Xiaoji Yinzi is one of the classic prescriptions for treating urinary diseases， originated from the Yan's Prescriptions to Aid the Living （Yan Shi Ji Sheng Fang） written by YAN Yonghe in the Song dynasty. Xiaoji Yinzi is composed of Rehmanniae Radix， Cirsii Herba， Talcum， Akebiae Caulis， Typhae Pollen， Nelumbinis Rhizomatis Nodus， Lophatheri Herba， Angelicae Sinensis Radix， Gardeniae Fructus， and Glycyrrhizae Radix et Rhizoma and has the effects of cooling blood and stopping bleeding， draining water and relieving stranguria. The medical experts of later generations have inherited the original prescription recorded in the Yan's Prescriptions to Aid the Living， while dispute has emerged during the inheritance of this prescription. In this study， the method of bibliometrics was employed to review and analyze the ancient documents and modern clinical studies involving Xiaoji Yinzi. The results showed that Xiaoji Yinzi has two dosage forms： powder and decoction. According to the measurement system in the Song Dynasty， the modern doses of hers in Xiaoji Yinzi were transformed. In the prepration of Xiaoji Yinzi powder， 149.2 g of Rehmanniae Radix and 20.65 g each of Cirsii Herba， Talcum， Akebiae Caulis， stir-fried Typhae Pollen， Nelumbinis Rhizomatis Nodus， Lophatheri Herba， wine-processed Angelicae Sinensis Radix， stir-fried Gardeniae Fructus， and stir-fried Glycyrrhizae Radix et Rhizoma are grounded into fine powder with the particle size of 4-10 meshes and a decocted with 450 mL water to reach a volume of 240 mL. After removal of the residue， the decoction was taken warm before meals， 3 times a day （i.e.， 7.77 g Rehmanniae Radix and 0.97 g each of the other herbs each time）. In the preparation of Xiaoji Yinzi decoction， 20.65 g each of the above 10 herbs are used， with stir-fried Typhae Pollen， wine-processed Angelica Sinensis Radix， stir-fired Gardeniae Fructus， stir-fired Glycyrrhizae Radix et Rhizoma， and raw materials of other herbs. Xiaoji Yinzi is specialized in treating hematuresis and blood stranguria due to heat accumulation in lower energizer， which causes injury of the blood collaterals of gallbladder and dysfunction of Qi transformation. In modern clinical practice， Xiaoji Yinzi is specifically used for treating urinary diseases and can be expanded to treat diseases of the cardiovascular system and other systems according to pathogenesis. The comprehensive research on the key information could provide a scientific reference for the future development of Xiaoji Yinzi.

OBJECTIVE To investigate the relationship of long non-coding RNA （LncRNA） metastasis-associated lung adenocarcinoma transcript 1 （MALAT1） and doxorubicin （DOX） resistance in osteosarcoma （OS） cells. METHODS MG-63 and MG-63/DOX cells were treated with different concentrations of DOX （0， 0.01， 0.05， 0.1， 1 μmol/L）， and survival rates and half maximal inhibitory concentration were determined using CCK-8 assay. The expressions of LncRNA MALAT1 in MG-63 and MG-63/ DOX cells were detected by real-time quantitative fluorescence PCR. MG-63/DOX cells were divided into Control group， knocking down LncRNA MALAT1 negative control （sh-NC） group， sh-MALAT1 group， sh-MALAT1+anti-NC group， and sh-MALAT1+ anti-miR-154-5p group. The expressions of LncRNA MALAT1， miR-154-5p and cyclin D1 （CCND1） mRNA in MG-63/DOX cells of each group were detected. The effects of knocking down LncRNA MALAT1 on the proliferation， migration， invasion， and apoptosis of MG-63/DOX cells were detected by CCK-8 assay， scratch test， Transwell experiment and flow cytometry， respectively. The expression of proliferating cell nuclear protein （PCNA） and CCND1 protein in MG-63/DOX cells was detected by Western blot assay. Interactions between LncRNA MALAT1 and miR-154-5p， miR-154-5p and CCND1 were detected by dual luciferase reporter gene experiment. RESULTS Compared with 0 μmol/L DOX， 0.01， 0.05， 0.1 and 1 μmol/L DOX could reduce the survival rates of MG-63 and MG-63/DOX cells （except for 0.01 μmol/L DOX） （P＜0.05）， IC50 were 0.07 and 0.13 μmol/L， respectively. The survival rate， cell migration number and invasion number of MG-63/DOX cells， scratch closure rate， mRNA expressions of LncRNA MALAT1， mRNA and protein expressions of CCND1， and PCNA protein expression in sh-MALAT1 group were significantly lower than sh-NC group and Control group； the apoptosis rate and miR-154-5p expression were significantly higher than sh-NC group and Control group （P＜0.05）. sh-MALAT1+anti-miR-154-5p group was able to reverse the aforementioned biological effects in sh-MALAT1 group （P＜0.05）. In MG-63/DOX cells transfected with both MALAT1-wild type （WT） and CCND1-WT， the luciferase activity in the miR-154-5p mimic group was significantly lower than mimic negative control group （P＜ 0.05）. CONCLUSIONS Knocking down LncRNA MALAT1 can inhibit the DOX resistance of OS cells， and its mechanism may be targeting the miR-154-5p/CCND1 axis.

