Background Methicillin-resistant Staphylococcus aureus (MRSA) is an important pathogen for both human bloodstream infections and mastitis in cows. However, little attention has been paid to the cross-host transmission of MRSA from cows to high-risk groups in China. Objective To determine the MRSA colonization rates among dairy cows and dairy farm workers in Xinjiang, identify the antibiotic resistance profiles and molecular characteristics of the isolates, and provide scientific evidence for the formulation of targeted infection control strategies. Method A cross-sectional survey combined with laboratory pathogen analysis was conducted. From June to August 2024, large-scale dairy farms in Xinjiang region were selected as study sites. Nasal swabs (n=96) and skin swabs (n=39) were collected from workers, and bovine nasal swab samples (n=109) were collected simultaneously. All samples were subjected to MRSA isolation, cultivation, and identification, followed by antibiotic susceptibility testing to characterize resistance phenotypes. Staphylococcus aureus protein A (Spa) typing was performed to determine strain genotypes and elucidate MRSA colonization rates and molecular epidemiological patterns. Results A total of 35 MRSA strains was successfully isolated from 244 samples. The MRSA colonization rates among dairy farm workers and dairy cows were 20.83% (20/96) and 12.84% (14/109), respectively, with an overall isolation rate of 14.34% (35/244). Among the workers, the nasal colonization rate was 16.67% (16/96), and the skin colonization rate was 12.82% (5/39). One worker exhibited MRSA colonization at multiple body sites. All MRSA strains were resistant to cefoxitin (100%, 35/35). The resistance rates to erythromycin and clindamycin were 42.86% (15/35) and 34.29% (12/35), respectively. Thirteen strains showed a multidrug-resistant phenotype, whereas all strains were susceptible to vancomycin. The MRSA isolates exhibited high genetic diversity, with 13 Spa types identified, among which t441 was the most prevalent (8 strains). Both t441 and t034 types were detected in samples from both the dairy cows and their handlers. These two Spa types also carried and stably inherited specific resistance combinations, including erythromycin–clindamycin–cefoxitin and ciprofloxacin–erythromycin–clindamycin–gentamicin–cefoxitin–tetracycline, and a statistically significant association was also observed between the two resistance profiles and the bacterial types (P < 0.001). In addition, one novel Spa type strain was identified. Conclusion MRSA colonization rates among dairy cows and dairy farm workers in Xinjiang are relatively high, with evidence of multi-site colonization. The isolates exhibit high levels of multidrug resistance and genetic diversity, indicating a potential risk of cross-host transmission.

Background Under intensive dairy farming conditions, Enterococcus spp. can be transmitted between animals, farm workers, and the environment via multiple vectors such as feces, soil, water, air, and farming equipment, posing a potential threat to public health. Objective To elucidate the prevalence, distribution, and antimicrobial resistance profiles of Enterococcus faecalis (E. faecalis) and Enterococcus faecium (E. faecium) among farm workers, dairy cattle, and the farm environment in Xinjiang, and to assess the risk of their cross-host transmission. Methods From May 2024 to January 2025, a total of 317 samples were collected from 11 large-scale dairy farms in Xinjiang, China, including feces from farm workers (n=130) and dairy cattle (n=154), and environmental samples (n=33). E. faecalis and E. faecium were isolated and identified, followed by antimicrobial susceptibility testing and multilocus sequence typing (MLST) to analyze their molecular characteristics. Results A total of 183 Enterococcus isolates were obtained (66 E. faecalis and 117 E. faecium isolated). The isolation rates of both species showed statistically significant differences among the three sources (χ²=29.21, P=0.003). Antimicrobial resistance analysis revealed that E. faecalis generally exhibited higher resistance rates across multiple antibiotic classes than E. faecium. High resistance to rifampicin was observed across all sources (50.00%–81.25%), with statistical variation among origins (χ²=8.03, P=0.024). Multidrug-resistant strains accounted for 69.10% of the isolates. Multidrug resistance patterns in E. faecium varied significantly by source (χ²=27.19, P=0.014), and one isolate displayed resistance to eight antibiotic classes. MLST indicated high genetic diversity; E. faecalis was dominated by ST472 and ST227 of which the distrubution was significantly different among sources, while E. faecium primarily clustered into clonal complexes CC94 (centered on ST94) and CC17 (centered on ST22). Conclusion Resistant Enterococcus strains exhibit cross-transmission among farm workers, animals, and the environment. Under the "One Health" framework, standardized farming protocols and prudent antimicrobial use are essential to disrupt the transmission chain of resistant clones and mitigate the spread of antimicrobial resistance at its source.

