Erchentang is a classic formula widely used by medical practitioners throughout history. In this paper，ancient and modern literature of Erchentang were collected， and bibliometrics was employed to analyze its historic evolution，prescription meaning，herbs origin， processing method，preparation methods， and clinical application. A total of 84 pieces of data were collected， and 58 pieces of data involving 53 ancient medical Chinese books were screened， sorted， and processed. Combined with research of modern scholars，the research has found that the Erchentang originated from the Taiping Huimin Huiye Shijie Fang compiled by the Imperial Medical Bureau of the Song Dynasty. The basic information about the origin of the drugs is quite clear. Pinelliae rhizoma in the formula is the dried tuber of Pinellia ternata. Citri exocarpium rubrum is the dried mature peel of Citrus reticulata and its cultivated varieties， with the inner white membrane removed. Poria is the whitest dry sclerotia of Poria cocos； Glycyrrhizae radix et rhizoma is the dried root and rhizome of the Glycyrrhiza uralensis. The dosage is 5.70 g Pinelliae rhizome and Citri exocarpium rubrum， 3.43 g Poria， and 1.69 g Glycyrrhizae radix et rhizoma praeparata cum melle. During the decoction process， the above-mentioned herbs should be chopped， with 300 mL water， 7 g ginger in thick slices， and 2 g Mume fructus added， and it was then simmered together to 180 mL. After removing the medicinal residue， it can be taken warmly. Erchentang has the effect of drying dampness and resolving phlegm， regulating Qi and harmonizing the middle. It can be used in treating the syndrome of phlegm and dampness，as well as symptoms such as frequent cough，white phlegm，fullness in chest and diaphragm，nausea and vomiting，limb drowsiness，anorexia，dizziness，palpitations，white and greasy tongue coating， and slippery pulse. The above results provide reference for future research and development of Erchentang.

ObjectiveThis paper aims to investigate the material basis of the anti-inflammatory efficacy and mechanism of action of Bushen Tongdu prescription （BSTDP）. MethodsThe chemical components of BSTDP and its blood-absorbed components in vivo were systematically identified by using ultra-performance liquid chromatography-linear ion trap-electrostatic field orbitrap high-resolution mass spectrometry （UPLC-LIT-Orbitrap-MS）. Network pharmacology was employed to screen blood-absorbed bioactive components and potential targets of this formula. A protein-protein interaction （PPI） network of core targets was constructed to conduct enrichment analysis. Molecular docking was further utilized to verify the binding affinity between key components and targets. The inflammatory model was established and verified in vivo by using a transgenic zebrafish Tg （mpx： GFP）. At three days post-fertilization （3 dpf）， larvae of zebrafish were randomly assigned to blank group， model group， positive drug dexamethasone acetate group （75 μmol·L^-1）， and BSTDP groups with low， medium， and high doses （500， 1 000， and 2 000 mg·L^-1）. The distribution and quantity of neutrophils in the yolk sac region were observed under a fluorescence microscope. The mRNA expression levels of key genes in the toll-like receptor 4 （TLR4）/myeloid differentiation factor 88 （MyD88）/nuclear factor kappa-B （NF-κB） signaling pathway and inflammatory factors including interleukin （IL）-1β， IL-6， and tumor necrosis factor-α （TNF-α） were detected by Real-time quantitative polymerase chain reaction （Real-time PCR）. ResultsA total of 120 chemical components were identified in BSTDP， among which 26 original components were confirmed by using serum pharmacochemical methods. A total of 227 common targets linking rheumatoid arthritis （RA） and the blood-absorbed components were screened by network pharmacology. It is suggested that pseudobrucine， vomicine， sinapine， rehmannioside， cinnamyl alcohol glycoside， and methylephedrine exert anti-inflammatory effects by acting on core targets including protein kinase B1 （Akt1）， signal transducer and activator of transcription 3 （STAT3）， tumor necrosis factor （TNF）， TLR4， mitogen-activated protein kinase 14 （MAPK14）， and phosphatidylinositol-4，5-bisphosphate 3-kinase catalytic subunit α （PIK3CA）， thereby modulating multiple signaling pathways such as TLR4 and NF-κB. In vivo verification in zebrafish demonstrates that the