Vascular endothelial growth factor (VEGF) inhibitors are drugs that target and inhibit tumor angiogenesis. By blocking the signaling pathway of VEGF and its receptor, they suppress tumor proliferation and play a crucial role in tumor treatment. However, their side effects, such as hypertension, proteinuria, hand-foot skin reactions, and myelosuppression, during treatment seriously affect patients' treatment compliance and quality of life. The development of intervention strategies for the side effects of VEGF inhibitors is of great importance for tumor treatment. This article reviews the clinical characteristics and toxic mechanisms of common side effects caused by VEGF inhibitors during tumor treatment and summarizes intervention strategies that combine traditional Chinese and Western medicines. Drug dosages were precisely monitored and adjusted to achieve antitumor treatment. Patients' discomfort symptoms are improved through prescriptions that act by tonifying qi and promoting blood circulation, strengthening the spleen, and tonifying the kidney. The combination of traditional Chinese and Western medicines is used to treat patients, thus providing a safe and effective treatment plan for patients with cancer.

Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.

Objective:To construct a sizeable naive human Fab phage display antibody library to screen high-affinity specific antibodies in vitro. Methods:Total RNA was extracted from peripheral blood mononuclear cells (PBMCs) of 126 healthy individuals, subsequently reverse-transcribed into cDNA, and used as a template. PCR amplification was performed to obtain the V H from IgG, IgM and light chain κ, λ, separately, with the initial PCR products serving as templates for a second round of PCR. Overlap extension PCR was employed to generate fragments of the κ and λ light chains. These fragments were ligated with the phage vector pNC3, which harbors the variable region 1 of the heavy chain, to construct a recombinant phage plasmid. This plasmid was then electroporated into competent Escherichia Coli TG1 cells to establish a naive human Fab phage display antibody library. One hundred clones were randomly selected for identification and sequencing, and antibody gene polymorphisms were analyzed using the IMGT database and MAFFT software. Recombinant α-hemolysin from Staphylococcus aureus was utilized to screen Fab antibody fragments through biopanning of the antibody library, followed by random selection of phage ELISA-identified clones. The positive clones (antigen A450∶blank control A450≥2.1) were sequenced. Results:Two large naive Fab phage display antibody libraries were successfully constructed, in which the capacity of κ and λ chain antibody libraries were 1.25×10 11 and 1.54×10 11, respectively. The titers for two antibody libraries were 6.04×10 13 CFU/ml and 3.50×10 13 CFU/ml. The positive transformation insertion rates for κ and λ chain antibody libraries were 96% (96/100) and 100% (100/100), respectively. Sequence analysis revealed that all antibody sequences were unique. The amino acid sequences in the skeletal region were relatively conserved. In contrast, significant variations in the length of the complementarity determining region (CDR) were found, and the diversity of amino acid sequence of the complementary determining region was high, especially the CDR3. Analysis using the IMGT database indicated that the sequences exhibited a broad distribution across variable-diversity-joining gene families. After six rounds of panning, specific phage antibodies enrichment targeting α-hemolysin were achieved. A total of 142 monoclonal antibodies were sequenced, yielding 8 distinct Fab antibody sequences. Conclusion:This study successfully constructed two naive human Fab phage display antibody libraries with large capacity and good diversity, which can be used for screening human antibodies for serum epidemiology.

Aim To investigates whether sphingosine-1-phosphate(S1P)regulates the expression of mitochon-drial calcium uniporter(MCU)via the sphingosine-1-phosphate receptor/proline-rich tyrosine kinase 2(S1PR/Pyk2)sig-naling pathway,thereby reducing oxidative stress-induced mitochondrial damage and inhibiting mitochondria-related apopto-sis.Methods Human umbilical vein endothelial cells(HUVEC)were subjected to oxidative damage using hydrogen peroxide(H2O2)as a model.Different concentrations of S1P were applied to the oxidative damaged HUVEC.Addi-tionally,the S1PR1 agonist SEW2871,the S1PR1 inhibitor W146,and the Pyk2 inhibitor PF-562271 were used to explore the specific mechanism of S1P action.Results S1P treatment significantly alleviated oxidative damage in HUVEC and was accompanied by an increase in S1PR1 expression(P<0.05),while S1PR3 expression remained unchanged.Mean-while,the expression levels of Pyk2 and MCU decreased(P<0.05).SEW2871 further reduced mitochondrial damage,whereas W146 exacerbated it(P<0.05).Furthermore,the application of the Pyk2 inhibitor PF-562271 also reduced H2O2-induced mitochondrial damage(P<0.05),further confirming the role of Pyk2 in this process.Conclusion S1P reduces H2O2-induced mitochondrial damage and inhibits mitochondria-related apoptosis in HUVEC by suppressing Pyk2 expression via S1PR1.

