polygonatum cyrtonema in ameliorating cerebral ischemia-reperfusion(I/R) injury in rats through modulation of the Toll-like receptor 4(TLR4)/NOD-like receptor protein 3(NLRP3) signaling pathway. In vivo, SD rats were randomly divided into the sham group, model group, PCP1 group, nimodipine(NMDP) group, and TLR4 signaling inhibitor(TAK-242) group. A middle cerebral artery occlusion/reperfusion(MCAO/R) model was established, and neurological deficit scores and infarct size were evaluated 24 hours after reperfusion. Hematoxylin-eosin(HE) and Nissl staining were used to observe pathological changes in ischemic brain tissue. Transmission electron microscopy(TEM) assessed ultrastructural damage in cortical neurons. Enzyme-linked immunosorbent assay(ELISA) was used to measure the levels of interleukin-1β(IL-1β), interleukin-6(IL-6), interleukin-18(IL-18), tumor necrosis factor-α(TNF-α), interleukin-10(IL-10), and nitric oxide(NO) in serum. Immunofluorescence was used to analyze the expression of TLR4 and NLRP3 proteins. In vitro, a BV2 microglial cell oxygen-glucose deprivation/reperfusion(OGD/R) model was established, and cells were divided into the control, OGD/R, PCP1, TAK-242, and PCP1 + TLR4 activator lipopolysaccharide(LPS) groups. The CCK-8 assay evaluated BV2 cell viability, and ELISA determined NO release. Western blot was used to analyze the expression of TLR4, NLRP3, and downstream pathway-related proteins. The results indicated that, compared with the model group, PCP1 significantly reduced neurological deficit scores, infarct size, ischemic tissue pathology, cortical cell damage, and the levels of inflammatory factors IL-1β, IL-6, IL-18, TNF-α, and NO(P<0.01). It also elevated IL-10 levels(P<0.01) and decreased the expression of TLR4 and NLRP3 proteins(P<0.05, P<0.01). Moreover, in vitro results showed that, compared with the OGD/R group, PCP1 significantly improved BV2 cell viability(P<0.05, P<0.01), reduced cell NO levels induced by OGD/R(P<0.01), and inhibited the expression of TLR4-related inflammatory pathway proteins, including TLR4, myeloid differentiation factor 88(MyD88), tumor necrosis factor receptor-associated factor 6(TRAF6), phosphorylated nuclear factor-kappaB dimer RelA(p-p65)/nuclear factor-kappaB dimer RelA(p65), NLRP3, cleaved-caspase-1, apoptosis-associated speck-like protein(ASC), GSDMD-N, IL-1β, and IL-18(P<0.05, P<0.01). The protective effects of PCP1 were reversed by LPS stimulation. In conclusion, PCP1 ameliorates cerebral I/R injury by modulating the TLR4/NLRP3 signaling pathway, exerting anti-inflammatory and anti-pyroptotic effects.
Animals ; Toll-Like Receptor 4/genetics* ; NLR Family, Pyrin Domain-Containing 3 Protein/genetics* ; Rats, Sprague-Dawley ; Rats ; Reperfusion Injury/genetics* ; Male ; Signal Transduction/drug effects* ; Polysaccharides/isolation & purification* ; Polygonatum/chemistry* ; Brain Ischemia/genetics* ; Drugs, Chinese Herbal/administration & dosage* ; Mice ; Humans

This study explores the role and underlying molecular mechanisms of fucoidan sulfate(FPS) in regulating heme oxygenase-1(Hmox1)-mediated ferroptosis to ameliorate myocardial injury in diabetic cardiomyopathy(DCM) through in vivo and in vitro experiments and network pharmacology analysis. In vivo, a DCM rat model was established using a combination of "high-fat diet feeding + two low-dose streptozotocin(STZ) intraperitoneal injections". The rats were randomly divided into four groups: normal, model, FPS, and dapagliflozin(Dapa) groups. In vitro, a cellular model was created by inducing rat cardiomyocytes(H9c2 cells) with high glucose(HG), using zinc protoporphyrin(ZnPP), an Hmox1 inhibitor, as the positive control. An automatic biochemical analyzer was used to measure blood glucose(BG), serum aspartate aminotransferase(AST), serum lactate dehydrogenase(LDH), and serum creatine kinase-MB(CK-MB) levels. Echocardiography was used to assess rat cardiac function, including ejection fraction(EF) and fractional shortening(FS). Pathological staining was performed to observe myocardial morphology and fibrotic characteristics. DCFH-DA fluorescence probe was used to detect reactive oxygen species(ROS) levels in myocardial tissue. Specific assay kits were used to measure serum brain natriuretic peptide(BNP), myocardial Fe~(2+), and malondialdehyde(MDA) levels. Western blot(WB) was used to detect the expression levels of myosin heavy chain 7B(MYH7B), natriuretic peptide A(NPPA), collagens type Ⅰ(Col-Ⅰ), α-smooth muscle actin(α-SMA), ferritin heavy chain 1(FTH1), solute carrier family 7 member 11(SLC7A11), glutathione peroxidase 4(GPX4), 4-hydroxy-2-nonenal(4-HNE), and Hmox1. Immunohistochemistry(IHC) was used to examine Hmox1 protein expression patterns. FerroOrange and Highly Sensitive DCFH-DA fluorescence probes were used to detect intracellular Fe~(2+) and ROS levels. Transmission electron microscopy was used to observe changes in mitochondrial morphology. In network pharmacology, FPS targets were identified through the PubChem database and PharmMapper platform. DCM-related targets were integrated from OMIM, GeneCards, and DisGeNET databases, while ferroptosis-related targets were obtained from the FerrDb database. A protein-protein interaction(PPI) network was constructed for the intersection of these targets using STRING 11.0, and core targets were screened with Cytoscape 3.9.0. Molecular docking analysis was conducted using AutoDock and PyMOL 2.5. In vivo results showed that FPS significantly reduced AST, LDH, CK-MB, and BNP levels in DCM model rats, improved cardiac function, decreased the expression of myocardial injury proteins(MYH7B, NPPA, Col-Ⅰ, and α-SMA), alleviated myocardial hypertrophy and fibrosis, and reduced Fe~(2+), ROS, and MDA levels in myocardial tissue. Furthermore, FPS regulated the expression of ferroptosis-related markers(Hmox1, FTH1, SLC7A11, GPX4, and 4-HNE) to varying degrees. Network pharmacology results revealed 313 potential targets for FPS, 1 125 targets for DCM, and 14 common targets among FPS, DCM, and FerrDb. Hmox1 was identified as a key target, with FPS showing high docking activity with Hmox1. In vitro results demonstrated that FPS restored the expression levels of ferroptosis-related proteins, reduced intracellular Fe~(2+) and ROS levels, and alleviated mitochondrial structural damage in cardiomyocytes. In conclusion, FPS improves myocardial injury in DCM, with its underlying mechanism potentially involving the regulation of Hmox1 to inhibit ferroptosis. This study provides pharmacological evidence supporting the therapeutic potential of FPS for DCM-induced myocardial injury.
Animals ; Ferroptosis/drug effects* ; Rats ; Diabetic Cardiomyopathies/physiopathology* ; Male ; Rats, Sprague-Dawley ; Polysaccharides/pharmacology* ; Heme Oxygenase-1/genetics* ; Myocytes, Cardiac/metabolism* ; Myocardium/pathology* ; Humans ; Cell Line ; Heme Oxygenase (Decyclizing)