1. Clinical research progresss of antiviral drugs for the novel coronavirus pneumonia
Weigang WU ; Guilin YANG ; Xiaobin ZENG ; Shipin WU ; Boping ZHOU
Chinese Journal of Experimental and Clinical Virology 2020;34(0):E001-E001
The novel coronavirus (2019-nCoV or SARS-CoV-2) is a highly contagious and deadly virus that has infected more than 50 000 people and killed more than 1 000 people in 25 countries around the world. People who infected by the novel coronavirus may suffer from fever and cough, some may gradually appear breathing difficulties and other serious manifestations, some severe patients may have acute respiratory distress syndrome and septic shock leading to death. However, there are no definite and effective antiviral drugs for the novel coronavirus pneumonia all around the world. Therefore, this article aims to provide new idea for the effective treatment of the novel coronavirus pneumonia by summarizing the basic research and clinical progress of antiviral drugs at home and abroad.
2.A questionnaire survey for gout management in physicians in Beijing
Yangyang XIONG ; Chen LI ; Yun ZHANG ; Yue SHA ; Weigang FANG ; Xuejun ZENG
Chinese Journal of Internal Medicine 2019;58(4):288-293
Objective To provide helpful continued medical education (CME) for physicians and improve gout treatment,we conducted a questionnaire survey to investigate physicians' knowledge in nine districts of Beijing.Methods A questionnaire survey including ten gout-related questions was conducted among 298 physicians in Beijing.Demographic data and previous gout CME experience were collected.Chi-square test or Student's t test,univariate analysis and logistic regression analysis were used to evaluate the relevant factors of physicians' knowledge level.Results A total of 250 valid copies were collected including 127 from community service centers (CSC),123 from tertiary hospitals.The correct answer rate of gout etiology,pathogenesis and attack symptoms were over 70% in both groups.45.5% (56/123) CSC doctors and 57.4% (66/115) tertiary doctors answered right drugs to control acute gout attack (P=0.067).Only 42.3% (52/123) in CSC and 53.4% (63/118) in hospitals chose allopurinol as a urate-lowering drug (ULT),while 46.3% (57/123) and 32.2% (38/118) doctors considered colchicine as a ULT drug (P=0.084) respectively.Near half doctors considered that gout patients should take long-term ULT [40.5% (51/126) vs.57.6% (68/118)respectively,P=0.007].Univariate analysis showed that CME training could improve gout-related knowledge in CRC doctors.Conclusion Most CSC doctors generally understand basic knowledge of gout,while confusion of treatment is still significant.CME especially including standard gout treatment should be performed by doctors in tertiary hospitals.
3.Glycogen storage disease type Ⅰ a: a rare cause of gout in adolescent and young adult patients
Na XU ; Xiaoming HUANG ; Weigang FANG ; Yun ZHANG ; Zhengqing QIU ; Xuejun ZENG
Chinese Journal of Internal Medicine 2018;57(4):264-269
Objective To analyze the clinical features of secondary gout in glycogen storage disease type Ⅰ a (GSD Ⅰ a),so as to improve the awareness of this disease.Methods The clinical features,laboratory findings,treatments and prognosis of 5 GSD Ⅰ a patients with secondary gout who had been admitted to the Peking Union Medical College Hospital during 2006 to 2016 were collected and analyzed.GSD Ⅰ a was confirmed by liver biopsy and genotyping.Results Among the 5 patients (median age:27 years),3 were males and 2 were females.The mean age of gout onset was 17 ranging from 10 to 22 years old.The common manifestations of GSD included hepatomegaly since childhood,hypoglycemia,growth retardation,anemia,hyperlactacidemia and hyperlipidemia.All the 5 patients were complicated with gouty tophi and kidney stone.Gouty tophi and kidney stone were identified 3.8 years and 10.2 years after the first occurrence of articular symptoms,respectively.Renal damage occurred in 3 cases.All the patients underwent several therapeutic modalities including lifestyle intervention,allopurinol,and raw corn starch treatment.Conclusions Determination of the presence of primary disease should be performed actively for young-onset gout with early occurrence of gouty tophi.GSD should be suspected if there exist clinical manifestations like hepatomegaly,recurrent hypoglycemia,growth retardation.Early management of hyperuricemia and gout in GSD patients is important to prevent complications and improve prognosis.