OBJECTIVE: To evaluate the effectiveness of early internal fixation combined with free anterolateral thigh perforator flap (ALTPF) transplantation in the treatment of open ankle fracture-dislocation. METHODS: A retrospective analysis was performed on the clinical data of 13 patients with open ankle fracture-dislocation who were admitted and met the inclusion criteria between January 2021 and May 2024. Among them, there were 9 males and 4 females, with the ages ranging from 23 to 61 years (mean, 45.3 years). Fracture types included 5 cases of simple medial or lateral malleolar fracture-dislocation, 7 cases of bimalleolar (medial and lateral) fracture-dislocation, and 1 case of trimalleolar fracture-dislocation. Additionally, 3 cases were complicated with bone defects (1 medial malleolus defect and 2 lateral malleolus defects). All injuries were classified as type ⅢB according to the Gustilo-Anderson classification for open fractures. The size of wound defects ranged from 7 cm×5 cm to 18 cm×12 cm. The time from injury to surgery was 2-20 hours (mean, 4 hours). All patients underwent emergency thorough debridement upon admission. The fracture-dislocation was temporarily stabilized with an external fixator, and the wound was covered with antibiotic-impregnated bone cement sheets or vacuum sealing drainage. Definitive internal fixation of the fracture and free ALTPF transplantation were performed 5-7 days after the initial emergency procedure. Postoperatively, wound healing, flap survival, and fracture union were monitored. At last follow-up, clinical outcomes were assessed using the American Orthopaedic Foot and Ankle Society (AOFAS) ankle-hindfoot score. RESULTS: All 13 patients were followed up 6-24 months (mean, 8.2 months). All flaps survived completely, and all fractures achieved union, with an union time of 3-11 months (mean, 5.5 months). One patient developed a superficial infection at the wound margin, which healed after regular dressing changes and drainage. No internal fixation-related complication (e.g., deep infection, implant loosening, or secondary ankle instability) were observed. At last follow-up, the total AOFAS ankle-hindfoot score was 78.6±13.5, with 3 excellent, 7 good, 2 fair, and 1 poor cases, yielding an excellent and good rate of 76.9%. CONCLUSION Early internal fixation combined with ALTPF transplantation for open ankle fracture-dislocation can shorten the treatment course and maximize the recovery of ankle joint function.
Humans ; Fracture Fixation, Internal/methods* ; Male ; Middle Aged ; Female ; Adult ; Retrospective Studies ; Perforator Flap/transplantation* ; Ankle Fractures/surgery* ; Thigh/surgery* ; Fractures, Open/surgery* ; Treatment Outcome ; Young Adult ; Plastic Surgery Procedures/methods* ; Fracture Dislocation/surgery*

