ObjectiveTo investigate the correlation between neutrophil-to-lymphocyte ratio （NLR）， platelet-to-lymphocyte ratio （PLR）， systemic immune-inflammation index （SII） and the severity of intrauterine adhesions （IUA）. MethodsThe retrospective study included 380 patients who underwent transcervical resection of adhesions （TCRA） from December 2019 to March 2025. Based on the American Fertility Society （AFS） classification， patients were divided into mild （n=61）， moderate （n=225）， and severe （n=94） groups. NLR， PLR， and SII were calculated from preoperative blood tests. Statistical analyses included Kruskal-Wallis test and ordinal Logistic regression. ResultsNLR， PLR， and SII were significantly higher in the severe IUA group compared to the mild group （P<0.05）， with SII showing the strongest predictive ability （OR=1.004， P=0.001）. The number of intrauterine procedures was an independent risk factor （OR=1.27/level， P=0.016）. The predictive model ［Logit（P）=-0.676+0.241×operation times+0.004×SII］ effectively identified severe IUA cases. ConclusionInflammatory markers （particularly SII） are correlated with IUA severity and may serve as non-invasive tools for clinical assessment.

Childhood simple obesity has become a significant public health issue in China. Modern medicine primarily relies on lifestyle interventions and often suffers from poor long-term compliance， while pharmacological options are limited and associated with potential adverse effects. Traditional Chinese Medicine （TCM） has a long history in the prevention and management of this condition， demonstrating eight distinct advantages， including systematic theoretical foundation， diversified therapeutic approaches， definite therapeutic efficacy， high safety profile， good patient compliance， comprehensive intervention strategies， emphasis on prevention， and stepwise treatment protocols. Additionally， TCM is characterized by six distinctive features： the use of natural medicinal substances， non-invasive external therapies， integration of medicinal dietetics， simple exercise regimens， precise syndrome differentiation， and diverse dosage forms. By combining internal and external treatments， TCM facilitates individualized regimen adjustment and holistic regulation， demonstrating remarkable effects in improving obesity-related metabolic indicators， regulating constitutional imbalance， and promoting healthy behaviors. However， challenges remain， such as inconsistent operational standards， insufficient high-quality clinical evidence， and a gap between basic research and clinical application. Future efforts should focus on accelerating the standardization of TCM diagnosis and treatment， conducting multicenter randomized controlled trials， and fostering interdisciplinary integration， so as to enhance the scientific validity and international recognition of TCM in the prevention and treatment of childhood obesity.

This study aims to systematically characterize the targeted effects of Quanduzhong Capsules on cartilage lesions in knee osteoarthritis by integrating spatial transcriptomics data mining and animal experiments validation, thereby elucidating the related molecular mechanisms. A knee osteoarthritis model was established using Sprague-Dawley(SD) rats, via a modified Hulth method. Hematoxylin and eosin(HE) staining was employed to detect knee osteoarthritis-associated pathological changes in knee cartilage. Candidate targets of Quanduzhong Capsules were collected from the HIT 2.0 database, followed by bioinformatics analysis of spatial transcriptomics datasets(GSE254844) from cartilage tissues in clinical knee osteoarthritis patients to identify spatially specific disease genes. Furthermore, a "formula candidate targets-spatially specific genes in cartilage lesions" interaction network was constructed to explore the effects and major mechanisms of Quanduzhong Capsules in distinct cartilage regions. Experimental validation was conducted through immunohistochemistry using animal-derived biospecimens. The results indicated that Quanduzhong Capsules effectively inhibited the degenerative changes in the cartilage of affected joints in rats, which was associated with the regulation of Quanduzhong Capsules on the thioredoxin-interacting protein(TXNIP)-NOD-like receptor family pyrin domain containing 3(NLRP3)-bone morphogenetic protein receptor type 2(BMPR2)-fibronectin 1(FN1)-matrix metallopeptidase 2(MMP2) signal axis in the articular cartilage surface and superficial zones, subsequently inhibiting cartilage matrix degradation leading to oxidative stress and inflammatory diffusion. In summary, this study clarifies the spatially specific targeted effects and protective mechanisms of Quanduzhong Capsules within pathological cartilage regions in knee osteoarthritis, providing theoretical and experimental support for the clinical application of this drug in the targeted therapy on the inflamed cartilage.
Animals ; Osteoarthritis, Knee/metabolism* ; Drugs, Chinese Herbal/administration & dosage* ; Rats, Sprague-Dawley ; Rats ; Male ; Humans ; Capsules ; Female ; Disease Models, Animal

