Objective:To construct an estimating equation to accurately reflect the aging phenomenon of the glomerular filtration rate(GFR).Methods:Healthy subjects receiving physical examinations at the First Affiliated Hospital of Nanjing Medical University between January 2017 and April 2018 were included in the study, and the aging phenomenon of renal function indicators such as serum creatinine(Scr)was used as the reference standard to evaluate the accuracy of four Scr-based GFR equations during GFR aging, including the full age spectrum(FAS)equation, the Chronic Kidney Disease Epidemiology Collaboration(CKD-EPI)equation, the Osaka equation and the Xiangya equation.Results:Of 37 636 individuals receiving physical examinations, 6 534 met the criteria specified in this study.Scr, serum urea nitrogen, serum uric acid, and serum albumin showed a significant aging phenomenon( H=191.640, 196.693, 83.271, 414.585, P<0.001 for all).The GFR estimated by the four equations all decreased with aging, but the starting point and rate of decline were significantly different.The GFR aging phenomenon estimated by the FAS equation was closer to the trend of renal function indicators. Conclusions:The FAS equation may be more applicable to healthy people to understand the aging phenomenon of GFR.

The incidence of osteoporotic thoracolumbar vertebral fracture (OTLVF) in the elderly is gradually increasing. The kyphotic deformity caused by various factors has become an important characteristic of OTLVF and has received increasing attention. Its clinical manifestations include pain, delayed nerve damage, sagittal imbalance, etc. Currently, the definition and diagnosis of OTLVF with kyphotic deformity in the elderly are still unclear. Although there are many treatment options, they are controversial. Existing guidelines or consensuses pay little attention to this type of fracture with kyphotic deformity. To this end, the Lumbar Education Working Group of the Spine Branch of the Chinese Medicine Education Association and Editorial Committee of Chinese Journal of Trauma organized the experts in the relevant fields to jointly develop Clinical guidelines for the diagnosis and treatment of osteoporotic thoracolumbar vertebral fractures with kyphotic deformity in the elderly ( version 2024), based on evidence-based medical advancements and the principles of scientificity, practicality, and advanced nature, which provided 18 recommendations to standardize the clinical diagnosis and treatment.

177Lu-prostate specific membrane antigen(PSMA)radio-ligand therapy has been approved abroad for advanced prostate cancer and has been in several clinical trials in China.Based on domestic clinical practice and experimental data and referred to international experience and viewpoints,the expert group forms a consensus on the clinical application of 177Lu-PSMA radio-ligand therapy in prostate cancer to guide clinical practice.

68Ga-DOTATATE/18F-FDG two-day low-dose total-body PET/CT imaging is increasingly employed to facilitate the diagnosis,prognosis,and heterogeneity assessment of neuroendocrine neoplasms.We present a consensus on operational guideline for a two-day combined imaging from experts in low-dose/ultra-low-dose total-body PET/CT from several domestic medical institutions.

Objective To discuss the effectiveness and safety of transarterial chemoembolization(TACE)combined with regorafenib and programmed death receptor-1(PD-1)in the second-line sequential treatment of advanced hepatocellular carcinoma(HCC).Methods The clinical data of a total of 83 patients with advanced HCC,who received TACE combined with regorafenib and PD-1(triple-therapy group)or TACE combined with regorafenib(dual-therapy group)at the Affiliated Hospital of Nantong University and Nantong Municipal Third People's Hospital of China between October 2020 and May 2022,were retrospectively analyzed.The clinical data were collected and evaluated.Modified response evaluation criteria in solid tumors(mRECIST)was used to evaluate the curative effect.The progression-free survival(PFS),overall survival(OS)and treatment-related adverse events(TRAEs)were compared between the two groups.The Kaplan-Meier method was used to draw PFS and OS curves,the Log-rank test was used to compare the relevant data between the two groups,and the COX regression model was drawn to determine the factors influencing PFS and OS.Results There were no statistically significant differences in the baseline data between the two groups(P≥0.05).In the triple-therapy group and the dual-therapy group,the objective response rate(ORR)was 31.1％and 18.4％respectively(P=0.024),and the disease control rate(DCR)was 77.8％and 57.8％respectively(P=0.038).The OS and PFS in the triple-therapy group were higher than those in the dual-therapy group(16.80 months vs 13.20 months,and 9.10 months vs.7.40 months,respectively).No statistically significant difference in the incidence of adverse drug reactions existed between the two groups(P 0.05).Conclusion In the second-line sequential treatment of advanced HCC,TACE combined with regorafenib and PD-1 is more effective than TACE combined with regorafenib,therefore,it can be used as a preferred second-line treatment for advanced HCC.