Background Under intensive dairy farming conditions, Enterococcus spp. can be transmitted between animals, farm workers, and the environment via multiple vectors such as feces, soil, water, air, and farming equipment, posing a potential threat to public health. Objective To elucidate the prevalence, distribution, and antimicrobial resistance profiles of Enterococcus faecalis (E. faecalis) and Enterococcus faecium (E. faecium) among farm workers, dairy cattle, and the farm environment in Xinjiang, and to assess the risk of their cross-host transmission. Methods From May 2024 to January 2025, a total of 317 samples were collected from 11 large-scale dairy farms in Xinjiang, China, including feces from farm workers (n=130) and dairy cattle (n=154), and environmental samples (n=33). E. faecalis and E. faecium were isolated and identified, followed by antimicrobial susceptibility testing and multilocus sequence typing (MLST) to analyze their molecular characteristics. Results A total of 183 Enterococcus isolates were obtained (66 E. faecalis and 117 E. faecium isolated). The isolation rates of both species showed statistically significant differences among the three sources (χ²=29.21, P=0.003). Antimicrobial resistance analysis revealed that E. faecalis generally exhibited higher resistance rates across multiple antibiotic classes than E. faecium. High resistance to rifampicin was observed across all sources (50.00%–81.25%), with statistical variation among origins (χ²=8.03, P=0.024). Multidrug-resistant strains accounted for 69.10% of the isolates. Multidrug resistance patterns in E. faecium varied significantly by source (χ²=27.19, P=0.014), and one isolate displayed resistance to eight antibiotic classes. MLST indicated high genetic diversity; E. faecalis was dominated by ST472 and ST227 of which the distrubution was significantly different among sources, while E. faecium primarily clustered into clonal complexes CC94 (centered on ST94) and CC17 (centered on ST22). Conclusion Resistant Enterococcus strains exhibit cross-transmission among farm workers, animals, and the environment. Under the "One Health" framework, standardized farming protocols and prudent antimicrobial use are essential to disrupt the transmission chain of resistant clones and mitigate the spread of antimicrobial resistance at its source.

ObjectiveTo systematically screen and validate key immunogenic cell death （ICD）-related genes that play important roles in primary sjögren’s syndrome （pSS） using multi-omics data. MethodsGene expression profiles of pSS patients and healthy controls （GSE66795， 131pSS patients/29 healthy controls） were obtained from the Gene Expression Omnibus （GEO） database. Candidate genes were selected by intersecting these profiles with known ICD core gene sets and pSS-related targets. The CIBERSORT algorithm was used to analyze immune cell infiltration characteristics. Validation of gene expression was performed using transcriptomic data from sorted CD8⁺ T cell subsets （GSE93683）. Finally， labial gland tissues and peripheral blood samples from 10 pSS patients and 4 healthy controls were collected， and key genes were experimentally validated by reverse transcription quantitative polymerase chain reaction （RT-qPCR）. ResultsSeven intersecting genes from the ICD-differentially expressed genes （DEGs）-pSS intersection were identified ［caspase 1 （CASP1）， forkhead box P3 （FOXP3）， interferon-gamma （IFNG）， myeloid differentiation primary response 88 （MYD88）， toll-like receptor 7 （TLR7）， DExD/H-box helicase 58 （DDX58）， and interferon induced helicase C domain 1 （IFIH1）］. Immune infiltration analysis showed that in pSS labial gland tissues， the proportions of naïve B cells and dendritic cells significantly increased， while the proportions of resting NK cells and M0 macrophages decreased （P<0.05）. Transcriptomic data of CD8⁺T cell subsets indicated that IFIH1 expression was significantly elevated in central memory CD8⁺T cells （P<0.05）. RT-qPCR experimental validation revealed that DDX58， IFIH1， and CASP1 were significantly upregulated in both peripheral blood leukocytes and labial gland tissues of pSS patients （all P<0.05）， whereas IFNG expression increased in peripheral blood but decreased in labial gland tissues （P<0.05）. ConclusionThis study identified and confirmed DDX58， IFIH1， CASP1， and IFNG as key ICD-related genes in pSS through a combination of bioinformatics and experimental validation， providing new candidate targets for further understanding the immunopathological mechanisms of pSS.