maximum tolerable concentration of Bushen Tongdu Formula is 2 000 mg·L^-1. Compared to those in the blank group， zebrafish in the model group showed a significantly higher number of neutrophils in the yolk sac region （P<0.01） and rising mRNA levels of TLR4， MyD88， NF-κB， TNF-α， IL-6， and IL-1β （P<0.01）. Compared to that in the model group， the number of neutrophils was significantly reduced in BSTDP groups with medium and high doses， as well as the dexamethasone acetate group （P<0.05， P<0.01）. There was no statistically significant difference in the low dose group. The mRNA expression levels of TLR4， MyD88， NF-κB， TNF-α， IL-6， and IL-1β were significantly down-regulated （P<0.05， P<0.01）. ConclusionThis paper identifies the material basis of the efficacy of BSTDP， demonstrating that the formula can exert an anti-inflammatory effect through the TLR4/MyD88/NF-κB signaling pathway. The results provide scientific experimental evidence for its further clinical application.

ObjectiveThis paper aims to investigate the material basis of the anti-inflammatory efficacy and mechanism of action of Bushen Tongdu prescription （BSTDP）. MethodsThe chemical components of BSTDP and its blood-absorbed components in vivo were systematically identified by using ultra-performance liquid chromatography-linear ion trap-electrostatic field orbitrap high-resolution mass spectrometry （UPLC-LIT-Orbitrap-MS）. Network pharmacology was employed to screen blood-absorbed bioactive components and potential targets of this formula. A protein-protein interaction （PPI） network of core targets was constructed to conduct enrichment analysis. Molecular docking was further utilized to verify the binding affinity between key components and targets. The inflammatory model was established and verified in vivo by using a transgenic zebrafish Tg （mpx： GFP）. At three days post-fertilization （3 dpf）， larvae of zebrafish were randomly assigned to blank group， model group， positive drug dexamethasone acetate group （75 μmol·L^-1）， and BSTDP groups with low， medium， and high doses （500， 1 000， and 2 000 mg·L^-1）. The distribution and quantity of neutrophils in the yolk sac region were observed under a fluorescence microscope. The mRNA expression levels of key genes in the toll-like receptor 4 （TLR4）/myeloid differentiation factor 88 （MyD88）/nuclear factor kappa-B （NF-κB） signaling pathway and inflammatory factors including interleukin （IL）-1β， IL-6， and tumor necrosis factor-α （TNF-α） were detected by Real-time quantitative polymerase chain reaction （Real-time PCR）. ResultsA total of 120 chemical components were identified in BSTDP， among which 26 original components were confirmed by using serum pharmacochemical methods. A total of 227 common targets linking rheumatoid arthritis （RA） and the blood-absorbed components were screened by network pharmacology. It is suggested that pseudobrucine， vomicine， sinapine， rehmannioside， cinnamyl alcohol glycoside， and methylephedrine exert anti-inflammatory effects by acting on core targets including protein kinase B1 （Akt1）， signal transducer and activator of transcription 3 （STAT3）， tumor necrosis factor （TNF）， TLR4， mitogen-activated protein kinase 14 （MAPK14）， and phosphatidylinositol-4，5-bisphosphate 3-kinase catalytic subunit α （PIK3CA）， thereby modulating multiple signaling pathways such as TLR4 and NF-κB. In vivo verification in zebrafish demonstrates that the maximum tolerable concentration of Bushen Tongdu Formula is 2 000 mg·L^-1. Compared to those in the blank group， zebrafish in the model group showed a significantly higher number of neutrophils in the yolk sac region （P<0.01） and rising mRNA levels of TLR4， MyD88， NF-κB， TNF-α， IL-6， and IL-1β （P<0.01）. Compared to that in the model group， the number of neutrophils was significantly reduced in BSTDP groups with medium and high doses， as well as the dexamethasone acetate group （P<0.05， P<0.01）. There was no statistically significant difference in the low dose group. The mRNA expression levels of TLR4， MyD88， NF-κB， TNF-α， IL-6， and IL-1β were significantly down-regulated （P<0.05， P<0.01）. ConclusionThis paper identifies the material basis of the efficacy of BSTDP， demonstrating that the formula can exert an anti-inflammatory effect through the TLR4/MyD88/NF-κB signaling pathway. The results provide scientific experimental evidence for its further clinical application.