Objective To investigate the effects of high-frequency repetitive transcranial magnetic stimulation(HF-rTMS)applied to the supplementary motor area(SMA)or primary motor cortex(M1)on upper limb function in stroke patients in terms of motor sequence learning.Methods From April,2024 to February,2025,60 inpatients were recruited from the First Affiliated Hospital with Nan-jing Medical University.They were randomly assigned into the control group,SMA group and M1 group,with 20 patients in each group.All the groups received medication and conventional rehabilitation.On this basis,SMA group underwent HF-rTMS on the affected side's SMA,while M1 group received HF-rTMS on the affected side's M1 for two weeks.All the groups were measured with motor evoked potentials(MEP),the serial reaction time(RT)task,Fugl-Meyer Assessment-Upper Extremities(FMA-UE)and modified Barthel Index(MBI)before and after intervention.Results The SMA and M1 groups dropped one case respectively.MEP elicitation rate of the affected side's increased in SMA and M1 groups(P<0.05),and it was better than that in the control group(χ2>4.792,P<0.05).The intra-group effects of RTsequential sequence,FMA-UE and MBI scores were significant(|F|>81.546,P<0.05).The inter-group effects of RTrandom sequence,RTsequential sequence,?RT,and MBI scores were significant(F>3.228,P<0.05).The in-teractive effects of RTrandom sequence,RTsequential sequence,?RT,FMA-UE and MBI scores were significant(|F|>3.520,P>0.05).After intervention,RTsequential sequence,?RT,FMA-UE and MBI scores improved(P<0.05).RTrandom sequence was lower in SMA group than in the control group(P<0.017),RTsequential sequence,?RT,FMA-UE and MBI scores im-proved more in SMA and M1 groups than in the control group(P<0.05),but no significant difference was found between the SMA group and the M1 group(P>0.05).Conclusion HF-rTMS applied to the affected SMA or M1 can activate motor sequence learning and promote the recov-ery of upper limb function in stroke patients.

Objective:To explore dynamic changes of CD4+T lymphocytes in peripheral blood of patients with bronchial asthma at different periods and its correlation with control level.Methods:A total of 108 patients with bronchial asthma who received medical treatment in Beijing Jishuitan Hospital,Capital Medical University from September 2020 to October 2022 were selected as study objects,and CD4+T level in peripheral blood of patients with asthma at different periods were compared.According to control level,patients were divided into control group(n=68)and uncontrolled group(n=40).Factors affecting control level of patients with bronchial asthma were analyzed,and prediction model of column graph was constructed and evaluated.Results:CD4+T level in periph-eral blood of patients with acute attack of bronchial asthma was significantly lower than that in chronic duration stage and clinical control stage,CD8+T and CD3+T levels were significantly higher than that in chronic duration stage and clinical control stage(P<0.05).Allergic rhinitis,smoking history,acute respiratory tract infection and residential air pollution were uncontrolled risk factors of patients with bronchial asthma,CD4+T and regular use of inhaled corticosteroids were protective factors(P<0.05).The above indexes were used to construct a line chart model.After internal verification(Bootstrap resamplage 1 000 times),it was found that AUC of this model was 0.845(95%CI:0.734～0.885),sensitivity and specificity were 85.7%and 88.6%,respectively.Conclusion:CD4+T lymphocytes in peripheral blood of patients with acute asthma are significantly lower than patients with chronic asthma and healthy people.Allergic rhinitis,smoking history,acute respiratory tract infection and residential air pollution are uncontrolled risk factors of patients with bronchial asthma,CD4+T and regular use of inhaled corticosteroids are protective factors.

