1.Effects of bioactive peptides combined with probiotics on serum uric acid in patients with hyperuricemia
HAN Dan ; ZHAO Ya ; HUANG Enshan ; YE Shuhua ; WANG Wanjin ; WU Fangmin ; WANG Dingliang ; ZHANG Ronghua
Journal of Preventive Medicine 2025;37(1):40-45
Objective:
To evaluate the effect of bioactive peptides combined with probiotics on serum uric acid (SUA) in patients with hyperuricemia (HUA), so as to provide the evidence for prevention and treatment of HUA.
Methods:
The patients with HUA aged 18 to 65 years were selected and randomly divided into an intervention group and a control group. The patients in the intervention group received bioactive peptides combined with probiotics for 28 days at a dose of 3 g/d, while the patients in the control group received an equal dose of placebos. Demographic information, body mass index (BMI), blood pressure and blood lipid were collected through questionnaire surveys, physical examination and laboratory tests. SUA levels were detected before and after 14 days and 28 days of interventions. The differences of SUA levels between the two groups were compared using generalized estimation equation.
Results:
Totally 108 patients with HUA were recruited, including 54 patients in the intervention group and 53 patients in the control group (1 dropout). Before interventions, there were no statistically significant differences in gender, age, course of HUA, exercise duration, frequency of alcohol consumption, frequency of meat broth consumption, BMI, prevalence of hypertension and prevalence of dyslipidemia between the two groups (all P>0.05). After 14 days of interventions, the SUA levels of the patients in the intervention group decreased by 3.00 μmol/L, while those in the control group increased by 7.00 μmol/L. After 28 days of interventions, the SUA levels of the patients in the intervention group and the control group decreased by 26.00 μmol/L and 16.00 μmol/L, respectively. However, there was no statistically significant interaction between the intervention time and group (both P>0.05). Subgroup analysis showed that after 28 days of interventions, the decrease in SUA levels in the patients aged 55 years and older and without hypertension in the intervention group was greater than those in the control group (both P<0.05).
Conclusions
Bioactive peptides combined with probiotics showed no significant difference in reducing SUA levels in patients with HUA compared to the control group. The effect was more significant for patients aged 55 years and older and without hypertension.
2.Molecular study of a case with variant of RHCE*ce allele in haplotype dce resulting in weakened e antigen
Yongkui KONG ; Hecai YANG ; Ming SHAO ; Yinghui CHEN-LI ; Wanjin ZHANG ; Xiaoyan ZHANG ; Jing WANG ; Xianping LYU ; Qiankun YANG
Chinese Journal of Medical Genetics 2024;41(9):1039-1044
Objective:To explore the RH genotype for a female with RhD(-) blood type and its molecular basis. Methods:A 26-year-old female who had attended the outpatient clinic of the First Affiliated Hospital of Zhengzhou University in August 2019 was selected as the study subject. Peripheral blood samples were collected from the proband and her parents for Rh phenotyping with gel card method. PCR-sequence-based typing (PCR-SBT) and DNA sequencing were used to determine the RHD zygosity and RH genotype of the proband and her parents. Homology modeling of Rh proteins was performed with bioinformatic software, and protein structural alterations caused by the variant was simulated by molecular dynamics. This study was approved by the Medical Ethics Committee of the First Affiliated Hospital of Zhengzhou University (Ethics No. 2023-KY-0870-003). Results:Serological tests showed that the proband and her father both had weakened e antigen of the Rh phenotype. PCR-SBT and DNA sequencing showed that the genotypes of the proband and her parents were dce/ dCE, dce/ DcE and dCE/ DcE, respectively. And the genotypes of the RHD and RHCE of the proband were RHD*01N.01/ RHD*01N.16, RHCE*01.01/RHCE*04, respectively. Protein simulation and molecular dynamics analysis revealed that the ce_16C variant resulted from RHCE* ce (c.48G>C) may alter the structure of intracellular and extracellular loops, mainly affecting the mobility of extracellular loops 2, 6 and intracellular loops 3, 4. Conclusion:Variant of the RHCE* ce allele c. 48G>C probably underlay the weakened e antigen in this proband.