Traditional Chinese medicine(TCM) capable of clearing heat and removing toxin is most commonly used in clinical practice and has the effect of removing fire-heat and toxin. Studies have shown that most of the Ilex plants have the effect of clearing heat and removing toxin, among which the varieties of I. cornuta, I. pubescens, I. rotunda, I. latifolia, and I. chinensis are most widely used. These plants generally contain triterpenoids and their glycosides, alkaloids, flavonoids, phenylpropanoids, and other chemical components, especially pentacyclic triterpenoids. According to their skeletons, pentacyclic triterpenoids can be divided into the oleanane type, the ursane type, the lupinane type, etc. Among them, ursane-type components are the most abundant, and 136 species have been found so far. These components have been proved to have pharmacological effects such as anti-inflammatory, anti-tumor, hypolipidemic, anti-thrombosis, cardiomyocyte-protective, antibacterial, and hepatoprotective effects. Therefore, this paper systematically reviews the domestic and foreign literature on Ilex plants with a focus on the research progress on pentacyclic triterpenoids and their pharmacological activities, aiming to provide reference for the development of TCM resources with the effect of clearing heat and removing toxin.
Ilex/chemistry* ; Plants, Medicinal/chemistry* ; Pentacyclic Triterpenes/pharmacology* ; Medicine, Chinese Traditional ; Drugs, Chinese Herbal/pharmacology* ; Humans ; Animals

A single-center, randomized, double-blind, dose-controlled trial of modified Sini Powder in treating mild to moderate generalized anxiety disorder(GAD) in the patients with syndrome of liver depression transforming into fire was conducted at Xiyuan Hospital, China Academy of Chinese Medical Sciences. A total of 80 patients with mild to moderate GAD and the syndrome of liver depression transforming into fire were included. Patients were assigned by the central randomization system at a ratio of 3∶1 into an observation group(n=60, receiving a conventional-dose of granules of modified Sini Powder) and a control group(n=20, receiving low-dose granules with the active ingredients being 50% of that in observation group). Assessments were conducted before treatment(baseline), after 2 weeks of introduction, after 2/4/8 weeks of treatment, and after 4 weeks of follow-up. The results were summarized as follows. In terms of primary outcome indicators, the observation group(62.2%) showed higher total response rate than the control group(26.6%)(P<0.05), and greater Hamilton anxiety scale(HAMA) score reduction after 8 weeks of treatment(P<0.05). In terms of secondary outcome indicators, the HAMA score(somatic anxiety score), traditional Chinese medicine(TCM) syndrome scores, Pittsburgh sleep quality index(PSQI) scale, and clinical global impression(CGI) scale score in the observation group showed a significant compared to the control group at each visit points(P<0.05). Adverse events occurred in 10 cases, including 9(16.9%) cases in the observation group and 1(6.6%) case in the control group. No adverse reaction was observed. In conclusion, conventional-dose modified Sini Powder demonstrated superior efficacy and favorable safety for mild and moderate GAD in the patients with the syndrome of liver depression transforming into fire over low-dose treatment.
Humans ; Male ; Female ; Adult ; Middle Aged ; Double-Blind Method ; Drugs, Chinese Herbal/administration & dosage* ; Anxiety Disorders/drug therapy* ; Treatment Outcome ; Young Adult ; Powders ; Aged ; Liver/drug effects* ; Generalized Anxiety Disorder