OBJECTIVE: This study reports the first imported case of Lassa fever (LF) in China. Laboratory detection and molecular epidemiological analysis of the Lassa virus (LASV) from this case offer valuable insights for the prevention and control of LF. METHODS: Samples of cerebrospinal fluid (CSF), blood, urine, saliva, and environmental materials were collected from the patient and their close contacts for LASV nucleotide detection. Whole-genome sequencing was performed on positive samples to analyze the genetic characteristics of the virus. RESULTS: LASV was detected in the patient's CSF, blood, and urine, while all samples from close contacts and the environment tested negative. The virus belongs to the lineage IV strain and shares the highest homology with strains from Sierra Leone. The variability in the glycoprotein complex (GPC) among different strains ranged from 3.9% to 15.1%, higher than previously reported for the seven known lineages. Amino acid mutation analysis revealed multiple mutations within the GPC immunogenic epitopes, increasing strain diversity and potentially impacting immune response. CONCLUSION The case was confirmed through nucleotide detection, with no evidence of secondary transmission or viral spread. The LASV strain identified belongs to lineage IV, with broader GPC variability than previously reported. Mutations in the immune-related sites of GPC may affect immune responses, necessitating heightened vigilance regarding the virus.
Humans ; China/epidemiology* ; Genome, Viral ; Lassa Fever/virology* ; Lassa virus/classification* ; Molecular Epidemiology ; Phylogeny

PURPOSE: We carried out the study aiming to explore and analyze the risk factors, the distribution of pathogenic bacteria, and their antibiotic-resistance characteristics influencing the occurrence of surgical site infection (SSI), to provide valuable assistance for reducing the incidence of SSI after traumatic fracture surgery. METHODS: A retrospective case-control study enrolling 3978 participants from January 2015 to December 2019 receiving surgical treatment for traumatic fractures was conducted at Tangdu Hospital of Air Force Medical University. Baseline data, demographic characteristics, lifestyles, variables related to surgical treatment, and pathogen culture were harvested and analyzed. Univariate analyses and multivariate logistic regression analyses were used to reveal the independent risk factors of SSI. A bacterial distribution histogram and drug-sensitive heat map were drawn to describe the pathogenic characteristics. RESULTS: Included 3978 patients 138 of them developed SSI with an incidence rate of 3.47% postoperatively. By logistic regression analysis, we found that variables such as gender (males) (odds ratio (OR) = 2.012, 95% confidence interval (CI): 1.235 - 3.278, p = 0.005), diabetes mellitus (OR = 5.848, 95% CI: 3.513 - 9.736, p < 0.001), hypoproteinemia (OR = 3.400, 95% CI: 1.280 - 9.031, p = 0.014), underlying disease (OR = 5.398, 95% CI: 2.343 - 12.438, p < 0.001), hormonotherapy (OR = 11.718, 95% CI: 6.269 - 21.903, p < 0.001), open fracture (OR = 29.377, 95% CI: 9.944 - 86.784, p < 0.001), and intraoperative transfusion (OR = 2.664, 95% CI: 1.572 - 4.515, p < 0.001) were independent risk factors for SSI, while, aged over 59 years (OR = 0.132, 95% CI: 0.059 - 0.296, p < 0.001), prophylactic antibiotics use (OR = 0.082, 95% CI: 0.042 - 0.164, p < 0.001) and vacuum sealing drainage use (OR = 0.036, 95% CI: 0.010 - 0.129, p < 0.001) were protective factors. Pathogens results showed that 301 strains of 38 species of bacteria were harvested, among which 178 (59.1%) strains were Gram-positive bacteria, and 123 (40.9%) strains were Gram-negative bacteria. Staphylococcus aureus (108, 60.7%) and Enterobacter cloacae (38, 30.9%) accounted for the largest proportion. The susceptibility of Gram-positive bacteria to Vancomycin and Linezolid was almost 100%. The susceptibility of Gram-negative bacteria to Imipenem, Amikacin, and Meropenem exceeded 73%. CONCLUSION Orthopedic surgeons need to develop appropriate surgical plans based on the risk factors and protective factors associated with postoperative SSI to reduce its occurrence. Meanwhile, it is recommended to strengthen blood glucose control in the early stage of admission and for surgeons to be cautious and scientific when choosing antibiotic therapy in clinical practice.