Metabolic dysfunction-associated fatty liver disease （MAFLD） is currently the most prevalent chronic liver disease worldwide， and its disease spectrum encompasses simple steatosis， metabolic-associated steatohepatitis， hepatic fibrosis， liver cirrhosis， and hepatocellular carcinoma. Recent studies have shown that hepatic macrophages play an important regulatory role in the development and progression of MAFLD. Hepatic macrophages mainly consist of resident Kupffer cells and monocyte-derived macrophages， which participate in the pathophysiological processes of the disease by regulating inflammatory response， lipid metabolism， fibrogenic process， and cell death pathways. This article summarizes the diversity and functional plasticity of hepatic macrophages in MAFLD， reviews their interactions with hepatocytes and gut microbiota， elaborates on the core mechanism of hepatic macrophages and related signaling pathways in the progression of MAFLD， and further discusses novel therapeutic strategies targeting hepatic macrophages. An in-depth understanding of the mechanism of action of hepatic macrophages in MAFLD may provide a crucial theoretical basis for developing precise therapeutic approaches for this disease.

Background Personal protection is crucial for reducing the risk of zoonotic pathogen infection among livestock workers. Investigating the current status of its implementation and associated influencing factors can provide empirical evidence for developing more effective intervention measures. Objective To investigate the current status of personal protection implementation among livestock workers in Xinjiang, China and its influencing factors, providing a reference for formulating targeted intervention measures. Methods This study was conducted in Bayingolin Mongol Autonomous Prefecture, Kashgar region, and the First and Eighth Divisions of Xinjiang Production and Construction Corps. We selected large-scale cattle and sheep farms, cooperatives, individual livestock households, livestock trading markets, slaughterhouses, and retail markets. Using cluster sampling, we recruited all livestock workers (1074 participants) at sampled sites. During the period from April to July 2024, we conducted face-to-face surveys with a self-designed questionnaire among livestock workers, collecting general demographic information, occupational exposure history, and information related to the use of personal protective equipment, resulting in 939 valid questionnaires. EpiData 3.1 was used for data entry and SPSS 26.0 for statistical analysis. We employed logistic regression to compare the implementation of personal protection among workers by selected categories. Results Among the study subjects, there were 300 workers from large-scale farms (31.95%) and 583 self-employed livestock farmers (62.09%). The sample included 600 males (63.90%) and 339 females (36.10%). The majority of the study subjects was farmers, breeders, or aged 18-60 years (87.75%), auxiliary workers (87.97%) and had an education level of junior high school or below (81.36%). The proportion of workers who consistently and correctly implemented all five personal protective measures (washing hands after work, wearing gloves, wearing masks, wearing dedicated work clothes, and using rubber boots) was 35.14% (330/939). The implementation rates for these five protective measures were 93.61% (879/939), 58.68% (551/939), 57.93% (544/939), 46.01% (432/939), and 42.81% (402/939), respectively. There were statistically significant differences in the implementation rates of differen personal protective measures among the workers by occupation and education level (P<0.05). Among them, workers with lower education levels had lower implementation rates for various protective measures. The results of logistic regression indicated that, compared to male workers, female workers (OR=2.26, 95%CI: 1.68, 3.04) showed a higher rate of non-standard implementation of personal protection. Using the age group of 18 to less than 36 years as a reference, those aged 36 to less than 60 years (OR=1.82, 95%CI: 1.33, 2.50) and 60 years or older (OR=4.45, 95%CI: 2.56, 7.73) reported higher rates of non-standard implementation of personal protection. Compared to those with an education level of primary school or below, those with a junior high school education (OR=0.64, 95%CI: 0.47, 0.88) and a high school education or above (OR=0.13, 95%CI: 0.19, 0.29) showed lower rates of non-standard implementation of personal protection. Compared to farmers, veterinarians (OR=0.03, 95%CI: 0.02, 0.07) reported the lowest rate of non-standard implementation of personal protection, followed by auxiliary workers (OR=0.08, 95%CI: 0.05, 0.12), breeders (OR=0.10, 95%CI: 0.07, 0.15), and other occupational groups (OR=0.28, 95%CI: 0.15, 0.52). Using large-scale farms as a reference, self-employed farmers (OR=13.5, 95%CI: 9.65, 18.88) reported a higher rate of non-standard implementation of personal protection, followed by workers from other workplaces (OR=3.63, 95%CI: 2.01, 6.54). Conclusion The implementation of personal protective measures among livestock workers in Xinjiang is generally satisfactory. However, significant disparities in the execution of these measures exist among different types of workers, indicating the need to enhance occupational health promotion to reduce the risk of zoonotic pathogen infection among the workers.