To investigate the impact of preoperative serum follicle-stimulating hormone (FSH) levels on the probability of testicular sperm retrieval, we conducted a study of nonobstructive azoospermic (NOA) men with different testicular volumes (TVs) who underwent microdissection testicular sperm extraction (micro-TESE). A total of 177 NOA patients undergoing micro-TESE for the first time from April 2019 to November 2022 in Shenzhen Zhongshan Obstetrics and Gynecology Hospital (formerly Shenzhen Zhongshan Urology Hospital, Shenzhen, China) were retrospectively reviewed. The subjects were divided into four groups based on average TV quartiles. Serum hormone levels in each TV group were compared between positive and negative sperm retrieval subgroups. Overall sperm retrieval rate was 57.6%. FSH levels (median [interquartile range]) were higher in the positive sperm retrieval subgroup compared with the negative outcome subgroup when average TV was <5 ml (first quartile [Q1: TV <3 ml]: 43.32 [17.92] IU l -1 vs 32.95 [18.56] IU l -1 , P = 0.048; second quartile [Q2: 3 ml ≤ TV <5 ml]: 31.31 [15.37] IU l -1 vs 25.59 [18.40] IU l -1 , P = 0.042). Elevated serum FSH levels were associated with successful micro-TESE sperm retrieval in NOA men whose average TVs were <5 ml (adjusted odds ratio [OR]: 1.06 per unit increase; 95% confidence interval [CI]: 1.01-1.11; P = 0.011). In men with TVs ≥5 ml, larger TVs were associated with lower odds of sperm retrieval (adjusted OR: 0.84 per 1 ml increase; 95% CI: 0.71-0.98; P = 0.029). In conclusion, elevated serum FSH levels were associated with positive sperm retrieval in micro-TESE in NOA men with TVs <5 ml. In men with TV ≥5 ml, increases in average TVs were associated with lower odds of sperm retrieval.
Humans ; Male ; Azoospermia/surgery* ; Sperm Retrieval/statistics & numerical data* ; Adult ; Follicle Stimulating Hormone/blood* ; Retrospective Studies ; Testis/pathology* ; Microdissection ; Organ Size

This study investigated the impact of metabolic syndrome (MetS) and its components on prostate volume (PV) in the general Chinese population. In total, 43 455 participants in The First Medical Center of the Chinese PLA General Hospital (Beijing, China) from January 1, 2012, to December 31, 2022, undergoing health examinations were included in the study. Participants were categorized into four groups according to PV quartiles: Q1 (PV ≤24.94 ml), Q2 (PV >24.94 ml and ≤28.78 ml), Q3 (PV >28.78 ml and ≤34.07 ml), and Q4 (PV >34.07 ml), with Q1 serving as the reference group. Logistic regression analyses were used to examine the association between MetS and PV, with subgroup analyses conducted by age. Among the participants, 18 787 (43.2%) were diagnosed with MetS. In the multivariate analysis model, a significant correlation between MetS and PV was observed, with odds ratios (ORs) increasing as PV increased (Q2, OR = 1.203, 95% confidence interval [CI]: 1.139-1.271; Q3, OR = 1.300, 95% CI: 1.230-1.373; and Q4, OR = 1.556, 95% CI: 1.469-1.648). Analysis of MetS components revealed that all components were positively associated with PV, with abdominal obesity showing the most significant effect. The number of MetS components was identified as a dose-dependent risk factor for elevated PV. The impact of MetS, its components, and component count on PV exhibited a decreasing trend with advancing age. Overall, the influence of MetS, its components, and component count on PV was predominantly observed in the age groups of 40-49 years and 50-59 years. Early intervention targeting MetS can significantly alleviate the increase in PV, particularly benefiting individuals aged 40-59 years who have abdominal obesity.
Humans ; Male ; Metabolic Syndrome/complications* ; Middle Aged ; Cross-Sectional Studies ; Aged ; Prostate/diagnostic imaging* ; Adult ; Age Factors ; Organ Size ; China/epidemiology* ; Obesity, Abdominal ; Risk Factors