PURPOSE: We carried out the study aiming to explore and analyze the risk factors, the distribution of pathogenic bacteria, and their antibiotic-resistance characteristics influencing the occurrence of surgical site infection (SSI), to provide valuable assistance for reducing the incidence of SSI after traumatic fracture surgery. METHODS: A retrospective case-control study enrolling 3978 participants from January 2015 to December 2019 receiving surgical treatment for traumatic fractures was conducted at Tangdu Hospital of Air Force Medical University. Baseline data, demographic characteristics, lifestyles, variables related to surgical treatment, and pathogen culture were harvested and analyzed. Univariate analyses and multivariate logistic regression analyses were used to reveal the independent risk factors of SSI. A bacterial distribution histogram and drug-sensitive heat map were drawn to describe the pathogenic characteristics. RESULTS: Included 3978 patients 138 of them developed SSI with an incidence rate of 3.47% postoperatively. By logistic regression analysis, we found that variables such as gender (males) (odds ratio (OR) = 2.012, 95% confidence interval (CI): 1.235 - 3.278, p = 0.005), diabetes mellitus (OR = 5.848, 95% CI: 3.513 - 9.736, p < 0.001), hypoproteinemia (OR = 3.400, 95% CI: 1.280 - 9.031, p = 0.014), underlying disease (OR = 5.398, 95% CI: 2.343 - 12.438, p < 0.001), hormonotherapy (OR = 11.718, 95% CI: 6.269 - 21.903, p < 0.001), open fracture (OR = 29.377, 95% CI: 9.944 - 86.784, p < 0.001), and intraoperative transfusion (OR = 2.664, 95% CI: 1.572 - 4.515, p < 0.001) were independent risk factors for SSI, while, aged over 59 years (OR = 0.132, 95% CI: 0.059 - 0.296, p < 0.001), prophylactic antibiotics use (OR = 0.082, 95% CI: 0.042 - 0.164, p < 0.001) and vacuum sealing drainage use (OR = 0.036, 95% CI: 0.010 - 0.129, p < 0.001) were protective factors. Pathogens results showed that 301 strains of 38 species of bacteria were harvested, among which 178 (59.1%) strains were Gram-positive bacteria, and 123 (40.9%) strains were Gram-negative bacteria. Staphylococcus aureus (108, 60.7%) and Enterobacter cloacae (38, 30.9%) accounted for the largest proportion. The susceptibility of Gram-positive bacteria to Vancomycin and Linezolid was almost 100%. The susceptibility of Gram-negative bacteria to Imipenem, Amikacin, and Meropenem exceeded 73%. CONCLUSION Orthopedic surgeons need to develop appropriate surgical plans based on the risk factors and protective factors associated with postoperative SSI to reduce its occurrence. Meanwhile, it is recommended to strengthen blood glucose control in the early stage of admission and for surgeons to be cautious and scientific when choosing antibiotic therapy in clinical practice.
Humans ; Surgical Wound Infection/epidemiology* ; Male ; Female ; Risk Factors ; Retrospective Studies ; Middle Aged ; Adult ; Case-Control Studies ; Fractures, Bone/surgery* ; Aged ; Drug Resistance, Bacterial ; Logistic Models ; Anti-Bacterial Agents/therapeutic use* ; Incidence ; Bacteria/drug effects*

Extensive studies have identified potential adverse effects on semen quality of obesity, based on body mass index, but the association between body fat distribution, a more relevant indicator for obesity, and semen quality remains less clear. We conducted a longitudinal study of 4304 sperm donors from the Guangdong Provincial Human Sperm Bank (Guangzhou, China) during 2017-2021. A body composition analyzer was used to measure total and local body fat percentage for each participant. Generalized estimating equations were employed to assess the association between body fat percentage and sperm count, motility, and morphology. We estimated that each 10% increase in total body fat percentage (estimated change [95% confidence interval, 95% CI]) was significantly associated with a 0.18 × 10 6 (0.09 × 10 6 -0.27 × 10 6 ) ml and 12.21 × 10 6 (4.52 × 10 6 -19.91 × 10 6 ) reduction in semen volume and total sperm count, respectively. Categorical analyses and exposure-response curves showed that the association of body fat distribution with semen volume and total sperm count was stronger at higher body fat percentages. In addition, the association still held among normal weight and overweight participants. We observed similar associations for upper limb, trunk, and lower limb body fact distributions. In conclusion, we found that a higher body fat distribution was significantly associated with lower semen quality (especially semen volume) even in men with a normal weight. These findings provide useful clues in exploring body fat as a risk factor for semen quality decline and add to evidence for improving semen quality for those who are expected to conceive.
Humans ; Male ; Adult ; Semen Analysis ; China ; Body Fat Distribution ; Longitudinal Studies ; Sperm Count ; Sperm Motility ; Body Mass Index ; Tissue Donors ; Obesity/complications* ; Spermatozoa ; Young Adult ; Middle Aged ; East Asian People

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Acetaminophen (APAP) is the primary cause of drug-induced acute liver failure. Ovarian tumor deubiquitinase 6A (OTUD6A), a recently discovered deubiquitinase of the OTU family, has been primarily studied in tumor contexts. However, its role in APAP-induced liver injury (AILI) remains unclear. Therefore, this study aimed to investigate the involvement of OTUD6A in the pathogenesis of AILI. Our findings demonstrated a substantial upregulation of OTUD6A in both the liver tissue and isolated hepatocytes of mice following APAP stimulation. OTUD6A knockout exacerbated APAP-induced inflammation, hepatocyte necrosis, and liver injury, whereas OTUD6A overexpression alleviated these pathologies. Mechanistically, OTUD6A directly interacted with the enhancer of zeste homolog 2 (EZH2) and selectively removed K48-linked polyubiquitin chains from EZH2, enhancing its stability. This resulted in increased protein levels of EZH2 and H3K27me3, as well as reduced endoplasmic reticulum (ER) stress and cell death in hepatocytes. Collectively, our research uncovers a novel role for OTUD6A in mitigating APAP-induced liver injury by promoting EZH2 stabilization.