Pleomorphic adenoma arising from the torus tubarius of the nasopharynx is an extremely rare entity with limited epidemiological data and unclear etiological mechanisms. Its pathogenesis may be related to the eustachian tube salivary glands. Here we report an elderly female patient with a long history of snoring, hypernasal speech and epistaxis. Following comprehensive diagnostic evaluation, the patient underwent tumor resection under nasal endoscopy. There were no postoperative complications, the symptoms were significantly improved, and there was no obvious recurrence during the follow-up. We summarized the experience of diagnosis and treatment of giant pleomorphic adenoma of the tubal torus. The main treatment for tubal torus pleomorphic adenoma is complete surgical resection, with a good prognosis and a low recurrence rate.
Humans ; Female ; Adenoma, Pleomorphic/surgery* ; Aged ; Nasopharynx/pathology*

Objective:To investigate the potential characteristic manifestations and application value of the Dynamic Visual Acuity Test（DVAT） in vestibular migraine（VM）. Methods:A total of 50 VM patients（case group） and 50 healthy subjects（control group） diagnosed at the Department of Otorhinolaryngology Head and Neck Surgery, First Hospital of Shanxi Medical University between November 1, 2023, and December 31, 2024, were enrolled. The case group underwent DVAT, video head impulse test（vHIT）, caloric test, and Dizziness Handicap Inventory（DHI） assessment, whereas the control group only received DVAT. Group-based analyses were conducted to examine the effect of age on Dynamic Visual Acuity Loss（DVALoss）, as well as the correlations of DVALoss with vestibular function tests and DHI scores. Results:DVALoss in the case group was significantly higher than that in the control group（P<0.001）. In both groups, age was significantly and positively correlated with DVALoss（P<0.001）. Within the case group, DVALoss was strongly and positively correlated with DHI scores（r=0.807, P<0.001）; it was negatively correlated with the vestibulo-ocular reflex（VOR） gain in vHIT, though without clinical significance, and showed no significant association with the caloric test. Age and DVALoss collectively accounted for 71.3% of the variance in DHI scores（R²=0.713）, with age exerting a relatively minor actual impact. Conclusion:DVAT can sensitively identify the core functional impairments of VM. DVALoss, as a direct functional reflection of the pathological mechanism of VM, is strongly correlated with DHI scores. Incorporating DVALoss into standardized assessments may provide an objective basis for the diagnosis and management of VM.
Humans ; Migraine Disorders/diagnosis* ; Visual Acuity ; Case-Control Studies ; Head Impulse Test ; Vestibular Function Tests ; Female ; Male ; Adult ; Vestibular Diseases/physiopathology* ; Middle Aged ; Caloric Tests

Background Animal farming may affect the structure and diversity of gut microbiota of farm workers, but it needs more studies to provide solid evidence. Objective To analyze the diversity characteristics of gut microbiota in dairy farm workers, dairy cows, and the control population (non-animal contact occupational group), and to assess the impact of dairy farming on the gut microbiota of workers. Methods The 16S rRNA full-length amplicon sequencing technology was used to sequence 60 fecal samples from dairy farm workers, 89 from dairy cows, and 50 from the general population. The gut microbiota structure characteristics, including operational taxonomic units (OTUs), alpha diversity, beta diversity, and the composition of species at the phylum, family, and genus levels were analyzed. The differences in gut microbiota among the three groups of samples were compared to explore the impact of occupational exposure on the gut microbiota structure of dairy farm workers. Results A total of 50478 OTUs were identified in the gut microbiota of farm workers, dairy cows, and the general population, with 23613, 42723, and 16592 OTUs, respectively. The number of shared OTUs between the dairy cows and the general population was 12674 (27.17%), between the general population and the farm workers was 10099 (33.54%), and between the dairy cows and the farm workers was 17690 (36.36%). Compared with the general population, the farm workers and dairy cows showed more shared gut microbiota (P<0.01). The abundance of Firmicutes in the gut of the farm workers was higher than that of the general population (P<0.01), while Actinobacteriota and Proteobacteria were the opposite (P<0.01). The alpha diversity of gut microbiota in the farm workers was different from that of the general population. The ACE index of the farm workers was slightly lower than that of the general population and much lower than that of dairy cows (P<0.05), while their Shannon index was higher than that of the general population but lower than that of dairy cows (P<0.01). The linear discriminant analysis effect size (LefSe) showed that the abundances of Lachnospiraceae and Ruminococcaceae in the gut microbiota of the farm workers were significantly higher than those of the general population, while Streptococcaceae, Lactobacillaceae, Bifidobacteriaceae, Enterobacteriaceae, and Erysipelatoclostridiaceae were lower than those of the general population. Conclusion The dairy farm workers shares a certain proportion of common bacterial communities with dairy cows. Dairy farming operations can affect the structure and diversity of the gut microbiota of workers by increasing the abundances of Lachnospiraceae and Ruminococcaceae, while decreasing the abundances of Streptococcaceae, Lactobacillaceae, Bifidobacteriaceae, Enterobacteriaceae, and Erysipelatoclostridiaceae. The study results provide reference data for further exploring the cross-host transmission of pathogens related to occupational exposure in dairy farming.

Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.