5.The associations between adenosine triphosphate binding cassette subfamily G member-2 single nucleotide polymorphism and hyperuricemia in a Chinese tertiary hospital faculty cohort
Bingqing ZHANG ; Weigang FANG ; Yun ZHANG ; Shufen LIU ; Xuejun ZENG
Chinese Journal of Internal Medicine 2017;56(11):833-838
Objective To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia .Method A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing .The enrollment criteria were faculty member of the hospital with signed consent .The exclusion criteria were tumor , previous renal diseases , renal function damage , pregnancy , currently taking medicines that could increase or decrease serum uric acid level , and those who had gout.Males with serum uric acid >416.4 μmol/L and females with serum uric acid >359.6 μmol/L were enrolled as hyperuricemia group .Subjects with normal serum uric acid were randomly enrolled at 1:2 ratio after matching for gender , age, renal function and body mass index .Rs2231142( C>A) was assayed by amplification refractory mutation system polymerase chain reaction , with common forward primer:5′GGCTTTGCAGACATCTATGG 3′, C specific reverse primer:5′CGAAGAGCTGCTGAGAAATG 3′, and A specific reverse primer:5′CGAAGAGCTGCTGAGAAATT 3′.Association between rs 2231142 and hyperuricemia was analyzed in the general study group , as well as different gender and age groups .Results A total of 198 subjects with hyperuricemia and 370 controls were enrolled .The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P<0.001), with an OR for hyperuricemia of 2.89 (95%CI 1.91-4.37, P<0.001).After adjustment for hypertension, hyperglycemia and dyslipidemia , the OR was 2.99 (95%CI 1.94 -4.62, P<0.001). Subgroup analysis showed that the ORs were 3.83 (95%CI 2.03-7.24, P<0.001) in male and 2.30 (95%CI 1.32-4.00, P=0.003) in female.In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95%CI 1.02-10.29, P=0.047) in male and 3.06 (95%CI 1.37-6.84, P=0.006) in female.While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95%CI 1.92-8.79, P<0.001) in males and 1.73 (95%CI 0.80-3.76, P=0.165) in females.Interaction study between gender and rs 2231142 did not reach significant level in both the gender group and two age groups . Conclusion Single nucleotide polymorphism rs 2231142 A allele is an independent risk factor for hyperuricemia in this tertiary hospital faculty cohort .The ORs are higher in male than those in female , especially in those less than 55 years old .
6.Nutritional risk screening and nutritional assessment: definition, clinical practice, and possible pitfalls
Jian YANG ; Ming ZHANG ; Zhuming JIANG ; Kang YU ; Weigang ZHAO ; Qian LU ; Mingwei ZHU ; Jingyong XU ; Minjie ZENG ; Hongxia XU
Chinese Journal of Clinical Nutrition 2017;25(1):59-64
Nutritional support therapy includes three main components:nutritional screening,nutritional assessment,and nutritional intervention.It is important to emphasize that nutritional screening and nutritional assessment are two different concepts and definitions,which are often confusing for many physicians,nurses,and dietitians.In this review,we present an overview on the main concepts about nutritional screening and nutritional assessment,highlight their features and complementarity,and discuss the future perspectives in the clinical practice.
7.Imaging features of Benign fibrous histiocytoma of bone
Haijun WU ; Hui ZENG ; Changhong LIANG ; Yanhai CUI ; Ronghua YAN ; Weigang WANG ; Yanhui LIU
Chinese Journal of Radiology 2012;46(2):148-151
Objective To evaluate the imaging features of benign fibrous histiocytoma (BFH).Methods Imaging data were retrospectively collected and reviewed in 11 patients with pathologically proved BFH.Of the 11 patients,X-ray was performed in all patients,MR scans in 6 patients,and CT scans in 4 patients.Results ALL lesions detected were a solitary lesion.The distribution of BFH was in the tibia (n =5 ),femur ( n =3),fibula ( n =1 ),sacrum ( n =1 ),and thoracic vertebrae ( n =1 ).X-ray features included eccentric osteolytic lesions in 7 patients and centric in 2 patients,with clear boundary and thinning of the cortex,and 7 patients with varying degrees of ossified border were found. CT scan shows bone destruction with density similar to soft tissue.The majority of lesions ( n =3 ) were observed in the expanding shell of bone,2 patients in the tibia and 1 patient in the thoracic lesions with cortical bone perforation.The thoracic lesion as soft tissue mass was detected. All of the lesions detected in CT showed no periosteal reaction.In patients with MR images,hypo to isointense signal intensity on T1WI and hyperintense signal intensity on T2WI was found. All lesions on post-contrast T1WI were detected with homogeneous or heterogeneous lesion with moderate or significant enhancement.Conclusion Imaging features were typical for MFH which is useful tool helping correct diagnosis of MFH.