Purpose To investigate the functional connectivity(FC)pattern between the bilateral lower limb sensorimotor cortex(LSM)and the whole brain in type 2 diabetic peripheral neuropathy(DPN).Materials and Methods A total of 44 DPN patients and 43 healthy controls admitted to Shaanxi Provincial People's Hospital from February 2021 to December 2022 were enrolled prospectively and underwent neuropsychological assessment and resting-state fMRI scans.Using bilateral LSM as the regions of interest,the differences of bilateral LSM and whole brain FC between DPN patients and healthy controls were compared.FC in different brain areas were extracted and correlated with clinical/neuropsychological scores.Results Compared with healthy controls,DPN patients had reduced FC of the LSM with the right cerebellar lobule Ⅵ,the right lateral occipitotemporal cortex,the bilateral rostral prefrontal cortex and the bilateral anterior cingulate gyrus.The FC between LSM and right cerebellar Ⅵ in DPN patients were significantly negatively correlated with fasting blood glucose(r=-0.490,P=0.001).The FC between LSM and bilateral anterior cingulate gyrus in DPN patients were significantly positively correlated with Montreal cognitive assessment scores(r=0.479,P=0.001).Conclusion Abnormal FC between LSM and multiple brain regions,suggesting that DPN may have extensive effects on brain regions that maintain motion and motor control function in type 2 diabetes mellitus patients.

Objective Piperazine derivatives are a group of emerging psychoactive substances with excitatory and hallucinogenic effects on the central nervous system.This study established a high-performance liquid chromatography-tandem mass spectrometry(HPLC-MS/MS)screening method for the detection of 40 piperazine compounds in urine.Methods A 200 μL urine sample(spiked with an internal standard at 1 ng/mL)was subjected to liquid-liquid extraction with ethyl acetate.After nitrogen evaporation,the residue was redissolved in 200 μL methanol and injected for analysis.Separation was performed on a Waters Acquity UPLC? HSS T3 column(100 mm × 2.1 mm,1.8 μm).The mobile phase consisted of(A)20 mmol/L ammonium acetate buffer containing 0.1％formic acid and 5％acetonitrile,and(B)acetonitrile.Gradient elution was applied,and detection was carried out in multiple reaction monitoring(MRM)mode.Quantification was achieved using an internal standard calibration curve.Results The 40 piperazine substances demonstrated good linearity within the range of 1-50 ng/mL,with correlation coefficients of 0.995-0.998.The extraction recovery ranged from 51.51％to 104.1％.Intra-day precision was below 5％,while inter-day precision ranged from 1.61％to 10.17％.Accuracy was between-7.84％and 8.77％.The limits of detection were 0.2-1 ng/mL,and the limit of quantification was 1 ng/mL.Conclusion The proposed method requires only a small sample volume,exhibits high sensitivity,selectivity,and stability,and offers short run times.It is suitable for the qualitative and quantitative determination of piperazine derivatives in urine in forensic toxicology practice.

ObjectiveTo investigate the mechanism of Naoxintong capsules on ischemia-reperfusion （I/R） injury in rats based on the changes of pericytes mediated by Ras homolog family member A （RHOA）/Rho-associated coiled-coil containing protein kinase 1 （ROCK1） pathway. MethodsNinety rats （15 rats for each group） were randomly divided into a sham operation group， a model group， a positive control group receiving Ginkgo biloba extract （21.6 mg·kg^-1）， and groups receiving Naoxintong capsules at low， medium， and high doses of 55， 110， and 220 mg·kg^-1 （NXT-L， NXT-M， and NXT-H groups）， respectively. Except for those in the sham operation group， all rats were subjected to transient middle cerebral artery occlusion （tMCAO） to establish the experiment model. Nerve function was assessed using a neurological function score. Cerebral blood flow was detected using a laser speckle contrast imager， and the cerebral infarction rate was calculated using 2，3，5-Triphenyl tetrazolium chloride （TTC） staining. Pathological changes were observed by hematoxylin-eosin （HE） staining and Nissl staining， while pericyte morphology was observed via transmission electron microscopy. Blood-brain barrier destruction was observed by Evans blue staining. Albumin and ischemia-modified albumin levels were measured using assay kits. Real-time fluorescence quantitative polymerase chain reaction （Real-time PCR） and Western blot were used to detect the mRNA and protein expression levels of RHOA， ROCK1， platelet-derived growth factor receptor β （PDGFRB）， α-smooth muscle actin （α-SMA）， tight junction protein （ZO-1）， matrix metalloproteinase-2 （MMP-2）， and matrix metalloproteinase-9 （MMP-9）. ResultsCompared with the sham operation group， the model group exhibited decreased neurological function scores， higher percentage reduction in blood flow， and increased cerebral infarction rates （P<0.01）. Additionally， cortical neuronal nucleus shrinkage， edema， a decreased number of Nissl bodies， reduced pericyte area， elevated albumin content in the cortex （P<0.05）， and increased ischemic modified albumin levels （P<0.01） were observed. The mRNA and protein expression levels of RHOA， ROCK1， PDGFRB， α-SMA， MMP-2， and MMP-9 were increased （P<0.01）， while those of ZO-1 were decreased. Compared with the model group， all treatment groups showed improved neurological function scores， lower percentage reduction in blood flow， reduced cerebral infarction rates （P<0.01）， alleviated cortical histological changes， increased number of Nissl bodies， expanded pericyte area， decreased albumin content in the cortex， and reduced ischemia-modified albumin levels （P<0.01）. The mRNA and protein expression levels of RHOA， ROCK1， PDGFRB， α-SMA， MMP-2， and MMP-9 were decreased （P<0.01）， while those of ZO-1 were increased. Among the treatment groups， the NXT-M group showed the most pronounced improvement in cerebral I/R injury. ConclusionNaoxintong capsules can restore cerebral blood supply， reduce microcirculation disturbance， and protect blood-brain barrier in rats with I/R injury. Its mechanism of action may be related to the inhibition of the RHOA/ROCK1 signaling pathway and reduced pericyte contraction.