3.Study on blood components and blood lipid regulation mechanism of Coreopsis tinctoria Nutt. flavones based on UPLC-Q-Exactive Orbitrap MS combined with network pharmacology
Qian CAO ; Shengli WEI ; Jingyi ZHANG ; Wanjin CHEN ; Yue WANG ; Weixian SHAO ; Yuan ZHANG
Journal of Beijing University of Traditional Chinese Medicine 2024;47(8):1089-1099
Objective To investigate the potential active ingredients and the mechanism of Coreopsis tinctoria Nutt. in the prevention and treatment of hyperlipidemia. Methods Ultra-high performance liquid chromatography-Quadrupole-Exactive Orbitrap mass spectrometry (UPLC-Q-Exactive Orbitrap MS) was used to qualitatively analyze the fractions and blood components of flavones in Coreopsis tinctoria Nutt. The intersection targets of flavones in Coreopsis tinctoria Nutt. and hyperlipidemia were screened,and the protein-protein interaction network was constructed and analyzed by the STRING 12.0 database. Finally,the gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) were used for enrichment analysis. Results A total of 25 compounds were detected from the flavones in Coreopsis tinctoria Nutt.,and their structures were identified,including ten chalcones,nine flavanones,four flavonols,one aurone,and one biflavone. The analysis of blood components showed that marein,flavanomarein,okanin,isookanin and 5,7,3',5'-tetrahydroxyflavanone-7-O-β-D-glucopyranoside were the main components of the flavones in Coreopsis tinctoria Nutt. in blood. Network pharmacological GO and KEGG enrichment analysis showed that the flavones in Coreopsis tinctoria Nutt. may regulate phosphatidylinositol 3-kinase/protein kinase B,tumor necrosis factor,hypoxia-inducible factor-1 signaling pathway and other signaling pathways in the regulation and prevention of hyperlipidemia. Conclusion Coreopsis tinctoria Nutt. can prevent and treat hyperlipidemia,and the mechanism may be related to the five blood components of the flavones in Coreopsis tinctoria Nutt.,including marein,flavanomarein,okanin,isookanin and 5,7,3',5'-tetrahydroxyflavanone-7-O-β-D-glucopyranoside.
4.From dark matter to fertile ground: the application and prospects of non-coding genomic regions in the diagnosis and treatment of neurogenetic disorders
Shirui GAN ; Kang YANG ; Wanjin CHEN ; Ning WANG
Chinese Journal of Neurology 2024;57(5):413-418
In recent years, the field of genetics has witnessed a burgeoning interest in the non-coding region, an area previously dubbed the"dark matter"of the genome. This once enigmatic domain is now progressively revealing its secrets, emerging as a rich terrain for genetic diagnosis and treatment. This editorial centers on diverse diagnostic analyses and intervention techniques associated with the non-coding region, delving into its significance in the etiology, diagnosis, and treatment of both monogenic and polygenic disorders within the nervous system. In doing so, it offers a comprehensive perspective for the exploration of genetic disorders in the nervous system.
5.Analysis of Clinical Trials of Nasal Sprays Registration in China in the Past 10 Years
ZHANG Wanjin ; WANG Qian ; LI Gang ; ZHANG Jingchen
Chinese Journal of Modern Applied Pharmacy 2023;40(20):2860-2864
OBJECTIVE To analyze the current situation and characteristics of clinical trials of nasal spray registration in China in the past 10 years, and to discuss the future development trend of nasal spray drugs in China, taking into account the current situation of international research. METHODS By accessing the State Drug Administration's drug clinical trial registration and information disclosure platform(http://www.chinadrugtrials.org.cn/index.html), collected information on clinical trials of nasal spray drugs in China from the open registration date(November 1, 2012) to March 29, 2023, in terms of clinical trial status, analyzed the status and characteristics of clinical trials of nasal sprays in terms of clinical trial status, indications, geographical distribution and trial phases, and trial design types by Microsoft Office Excel. RESULTS A total of 80 clinical trials of nasal sprays were conducted in China, of which 24 (30.0%) were phase I, 15 (18.8%) were phase II, 13(16.3%) were phase III, 3(3.8%) were phase IV, 17(21.3%) were bioequivalence trials, and 8(10.0%) were other(pharmacokinetic/pharmacodynamic studies). The status of clinical trials included 13(16.3%) in progress(not yet enrolled), 7(8.8%) in progress (enrollment completed), 15(18.8%) in progress (enrollment in progress), 44(55.0%) completed, and 1(1.3%) voluntarily terminated. There were 56 phase I-IV clinical trials, including 41(73.2%) parallel group trials, 14(25.0%) crossover design trials, and 1(1.8%) single-arm trial. A total of 65(81.3%) were chemicals, 7(8.8%) were biologics and 8(10.0%) were traditional Chinese medicine/natural drugs. A total of 15 indications were identified, which included allergic rhinitis, sedation, dry eye, paroxysmal supraventricular tachycardia, etc. CONCLUSION The research and development of nasal sprays in China is still at an early stage, but it keeps up with the international and independent innovation ability is being strengthened, and more new clinical research directions and strategies of nasal sprays should be explored in the future to help the development of nasal sprays and meet the needs of more patients.