Humans ; Surgical Wound Infection/epidemiology* ; Male ; Female ; Risk Factors ; Retrospective Studies ; Middle Aged ; Adult ; Case-Control Studies ; Fractures, Bone/surgery* ; Aged ; Drug Resistance, Bacterial ; Logistic Models ; Anti-Bacterial Agents/therapeutic use* ; Incidence ; Bacteria/drug effects*

Extensive studies have identified potential adverse effects on semen quality of obesity, based on body mass index, but the association between body fat distribution, a more relevant indicator for obesity, and semen quality remains less clear. We conducted a longitudinal study of 4304 sperm donors from the Guangdong Provincial Human Sperm Bank (Guangzhou, China) during 2017-2021. A body composition analyzer was used to measure total and local body fat percentage for each participant. Generalized estimating equations were employed to assess the association between body fat percentage and sperm count, motility, and morphology. We estimated that each 10% increase in total body fat percentage (estimated change [95% confidence interval, 95% CI]) was significantly associated with a 0.18 × 10 6 (0.09 × 10 6 -0.27 × 10 6 ) ml and 12.21 × 10 6 (4.52 × 10 6 -19.91 × 10 6 ) reduction in semen volume and total sperm count, respectively. Categorical analyses and exposure-response curves showed that the association of body fat distribution with semen volume and total sperm count was stronger at higher body fat percentages. In addition, the association still held among normal weight and overweight participants. We observed similar associations for upper limb, trunk, and lower limb body fact distributions. In conclusion, we found that a higher body fat distribution was significantly associated with lower semen quality (especially semen volume) even in men with a normal weight. These findings provide useful clues in exploring body fat as a risk factor for semen quality decline and add to evidence for improving semen quality for those who are expected to conceive.
Humans ; Male ; Adult ; Semen Analysis ; China ; Body Fat Distribution ; Longitudinal Studies ; Sperm Count ; Sperm Motility ; Body Mass Index ; Tissue Donors ; Obesity/complications* ; Spermatozoa ; Young Adult ; Middle Aged ; East Asian People

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Acetaminophen (APAP) is the primary cause of drug-induced acute liver failure. Ovarian tumor deubiquitinase 6A (OTUD6A), a recently discovered deubiquitinase of the OTU family, has been primarily studied in tumor contexts. However, its role in APAP-induced liver injury (AILI) remains unclear. Therefore, this study aimed to investigate the involvement of OTUD6A in the pathogenesis of AILI. Our findings demonstrated a substantial upregulation of OTUD6A in both the liver tissue and isolated hepatocytes of mice following APAP stimulation. OTUD6A knockout exacerbated APAP-induced inflammation, hepatocyte necrosis, and liver injury, whereas OTUD6A overexpression alleviated these pathologies. Mechanistically, OTUD6A directly interacted with the enhancer of zeste homolog 2 (EZH2) and selectively removed K48-linked polyubiquitin chains from EZH2, enhancing its stability. This resulted in increased protein levels of EZH2 and H3K27me3, as well as reduced endoplasmic reticulum (ER) stress and cell death in hepatocytes. Collectively, our research uncovers a novel role for OTUD6A in mitigating APAP-induced liver injury by promoting EZH2 stabilization.