Objective:To investigate the effects of matrine on proliferation, apoptosis and radiotherapy sensitivity of uveal melanoma cells.Methods:An animal experiment study. In vitro experiment: MuM2B cells of human choroidal melanoma were randomly divided into control group and matrine 0.25, 0.50, 1.00, 2.00 g/L groups. The cell morphology was observed by transmission electron microscope. Cell proliferation was detected by thiazole blue colorimetry. The mRNA and relative expression levels of CyclinD D (CyclinD), B lymphoblastoma-2 (Bcl-2) and Bcl2-associated X protein (Bax) were detected by real-time polymerase chain reaction and Western blot. In vivo experiment: BALB/C mice were injected with MuM2B cell suspension subcutaneously on the back of forelimb to prepare transplanted tumor model. After successful modeling, they were randomly divided into blank group and matrine treatment group with different concentrations. Mice in blank group were injected with phosphate buffer subcutaneously. Mice in different matrine treatment groups were injected with 15, 25, 50, 100 mg/kg matrine subcutaneously, respectively, for 7 consecutive days. The tumor was weighed and its volume was measured after the last administration. Single factor analysis of variance was used to compare different groups. The t test was used for pairwise comparison between groups. Results:In the control group, the cell structure was normal, the distribution was uniform, and no or rare nuclear pyknosis was seen. With the increase of matrine dosage, the nuclear pyretosis increased gradually and cell morphology changed obviously. Compared with the control group, the cell survival rate in 0.50, 1.00 and 2.00 g/L groups gradually decreased with matrine concentration increasing and treatment time prolongating, the relative expression levels of CyclinD and Bcl-2 mRNA and protein gradually decreased, and the relative expression levels of Bax mRNA and protein gradually increased. Under the same radiation dose X-ray irradiation, the cell survival rate of 0.50, 1.00 and 2.00 g/L groups gradually decreased, and the differences were statistically significant ( P<0.05). Compared with blank group, the tumor weight and volume of mice in different doses of matrine group were significantly decreased, and the differences were statistically significant ( P<0.05). Conclusion:Matrine can down-regulate the expression of CyclinD and Bcl-2, up-regulate the expression of Bax, promote the apoptosis of MuM2B human melanoma cells, inhibit cell proliferation, and enhance cell radiosensitivity.

【Objective】 To establish a comprehensive performance appraisal system, in order to promote blood collection, preparation and supply. 【Methods】 The performance reform leading group headed by the central leader was set up to manage the overall work, with performance reform office set up to formulate the central performance reform plan and the target assessment plan. The operation effectiveness was evaluated by comparing the index changes in blood collection, preparation and supply. 【Results】 Compared with before the implementation of performance (from 2018 to 2019, a total of 24 months), except for the total monthly collection of street whole blood, the per person of street monthly blood collection and the total and per person monthly collection of apheresis platelets were significantly increased (P<0.05) during the process of blood collection. The total and per person monthly preparation of cryoprecipitates and virus inactivates plasma were significantly increased (P<0.05) during the process of blood preparation. The total and per person monthly supply of apheresis platelets, cryoprecipitates and virus inactivates plasma were significantly increased (P<0.05) during the process of blood supply. 【Conclusion】 The adjustment and implementation of performance reform program optimized the performance salary distribution system, and the formulation and implementation of target assessment program significantly promoted blood collection, preparation and supply.