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To construct a Z-score regression model for coronary artery diameter based on echocardiographic data from children in Sichuan Province and to establish a Z-score calculation formula. METHODS: A total of 744 healthy children who underwent physical examinations at Sichuan Provincial People's Hospital from January 2020 to December 2022 were selected as the modeling group, while 251 children diagnosed with Kawasaki disease at the same hospital from January 2018 to December 2022 were selected as the validation group. Pearson correlation analysis was conducted to analyze the relationships between coronary artery diameter values and age, height, weight, and body surface area. A regression model was constructed using function transformation to identify the optimal regression model and establish the Z-score calculation formula, which was then validated. RESULTS: The Pearson correlation analysis showed that the correlation coefficients for the diameters of the left main coronary artery, left anterior descending artery, left circumflex artery, and right coronary artery with body surface area were 0.815, 0.793, 0.704, and 0.802, respectively (P<0.05). Among the constructed regression models, the power function regression model demonstrated the best performance and was therefore chosen as the optimal model for establishing the Z-score calculation formula. Based on this Z-score calculation formula, the detection rate of coronary artery lesions was found to be 21.5% (54/251), which was higher than the detection rate based on absolute values of coronary artery diameter. Notably, in the left anterior descending and left circumflex arteries, the detection rate of coronary artery lesions using this Z-score calculation formula was higher than that of previous classic Z-score calculation formulas. CONCLUSIONS The Z-score calculation formula established based on the power function regression model has a higher detection rate for coronary artery lesions, providing a strong reference for clinicians, particularly in assessing coronary artery lesions in children with Kawasaki disease.
Humans ; Male ; Female ; Child, Preschool ; Child ; Coronary Artery Disease/diagnostic imaging* ; Infant ; Mucocutaneous Lymph Node Syndrome ; Regression Analysis ; Coronary Vessels/diagnostic imaging* ; Echocardiography ; Adolescent

OBJECTIVES: To evaluate the safety and efficacy of thiotepa (TT)-containing conditioning regimens for allogeneic hematopoietic stem cell transplantation (HSCT) in children with inborn errors of immunity (IEI). METHODS: Clinical data of 22 children with IEI who underwent HSCT were retrospectively reviewed. Survival after HSCT was estimated using the Kaplan-Meier method. RESULTS: Nine patients received a traditional conditioning regimen (fludarabine + busulfan + cyclophosphamide/etoposide) and underwent peripheral blood stem cell transplantation (PBSCT). Thirteen patients received a TT-containing modified conditioning regimen (TT + fludarabine + busulfan + cyclophosphamide), including seven PBSCT and six umbilical cord blood transplantation (UCBT) cases. Successful engraftment with complete donor chimerism was achieved in all patients. Acute graft-versus-host disease occurred in 12 patients (one with grade III and the remaining with grade I-II). Chronic graft-versus-host disease occurred in one patient. The incidence of EB viremia in UCBT patients was lower than that in PBSCT patients (P<0.05). Over a median follow-up of 36.0 months, one death occurred. The 3-year overall survival (OS) rate was 100% for the modified regimen and 88.9% ± 10.5% for the traditional regimen (P=0.229). When comparing transplantation types, the 3-year OS rates were 100% for UCBT and 93.8% ± 6.1% for PBSCT (P>0.05), and the 3-year event-free survival rates were 100% and 87.1% ± 8.6%, respectively (P>0.05). CONCLUSIONS TT-containing conditioning for allogeneic HSCT in children with IEI is safe and effective. Both UCBT and PBSCT may achieve high success rates.
Humans ; Retrospective Studies ; Transplantation Conditioning/methods* ; Thiotepa/therapeutic use* ; Hematopoietic Stem Cell Transplantation/adverse effects* ; Male ; Female ; Child, Preschool ; Infant ; Child ; Transplantation, Homologous ; Graft vs Host Disease ; Adolescent