1.Quercetin Ameliorates Gouty Arthritis in Rats via ROS/NLRP3/IL-1β Signaling Pathway
Baowei FENG ; Yan WANG ; Chang LI ; Yujing ZHANG ; Dingxing FAN ; Xin LI
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(2):145-153
ObjectiveTo investigate the effect of quercetin on acute gouty arthritis (GA) in rats by inhibiting the reactive oxygen species (ROS)/NOD-like receptor protein 3 (NLRP3)/interleukin-1β (IL-1β) signaling pathway. MethodsSixty SPF-grade male SD rats were randomized into normal, model, colchicine (0.3 mg·kg-1), and low-, medium-, and high-dose (25, 50, 100 mg·kg-1, respectively) quercetin groups (n=10). The rats in the dosing groups were administrated with the corresponding drugs (10 mL·kg-1) by gavage once a day for one week. An equal volume of normal saline was given by gavage to rats in normal and model groups. One hour after drug administration on day 5, an acute GA model was established in other groups except the control group via intra-articular injection of monosodium urate (MSU) suspension into the right posterior ankle joint cavity. The joint swelling and gait were scored at the time points of 6, 12, 24, 48 h after modeling. Histopathological alterations in the ankle joint tissue from each group were assessed by hematoxylin-eosin (HE) staining. Malondialdehyde (MDA), xanthine oxidase (XOD), and total superoxide dismutase (T-SOD) assay kits were used to assess the levels of MDA, XOD, and T-SOD in the serum. The levels of tumor interleukin-6 (IL-6), necrosis factor-α (TNF-α), and IL-1β in the rat serum, as well as ROS in the ankle joint tissue, were measured by enzyme-linked immunosorbent assay (ELISA). Western blot was performed to determine the protein levels of NLRP3, thioredoxin-interacting protein (TXNIP), apoptosis-associated speck-like protein containing a CARD domain (ASC), precursor cysteinyl aspartate-specific proteinase-1 (pro-Caspase-1), cleaved Caspase-1 (Caspase-1 p20), and IL-1β in the ankle joint tissue. Real-time PCR was employed to assess the mRNA levels of TXNIP, NLRP3, ASC, IL-1β, and TNF-α in the ankle joint tissue. ResultsCompared with the normal group, the model group exhibited decreased spontaneous activity, mental fatigue, increased ankle joint swelling and gait scores (P<0.01), aggravated synovial tissue edema and inflammatory cell infiltration (P<0.01), elevated levels of XOD, MDA, TNF-α, IL-1β, and IL-6 in the serum and ROS in the joint tissue (P<0.01), a declined level of T-SOD (P<0.01), up-regulated protein levels of NLRP3, TXNIP, ASC, pro-Caspase-1, Caspase-1 p20, and IL-1β in the ankle joint tissue (P<0.01), and up-regulated mRNA levels of NLRP3, TXNIP, ASC, IL-1β, and TNF-α in the ankle joint tissue (P<0.01). Compared with the model group, the medium- and high-dose quercetin groups showed improved general conditions, decreased gait scores (P<0.05, P<0.01), reduced joint swelling (P<0.01), alleviated synovial tissue edema and inflammatory cell infiltration (P<0.05, P<0.01), lowered levels of XOD, MDA, TNF-α, IL-1β, and IL-6 in the serum and ROS in the joint tissue (P<0.01), increased levels of T-SOD (P<0.01), down-regulated protein levels of TXNIP, NLRP3, ASC, pro-Caspase-1, Caspase-1 p20, and IL-1β in the ankle joint tissue (P<0.05, P<0.01), and down-regulated mRNA levels of TXNIP, NLRP3, ASC, IL-1β, and TNF-α in the ankle joint tissue (P<0.01). Low-dose quercetin also ameliorated some of the above parameters (P<0.05, P<0.01). ConclusionQuercetin exerts anti-GA effects by blocking the ROS/NLRP3/IL-1β signaling pathway, downregulating NLRP3 inflammasome activation, and inhibiting the production of pro-inflammatory cytokines including TNF-α, IL-1β, and IL-6.