Objective:To investigate the effects of antibiotic treatment and antibiotics combined with surgery treatment on the prognosis of patients with infective endocarditis (IE).Methods:The clinical data and prognosis of all patients diagnosed as IE discharged from Shanghai Jiao Tong University Affiliated Sixth People′s Hospital from June 2011 to May 2021 were collected. There were 240 IE patients, divided into antibiotic treatment group and the antibiotics combined with surgery group according to the treatment methods. The clinical characteristics and prognosis of the IE patients were compared between the two groups, so as to investigate the timing of surgery for IE patients and to analyze the effects of the two treatment methods on the prognosis of IE patients.Statistical analysis methods including Wilcoxon rank sum test, chi-square test, Kaplan-Meier survival analysis and Cox regression analysis were used when appropriate.Results:Of the 240 patients with IE, 63 cases were only treated with antibiotics and 177 cases were treated with antibiotics combined with surgery. After propensity score matching (PSM), one-year mortality rate of the IE patients in the antibiotics combined with surgery group was 11.1%(4/36), which was significantly lower than that in the antibiotic treatment group (33.3%(12/36), χ2=5.14, P=0.023). The median values of left ventricular ejection fraction (LVEF), left ventricular end diastolic diameter (LVEDD) and left ventricular fractional shortening (LVFS) in the antibiotics combined with surgery group were 59%, 47 mm and 31%, respectively, which were significantly lower than those before surgery (63%, 54 mm and 34%, respectively, Z=6.19, 9.36 and 6.11, respectively, all P<0.001). The most common surgical indication was moderate to severe heart failure, and there was no significant difference between the early operation group and the late operation group (both P>0.050). The one-year cumulative survival rate of antibiotics combined with surgery group was 94.9%, which was significantly higher than that in the antibiotic treatment group (83.2%, χ2=7.38, P=0.007). Heart failure and Pitt bacteremia scores≥4 were the independent risk factors for one-year all-cause death of the IE patients (hazard ratio ( HR)=5.668 and 19.392, respectively, both P<0.050). Hospital days and antibiotics combined with surgery were independent related factors for reducing the risks of one-year all-cause death ( HR=0.931 and 0.299, respectively, both P<0.050). Pitt bacteremia scores≥4 had the greatest impact on one-year prognosis of the IE patients. Conclusions:Surgery could significantly improve cardiac function and one-year prognosis of the IE patients. IE patients with heart failure and Pitt bacteremia score≥4 should be actively treated.

Objective:To compare efficacy and safety of 308-nm SQ light-emitting diode (LED) light versus 308-nm excimer light in the treatment of facial vitiligo.Methods:Patients with stable facial vitiligo were retrospectively collected from Department of Physical Therapy, Hospital of Dermatology, Chinese Academy of Medical Sciences from June 2018 to June 2020, who received treatment with 308-nm SQ LED light (LED group) or 308-nm excimer light (excimer light group). The treatment was performed once or twice a week, and patients who had received more than 8 sessions of treatment were included in the analysis of efficacy and safety. Statistical analysis was carried out by using chi-square test.Results:Totally, 68 patients with 90 lesions were enrolled into the LED group, including 36 males and 32 females, aged 25.01 ± 13.37 years; 20 patients with 28 lesions were enrolled into the excimer light group, including 13 males and 7 females, aged 27.15 ± 14.30 years. After 8 and 16 sessions of treatment, there was no significant difference in the response rate between the LED group (23.33%, 46.67%, respectively) and excimer light group (14.29%, 46.43%, χ2 = 1.05, < 0.001, respectively, both P > 0.05). During the treatment, 36 (52.94%) patients in the LED group developed persistent erythema, 17 (85%) in the excimer light group developed persistent erythema or blisters. The incidence of adverse reactions was significantly lower in the LED group than in the excimer light group ( χ2 = 16.43, P < 0.001) . Conclusion:Compared with the 308-nm excimer light, the 308-nm SQ LED light showed similar effect but higher safety for the treatment of facial vitiligo.

We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.