ObjectiveTo investigate the mechanism of Naoxintong capsules on ischemia-reperfusion （I/R） injury in rats based on the changes of pericytes mediated by Ras homolog family member A （RHOA）/Rho-associated coiled-coil containing protein kinase 1 （ROCK1） pathway. MethodsNinety rats （15 rats for each group） were randomly divided into a sham operation group， a model group， a positive control group receiving Ginkgo biloba extract （21.6 mg·kg^-1）， and groups receiving Naoxintong capsules at low， medium， and high doses of 55， 110， and 220 mg·kg^-1 （NXT-L， NXT-M， and NXT-H groups）， respectively. Except for those in the sham operation group， all rats were subjected to transient middle cerebral artery occlusion （tMCAO） to establish the experiment model. Nerve function was assessed using a neurological function score. Cerebral blood flow was detected using a laser speckle contrast imager， and the cerebral infarction rate was calculated using 2，3，5-Triphenyl tetrazolium chloride （TTC） staining. Pathological changes were observed by hematoxylin-eosin （HE） staining and Nissl staining， while pericyte morphology was observed via transmission electron microscopy. Blood-brain barrier destruction was observed by Evans blue staining. Albumin and ischemia-modified albumin levels were measured using assay kits. Real-time fluorescence quantitative polymerase chain reaction （Real-time PCR） and Western blot were used to detect the mRNA and protein expression levels of RHOA， ROCK1， platelet-derived growth factor receptor β （PDGFRB）， α-smooth muscle actin （α-SMA）， tight junction protein （ZO-1）， matrix metalloproteinase-2 （MMP-2）， and matrix metalloproteinase-9 （MMP-9）. ResultsCompared with the sham operation group， the model group exhibited decreased neurological function scores， higher percentage reduction in blood flow， and increased cerebral infarction rates （P<0.01）. Additionally， cortical neuronal nucleus shrinkage， edema， a decreased number of Nissl bodies， reduced pericyte area， elevated albumin content in the cortex （P<0.05）， and increased ischemic modified albumin levels （P<0.01） were observed. The mRNA and protein expression levels of RHOA， ROCK1， PDGFRB， α-SMA， MMP-2， and MMP-9 were increased （P<0.01）， while those of ZO-1 were decreased. Compared with the model group， all treatment groups showed improved neurological function scores， lower percentage reduction in blood flow， reduced cerebral infarction rates （P<0.01）， alleviated cortical histological changes， increased number of Nissl bodies， expanded pericyte area， decreased albumin content in the cortex， and reduced ischemia-modified albumin levels （P<0.01）. The mRNA and protein expression levels of RHOA， ROCK1， PDGFRB， α-SMA， MMP-2， and MMP-9 were decreased （P<0.01）， while those of ZO-1 were increased. Among the treatment groups， the NXT-M group showed the most pronounced improvement in cerebral I/R injury. ConclusionNaoxintong capsules can restore cerebral blood supply， reduce microcirculation disturbance， and protect blood-brain barrier in rats with I/R injury. Its mechanism of action may be related to the inhibition of the RHOA/ROCK1 signaling pathway and reduced pericyte contraction.