2.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
3.Research progress on the association between food environment and obesity
JIA Menghan ; CHEN Pei ; LI Xin ; SUN Ling
Journal of Preventive Medicine 2026;38(1):43-47
Obesity is a multi-factorial disease involving genetics, individual behavior, socio-economic status, and environmental factors, and has become a global public health issue. The food environment, as an external factor amenable to direct intervention, affects the development of obesity by shaping individual food acquisition and consumption behaviors. The food environment refers to the physical and social environment where food is accessible, and can be assessed from dimensions such as availability, accessibility, and affordability through geographic information system spatial analysis, field surveys, commercial databases, and questionnaires. Studies indicate that the food environment can influence obesity through the spatial shaping effects of dietary structure and sociobehavioral pathways. A healthy food environment is negatively correlated with the risk of obesity, whereas an unhealthy food environment is positively correlated with the risk of obesity. This paper reviews studies related to the correlation between the food environment and obesity, covering the prevalence of obesity, the definition and assessment methods of the food environment, and the mechanisms by which the food environment affects obesity. It summarizes food environment intervention strategies centered on urban planning, policies and regulations, and community education to provide a reference for obesity prevention and control.
4.Comparison of Wild and Cultivated Gardeniae Fructus Based on Traditional Quality Evaluation
Yuanjun SHANG ; Bo GENG ; Xin CHEN ; Qi WANG ; Guohua ZHENG ; Chun LI ; Zhilai ZHAN ; Junjie HU
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(5):225-234
ObjectiveBased on traditional quality evaluation of Gardeniae Fructus(GF) recorded in historical materia medica, this study systematically compared the quality differences between wild and cultivated GF from morphological characteristics, microscopic features, and contents of primary and secondary metabolites. MethodsVernier calipers and analytical balances were used to measure the length, diameter and individual fruit weight of wild and cultivated GF, and the aspect ratio was calculated. A colorimeter was used to determine the chromaticity value of wild and cultivated GF, and the paraffin sections of them were prepared by safranin-fast green staining and examined under an optical microscope to observe their microstructure. Subsequently, the contents of water-soluble and alcohol-soluble extracts of wild and cultivated GF were detected by hot immersion method under the general rule 2201 in volume Ⅳ of the 2020 edition of the Pharmacopoeia of the People's Republic of China, the starch content was measured by anthrone colorimetric method, the content of total polysaccharides was determined by phenol-sulfuric acid colorimetric method, the sucrose content was determined by high performance liquid chromatography coupled with evaporative light scattering detection(HPLC-ELSD), and the contents of representative components in them were measured by ultra-performance liquid chromatography(UPLC). Finally, correlation analysis was conducted between quality traits and phenotypic traits, combined with multivariate statistical analysis methods such as principal component analysis(PCA) and orthogonal partial least squares-discriminant analysis(OPLS-DA), key differential components between wild and cultivated GF were screened. ResultsIn terms of traits, the wild GF fruits were smaller, exhibiting reddish yellow or brownish red hues with significant variation between batches. While the cultivated GF fruits are larger, displaying deeper orange-red or brownish red. The diameter and individual fruit weight of cultivated GF were significantly greater than those of wild GF, while the blue-yellow value(b*) of wild GF was significantly higher than that of cultivated GF. In the microstructure, the mesocarp of wild GF contained numerous scattered calcium oxalate cluster crystals, while the endocarp contained stone cell class round, polygonal or tangential prolongation, undeveloped seeds were visible within the fruit. In contrast, the mesocarp of cultivated GF contained few calcium oxalate cluster crystals, or some batches exhibited extremely numerous cluster crystals. The stone cells in the endocarp were predominantly round-like, with the innermost layer arranged in a grid pattern. Seeds were basically mature, and only a few immature seeds existed in some batches. Regarding primary metabolite content, wild GF exhibited significantly higher total polysaccharide level than cultivated GF(P<0.01). In category-specific component content, wild GF exhibited significantly higher levels of total flavonoids and total polyphenols compared to cultivated GF(P<0.01). Analysis of 12 secondary metabolites revealed that wild GF exhibited significantly higher levels of Shanzhiside, deacetyl asperulosidic acid methyl ester, gardenoside and chlorogenic acid compared to cultivated GF(P<0.01). Conversely, the contents of genipin 1-gentiobioside, geniposide and genipin were significantly lower in wild GF(P<0.01). ConclusionThere are significant differences between wild and cultivated GF in terms of traits, microstructure, and contents of primary and secondary metabolites. At present, the quality evaluation system of cultivated GF remains incomplete, and this study provides a reference for guiding the production of high-quality GF medicinal materials.