8.An analysis of disease spectrum of patients admitted to the General Internal Medicine Unit at Peking Union Medical College Hospital from 2004 to 2008, and the value of general internal medicine unit in comprehensive hospitals
Weiguo ZHU ; Yu WANG ; Weigang FANG ; Jialin CHEN ; Yue SHA ; Xiaoming HUANG ; Chengjin HUANG ; Xuejun ZENG ; Yuandong SHAN ; Ti SHEN
Chinese Journal of Internal Medicine 2011;50(3):205-208
Objective To analyze the disease spectrum of patients admitted to the General Internal Medicine Unit at Peking Union Medical College Hospital, which is the first academic division of general internal medicine in the department of medicine within Chinese medical colleges and universities, and the value of general internal medicine unit in comprehensive hospitals. Methods A retrospective data review of patients admitted to the General Internal Medicine Unit from 2004 to 2008 was conducted from hospital information system and partially by chart review manually. Analysis of disease spectrum was performed thereafter. Results A total of 2593 patients were included in our study. It consisted of 1075 men and 1518women, with an average age of 45.1 years old. Forty point three percent of these patients were from Beijing,the local city, and the remaining 59.7% were from outside of Beijing. Sixty-four point nine percent (1683/2593)of these patients did not have a clear diagnosis on admission, including 758 fever of unknown origin (FUO) cases and 925 non-FUO cases. The final diagnostic rate of the FUO cases was 89. 2% [676/758, with the first three leading causes as diseases of the musculoskeletal system and connective tissue (29. 8%), certain infectious and parasitic diseases(26.3%), and neoplasm (14. 5%)] . The final diagnostic rate of the 928 non-FUO cases was 86. 8%(803/925), with the first three leading causes as musculoskeletal system and connective tissue(24.9%), neoplasm (15.5%), and diseases of blood and blood-forming organs(11.4%). Despite most diagnoses fitting into the above categories, the array of diseases was broad with as many as 550 discharge diagnoses from 2004 to 2008. Conclusions During 2004 -2008, there was a high proportion of cases that presented to the General Internal Medicine Unit at Peking Union Medical College Hospital with an unclear diagnosis, and the spectrum of diseases diagnosed was very broad. This kind of patient admitting model might not only benefit patients with no clear admission diagnosis and patients with multidisciplinary medical problems for whom it is usually difficult to be admitted by a specialty unit, but would also benefit medical students and residents by providing a good clinical medicine teaching base. These features show the value of general internal unit in comprehensive hospitals.
9.Teaching base of general internal medicine in Peking Union Medical College Hospital
Xiaoming HUANG ; Jialin CHEN ; Yu WANG ; Chengjin HUANG ; Yue SHA ; Weigang FANG ; Xuejun ZENG ; Ping YANG ; Ti SHEN
Chinese Journal of General Practitioners 2009;8(1):45-47
Department of General Internal Medicine (DGIM) in the Peking Union Medical College (PUMC) Hospital is the first academic general internal medicine division in teaching hospitals in China. We attempted to construct DGIM teaching base in 2005, and the teaching reform was conducted in a part of the students. Primary assessment was based on examinations and questionnaires. The results show that the students could not only master the basic medical knowledge, but also improve overall capability. We conclude that DGIM in teaching hospital would become an important teaching base in China.
10.Imaging appearance of nodular fasciitis
Haijun WU ; Hui ZENG ; Ronghua YAN ; Wei LUO ; Weigang WANG ; Changhong LIANG ; Yanhui LIU
Chinese Journal of Radiology 2009;43(10):1072-1076
Objective To explore the CT and MR imaging features of nodular fasciitis(NF), which will in return improve the standard and quality of diagnosis. Methods CT (n = 4) and MRI (n = 5) findings of pathologically proved nodular fasciitis in 9 patients were retrospectively analyzed. Results Of 9 NF, 5 were located in the lower extremities, 2 in the abdominal wall, and the others in the acoustic duct. The resected tumor size vary from 1.1 to 9. 5 cm in the largest diameter and mean (3.7±0.3) cm. All lesions appeared as a discrete solid mass on imaging. The CT value of lesions was similar to muscle. MR imaging manifested as a hypo to isointense lesion on T_1WI and hyperintense signal intensity on T_2WI. There was homogeneous or heterogeneous moderate to significant enhancement in the lesions. Conclusion CT and MRI can provide helpful information for the clinical and differential diagnosis of NF.

Result Analysis
Print
Save
E-mail