Cemental tear is a rare and indetectable condition unless obvious clinical signs present with the involvement of surrounding periodontal and periapical tissues. Due to its clinical manifestations similar to common dental issues, such as vertical root fracture, primary endodontic diseases, and periodontal diseases, as well as the low awareness of cemental tear for clinicians, misdiagnosis often occurs. The critical principle for cemental tear treatment is to remove torn fragments, and overlooking fragments leads to futile therapy, which could deteriorate the conditions of the affected teeth. Therefore, accurate diagnosis and subsequent appropriate interventions are vital for managing cemental tear. Novel diagnostic tools, including cone-beam computed tomography (CBCT), microscopes, and enamel matrix derivatives, have improved early detection and management, enhancing tooth retention. The implementation of standardized diagnostic criteria and treatment protocols, combined with improved clinical awareness among dental professionals, serves to mitigate risks of diagnostic errors and suboptimal therapeutic interventions. This expert consensus reviewed the epidemiology, pathogenesis, potential predisposing factors, clinical manifestations, diagnosis, differential diagnosis, treatment, and prognosis of cemental tear, aiming to provide a clinical guideline and facilitate clinicians to have a better understanding of cemental tear.
Humans ; Dental Cementum/injuries* ; Consensus ; Diagnosis, Differential ; Cone-Beam Computed Tomography ; Tooth Fractures/therapy*

Objective To construct and validate a prediction model for urosepsis in patients after upper urinary tract stone surgery using various machine learning algorithms.Methods A total of 7 464 upper urinary tract stone patients who underwent surgery at the Sixth Affiliated Hospital of Guangxi Medical University from Jun.2018 to Jun.2023 were enrolled and randomly assigned to training(5 224 cases)or validation sets(2 240 cases)at a ratio of 7∶3.Among them,622(8.33%)cases developed urosepsis postoperatively.Six machine learning algorithms,including extreme gradient boosting(XGBoost),logistic regression,light gradient boosting machine(LightGBM),random forest(RF),adaptive boosting(AdaBoost),and gradient boosting decision tree(GBDT),were used to construct prediction models for postoperative urosepsis.The model's predictive ability and clinical benefits were evaluated using receiver operating characteristic(ROC)curves,Shapley additive explanation(SHAP)analysis,calibration curves,and decision curve analysis(DCA).Results The clinical features included body mass index(BMI),number of surgeries,heart rate,Barthel index,venous thrombo embolism(VTE)risk assessment,gender,American Society of Anesthesiologists(ASA)grade,urinary nitrite,and urinary leukocyte in the models.In the training set,the XGBoost,LightGBM,and RF models performed excellently,with area under curve(AUC)values of ROC curves reaching 1.00.In the validation set,the logistic regression model performed the best,with an AUC value of ROC curve of 0.76,showing good predictive stability and calibration.The AdaBoost and GBDT models followed with AUC values of 0.74 and 0.75,respectively,while the AUC values of the LightGBM,XGBoost,and RF models were 0.71,0.70,and 0.68.In terms of model interpretability,SHAP analysis showed the contribution of variables in a descending order as:heart rate,urinary leukocytes,gender,BMI,Barthel index,VTE risk assessment,urinary nitrite,number of surgeries,and ASA grade.Conclusion A logistic regression model for early risk prediction of postoperative urosepsis in upper urinary tract stone patients has been successfully constructed.This model has good predictive performance and calibration,and can effectively assist clinical diagnosis.