5.Mechanism prediction and verification of Xihuang pill against diffuse large B-cell lymphoma
Ruyi HUANG ; Jinyu LI ; Wenqi LIN ; Xin JIANG ; Yanling CHEN ; Weikun HUANG ; Lin YANG
China Pharmacy 2026;37(2):161-167
OBJECTIVE To investigate the mechanism of Xihuang pill (XHP) against diffuse large B-cell lymphoma (DLBCL). METHODS The active ingredients of XHP and potential therapeutic targets for DLBCL were identified using TCMSP, GeneCards and DisGeNET databases. Protein-protein interaction networks were constructed using the String database and Cytoscape software to screen core components and core targets. Gene ontology and Kyoto Encyclopedia of Genes and Genomes pathway enrichment analyses were then performed. The clinical relevance of core targets was analyzed using the GEPIA and PanCanSurvPlot databases. Molecular docking and molecular dynamics (MD) simulation were conducted to verify the interactions between core components and core targets, and the binding free energy was calculated using the molecular mechanics Poisson-Boltzmann surface area (MM-PBSA) method. The effects of XHP on DLBCL and the related molecular mechanisms were validated using CCK-8 assay, flow cytometry and Western blot. RESULTS Network pharmacology analysis identified 108 active ingredients of XHP and 410 potential therapeutic targets for DLBCL. Six core components (e.g., 17 beta-estradiol, quercetin) and ten core targets [e.g., tumor protein 53 (TP53), proto-oncogene tyrosine-protein kinase Src (SRC)] were obtained. Enrichment analysis indicated that the anti-DLBCL effects of XHP were primarily associated with the apoptotic signaling pathway, the phosphoinositide 3-kinase (PI3K)/protein kinase B (Akt) signaling pathway and so on. Clinical correlation analysis revealed that TP53 and SRC expression were significantly up-regulated in DLBCL tissues and associated with poor patient prognosis (P<0.05). Molecular docking, MD simulations and MM-PBSA calculations confirmed that the SRC-quercetin complex had a mail:stronger and more stable binding affinity. In vitro experiments demonstrated that XHP concentration-dependently inhibited the proliferation of DLBCL cells; compared with control group, XHP medium- and high-dose groups could significantly induce the apoptosis of SU-DHL2 and SU-DHL4 cells, and significantly down- regulated the expressions of SRC protein, phosphorylated (p)-PI3K/PI3K and p-Akt/Akt in SU-DHL4 cells (P<0.05). CONCLUSIONS XHP may inhibit the proliferation and induce the apoptosis of DLBCL cells by regulating the SRC/PI3K/Akt signaling pathway.
6.Association between takeout fast foods and sugar sweetened beverage consumption with co-occurrence of anxiety and depressive symptoms among first year junior high school students in Yunnan Province
HU Dongyue, ZHANG Zhengwu, XU Zenglei, TAO Lei, ZENG Anna, GUAN Liao, CHANG Litao,〖JZ〗 HUANG Xin, CHEN Weiwei, LI Jiangli, XU Honglü ;
Chinese Journal of School Health 2026;47(1):23-26
Objective:
To explore the association between takeout fast foods and sugar sweetened beverage consumption with co-occurrence of anxiety and depressive symptoms among first year junior high school students in Yunnan Province, so as to provide theoretical basis for the prevention of anxiety and depressive symptoms co-occurrence among adolescents.
Methods:
A random cluster sampling involving 8 500 first year junior high school students in 11 counties in Yunnan Province was conducted by a questionnaire survey from October to December 2022. The Depression Anxiety Stress Scale-21 (DASS-21) was applied to assess anxiety and depressive symptoms in first year junior high school students. Chi-square test was used to compare the anxiety-depression co-occurrence symptoms of first year junior high school students with different demographic characteristics. The association between takeout fast foods and sugar sweetened beverage consumption with co-occurrence of anxiety and depressive symptoms of adolescents was analyzed by binary Logistic regression models.
Results:
The detection rate of co-occurrence of anxiety and depression symptoms among first year junior high school students in Yunnan Province was 26.92%. After controlling for demographic variables and other confounders, takeout fast foods and sugar sweetened beverage consumption( OR=1.50, 95%CI =1.27-1.77) was associated with anxiety-depression co-occurrence symptoms among first year junior high school students in Yunnan Province ( P <0.01). Stratified analysis showed that both Han ( OR=1.37, 95%CI =1.07-1.77) and ethnic minorities ( OR=1.60, 95%CI =1.29-2.00) exhibited statistically significant associations between takeout fast foods and sugar sweetened beverage consumption with co-occurrence of anxiety and depressive symptoms(both P <0.05).