Cemental tear is a rare and indetectable condition unless obvious clinical signs present with the involvement of surrounding periodontal and periapical tissues. Due to its clinical manifestations similar to common dental issues, such as vertical root fracture, primary endodontic diseases, and periodontal diseases, as well as the low awareness of cemental tear for clinicians, misdiagnosis often occurs. The critical principle for cemental tear treatment is to remove torn fragments, and overlooking fragments leads to futile therapy, which could deteriorate the conditions of the affected teeth. Therefore, accurate diagnosis and subsequent appropriate interventions are vital for managing cemental tear. Novel diagnostic tools, including cone-beam computed tomography (CBCT), microscopes, and enamel matrix derivatives, have improved early detection and management, enhancing tooth retention. The implementation of standardized diagnostic criteria and treatment protocols, combined with improved clinical awareness among dental professionals, serves to mitigate risks of diagnostic errors and suboptimal therapeutic interventions. This expert consensus reviewed the epidemiology, pathogenesis, potential predisposing factors, clinical manifestations, diagnosis, differential diagnosis, treatment, and prognosis of cemental tear, aiming to provide a clinical guideline and facilitate clinicians to have a better understanding of cemental tear.
Humans ; Dental Cementum/injuries* ; Consensus ; Diagnosis, Differential ; Cone-Beam Computed Tomography ; Tooth Fractures/therapy*

OBJECTIVE: This study reports the first imported case of Lassa fever (LF) in China. Laboratory detection and molecular epidemiological analysis of the Lassa virus (LASV) from this case offer valuable insights for the prevention and control of LF. METHODS: Samples of cerebrospinal fluid (CSF), blood, urine, saliva, and environmental materials were collected from the patient and their close contacts for LASV nucleotide detection. Whole-genome sequencing was performed on positive samples to analyze the genetic characteristics of the virus. RESULTS: LASV was detected in the patient's CSF, blood, and urine, while all samples from close contacts and the environment tested negative. The virus belongs to the lineage IV strain and shares the highest homology with strains from Sierra Leone. The variability in the glycoprotein complex (GPC) among different strains ranged from 3.9% to 15.1%, higher than previously reported for the seven known lineages. Amino acid mutation analysis revealed multiple mutations within the GPC immunogenic epitopes, increasing strain diversity and potentially impacting immune response. CONCLUSION The case was confirmed through nucleotide detection, with no evidence of secondary transmission or viral spread. The LASV strain identified belongs to lineage IV, with broader GPC variability than previously reported. Mutations in the immune-related sites of GPC may affect immune responses, necessitating heightened vigilance regarding the virus.
Humans ; China/epidemiology* ; Genome, Viral ; Lassa Fever/virology* ; Lassa virus/classification* ; Molecular Epidemiology ; Phylogeny

This study using maltodextrin as raw material, 1%-5% polyvinylpyrrolidone K30 as template agent, 1%-5% ammonium bicarbonate as pore-forming agent, curcumin and ibuprofen as model drugs. Porous maltodextrin was prepared by template and pore-forming agent methods, respectively. The structure and drug delivery behavior of porous maltodextrin prepared by different technologies were comprehensively characterized. The results showed that the porous maltodextrin prepared by pore-forming agent method had larger specific surface area (6.449 4 m²·g^-1) and pore size (32.804 2 nm), which was significantly better than that by template agent method (3.670 2 m²·g^-1, 15.278 5 nm). The adsorption kinetics between porous maltodextrin prepared by pore-forming agent method and curcumin were suitable for quasi-first order adsorption kinetic model, and that between porous maltodextrin and ibuprofen were suitable for quasi-second order adsorption kinetic model. While the adsorption kinetics between porous maltodextrin prepared by template agent method and two model drugs were both suitable for the quasi-first order adsorption kinetic model. In addition, the dissolution behavior analysis showed that the porous maltodextrin prepared by the two technologies can significantly improve the dissolution behavior of insoluble drugs, and the drug release was both carried out by diffusion mechanism, which suitable for the Peppas kinetic release model, but the porous maltodextrin prepared by template agent method had a faster release rate. The change of nozzle diameter had no significant effect on the adsorption process and drug release behavior of porous maltodextrin. In conclusion, the porous maltodextrins prepared by two different technologies were both beneficial to the delivery of insoluble drugs, and the template agent method was the best for delivery of insoluble drugs. This study can provide theoretical basis for the preparation of porous particles, promote the application of porous particles in insoluble drugs, and improve the bioavailability of insoluble drugs.