Conclusions
Takeout fast foods and sugar sweetened beverage consumption increases the risk of co-occurrence of anxiety and depressive symptoms among first year junior high school students in Yunnan Province. It is recommended to strengthen guidance on the consumption of such products among junior high school students to prevent co-occurrence of anxiety and depressive symptoms.
7.Interpretation of Pharmacovigilance Guidelines for Clinical Application of Oral Chinese Patent Medicines
Wenxi PENG ; Meng QIAO ; Lianxin WANG ; Yuanyuan LI ; Xiuhui LI ; Xin CUI ; Zijia CHEN ; Xinyi CHEN ; Yi DENG ; Yanming XIE ; Zhifei WANG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(6):152-160
The Pharmacovigilance Guidelines for Clinical Application of Oral Chinese Patent Medicines (hereinafter referred to as the Guidelines) is first specialized in the field of drug safety for oral Chinese patent medicines (OCPMs) in China. Rooted in China's healthcare context, the Guidelines address the unique usage patterns and risk characteristics of OCPMs, filling a regulatory gap in the pharmacovigilance framework specific to this category. To facilitate accurate understanding and effective implementation of the Guidelines, and to promote the standardized development of pharmacovigilance practices for OCPMs, this study offered a systematic interpretation based on its three core components. In the domain of risk monitoring and reporting, the paper analyzed the rationale for multi-source information integration and clarified the criteria for identifying key products and target populations for intensive monitoring. Regarding risk assessment, the Guidelines were examined from three dimensions of formulation components, medication behaviors, and population to address complex safety issues arising from medicinal constituents, irrational use, and individual susceptibility. In the area of risk control, the analysis focused on context-based interventions and dynamic closed-loop management strategies, exploring practical pathways to shift from passive response to proactive risk mitigation. Furthermore, this paper evaluated the applied value of the Guidelines and identified implementation challenges, such as insufficient capacity at the primary-care level and limited digital infrastructure. In response, the study proposed optimization strategies including establishing a dynamic updating mechanism, strengthening training at the grassroots level, and incorporating artificial intelligence to enhance pharmacovigilance capacity. This interpretation aims to provide actionable insights for marketing authorization holders (including manufacturers), pharmaceutical distributors, healthcare institutions, and research organizations, ultimately supporting the establishment and refinement of a full lifecycle pharmacovigilance system for OCPMs.
8.Construction of Perimenopausal Depression Animal Models and Mechanism of Action of Traditional Chinese Medicine: A Review
Xiaoting LI ; Shouzhu XU ; Jun KE ; Zhan ZHANG ; Bao XIN
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(4):258-267
Perimenopausal depression (PMD) is an affective disorder that occurs in women during the transition from sexual maturity to old age. It can induce various complications, such as insomnia and cognitive decline. The etiology of PMD is complex. Although multiple hypotheses have been proposed, there is still no unified theory that fully explains its pathogenesis. Research into its mechanisms relies heavily on animal experiments, and establishing reliable animal models is crucial for experimental studies. Appropriate animal models can better simulate human pathophysiological states, rapidly evaluate the efficacy and safety of drugs and intervention methods, grasp the essence of the disease, and uncover its intrinsic connections, thereby exploring more advanced intervention strategies. However, there is a lack of systematic review and summarization of literature related to model construction. Additionally, traditional Chinese medicine (TCM), adhering to the principles of ''syndrome differentiation and treatment'' and ''holistic concept'', has shown significant efficacy in treating PMD. In recent years, research exploring and analyzing its therapeutic mechanisms has been increasing. Therefore, to gain a clearer and more comprehensive understanding of PMD animal modeling methods and the mechanisms of TCM, this paper reviewed Chinese and English literature on PMD animal models and mechanisms of TCM in PMD treatment. It summarized the construction methods of single-factor and multi-factor PMD models, and discussed the advantages and disadvantages of each modeling approach. Furthermore, it delved into the mechanisms of TCM intervention in PMD, revealing that TCM formulas primarily exert their effects by regulating the hypothalamic-pituitary-adrenal axis, hypothalamic-pituitary-ovarian axis, gut-brain axis, cell signaling pathways, neural circuits, hormone levels, and neurotransmitter levels. This review aims to provide a reference for future research in this field. In summary, by summarizing the progress in the methods for PMD animal model construction and the mechanisms of TCM, the paper seeks to offer new insights into the mechanistic research of TCM intervention in PMD.
9.Expert Consensus on Neurocritical Care Monitoring and Management in Beijing and Tibet(2025)
Drolma PHURBU ; Wenjin CHEN ; Heng ZHANG ; Jian ZHANG ; Xiaomeng WANG ; Guoying LIN ; Wenjun PAN ; Xiying GUI ; Xin CAI ; Chodron TENZIN ; Jianlei FU ; Qianwei LI ; TSEYANG ; Yijun LIU ; Bo LIU ; Tsering DROLMA ; Yudron SONAM ; KYILV ; Samdrup TSERING ; Wa DA ; Juan GUO ; Cheng QIU ; Huan CHEN ; Xiaoting WANG ; Yangong CHAO ; Dawei LIU ; Wenzhao CHAI ; Chenggong HU ; Wanhong YIN ; Shihong ZHU
Medical Journal of Peking Union Medical College Hospital 2026;17(1):59-72
Neurocritical care involves complex pathophysiological mechanisms, and its incidence is higher, injuries are more severe, and treatment is more challenging in high-altitude environments. This consensus, based on the latest domestic and international evidence-based medical data, establishes a standardized, goal-oriented framework for neurocritical care management applicable in high-altitude regions and nationwide. The consensus was developed following international standards for evidence quality assessment and underwent two rounds of Delphi expert consultation, resulting in 32 recommendation statements covering three parts: management systems, monitoring and assessment, and core strategies. Key updates include: advocating for the establishment of independent neurocritical care units and implementing precise tiered diagnosis and treatment based on the "Five Differences in Critical Care" concept; constructing a "trinity" multimodal brain monitoring system centered on cerebral blood flow, cerebral oxygenation, and brain function, emphasizing routine bedside transcranial Doppler ultrasound, cerebral oximetry, and continuous electroencephalography monitoring; shifting management strategies from mild hypothermia therapy to targeted temperature management, and defining the "446" target management pathway for the supercritical stage; emphasizing the assessment of static and dynamic cerebrovascular autoregulation functions through multimodal methods to achieve individualized optimal mean arterial pressure management; elevating cerebrospinal fluid management goals to the level of "glymphatic system" function maintenance; implementing a multidisciplinary collaborative, whole-process management model focusing on patients' long-term neurological functional outcomes; de-escalation criteria include multidimensional indicators such as recovery of brain structure, restoration of cerebrovascular autoregulation, improvement in cerebrospinal fluid dynamics, and reduction in biomarker levels; and integrating cutting-edge technologies like artificial intelligence into post-critical care management and rehabilitation planning. This consensus systematically integrates the entire process of neurocritical care management, reflecting the modern connotation of goal-oriented, dynamic, and multimodal integration in neurocritical care medicine. It aims to adapt to new trends such as deepening understanding of pathophysiological mechanisms, the integration of medicine and engineering, and the empowerment of artificial intelligence, thereby further advancing the discipline of critical care medicine.
10.Standards for the Application of Hemodynamic Monitoring Technology in Critical Care
Hua ZHAO ; Hongmin ZHANG ; Xin DING ; Huan CHEN ; Jun DUAN ; Wei DU ; Bo TANG ; Yuankai ZHOU ; Dongkai LI ; Xinchen WANG ; Cui WANG ; Gaosheng ZHOU ; Xiaoting WANG
Medical Journal of Peking Union Medical College Hospital 2026;17(1):73-85
With the rapid advancement of hemodynamic indices and monitoring technologies, their classification methods and application processes have become increasingly complex. Currently, no unified standard hasbeen established, making it difficult to fully meet the clinical requirements for hemodynamic management. To assist in hemodynamic monitoring assessment and therapeutic decision-making in critically ill patients, the Critical Hemodynamic Therapy Collaborative Group, in conjunction with the Critical Ultrasound Study Group, has jointly developed the Standard for the Application of Hemodynamic Monitoring Techniques in Critical Care. The first part of this standard systematically categorizes hemodynamic indicators into flow indicators, pressure and its derivative indicators, and tissue perfusion indicators, while elaborating on the clinical application of each. The second part establishes a standardized clinical implementation pathway for hemodynamic monitoring. It proposes a tiered monitoring strategy-comprising basic, advanced, indication-specific, and special scenario monitoring-tailored to different clinical settings. It emphasizes the central role of critical care ultrasound across all levels of monitoring and establishes hemodynamic assessment standards for organs such as the brain, kidneys, and gastrointestinal tract. This standard aims to provide a unified framework for clinical practice, teaching, training, and research in critical care medicine, thereby promoting standardized development within the discipline.


Result Analysis
Print
Save
E-mail