6.The strategy and prospect of gene therapy in neurogenetic diseases
Ning WANG ; Miao ZHAO ; Wanjin CHEN
Chinese Journal of Neurology 2018;51(11):857-862
Most of the neurogenetic disorders could not be cured until now. With the development of molecular biological techniques, gene therapies show brilliant application prospects in neurogenetic disorders, which contain gene supplementation, exon skipping, splicing enhancement, dynamic mutation correction and toxic expression product elimination, and so on.
7.Effects of Compound Kushen Tang on Ulcerative Colitis in Rats and the Underlying Mechanism
Chengzhi ZHOU ; Nan JIANG ; Conghui ZHOU ; Wanjin SUN ; Wei SUN ; Xiulan WANG ; Tianmi ZHU ; Songtao WU ; Jia YANG ; Xueyun DUAN ; Heng FAN
China Pharmacist 2016;19(10):1816-1820
Objective: To investigate the therapeutic effects of compound Kushen Tang and its relevant mechanism in TNBS-in-duced ulcerative colitis ( UC) rats. Methods:UC was induced by TNBS in rats. After compound Kushen Tang was given orally, the levels of MDA, iNOS, and NO and the activity of MPO, SOD, and GSH-Px were measured. The general condition of rats and colon tissue morphology were observed. Results:The levels of MDA (P<0. 05), iNOS (P<0. 01) and NO (P<0. 01) and the activity of MPO (P<0. 01) in tissues of UC rats were significantly higher than the control group. The activity of SOD (P<0. 01) and GSH-Px (P<0. 05) were significantly lower than those in the control group. After the treatment with high doses of compound Kushen Tang, the levels of MPO (P<0. 01), MDA (P<0. 05), iNOS (P<0. 05) and NO (P<0. 01) were significantly decreased, and the activity of SOD (P<0. 01) and GSH-Px (P<0. 05) significantly increased. The therapeutic effect was dose-dependent and the general con-dition of rats and colon tissue morphology were also significantly improved. Conclusion:Compound Kushen Tang is considered as a no-vel therapeutic alternatives for the treatment of UC, which can reduce coloni inflammatory injury and ameliorate the colitis.
8.Distribution characteristics and influencing factors of children with allergic rhinitis in a domestic dust mites allergens content distribution characteristics and influencing factors.
Dong JI ; Xiaozhong GUI ; Wanjin JIANG ; Qin WANG
Journal of Clinical Otorhinolaryngology Head and Neck Surgery 2015;29(5):407-409
OBJECTIVE:
To observe the household environment dust mites allergens content distribution characteristics and influence factors of children with allergic rhinitis to dust mites in Wuhu.
METHOD:
Collect the surface dust in bedroom and living room floor, mattresses, pillows, sofa of 102 children with allergic rhinitis families. Dust mite allergen components 1 (Der f1) and house dust mites allergens 1 components (Der p1) of the dust samples were determined by enzyme-linked immunosorbent assay (ELISA).
RESULT:
One hundred and twenty samples were collected . In a domestic dust mites samples, with a median of M (Min and Max) said dust mite allergen levels, Der f1 and Der p1 content was 2.66 (0.03, 26.63), 3.48 (0, 03, 33.68), respectively. Der f1 was significantly less than Der p1, and the difference was statistically significant (P < 0.05). According to the classification of urban and township, there were 68 cases and 34 cases. Der f1 content in the samples was 2.91 (0.31, 26.63), 2.40 (0.08, 16.02), respectively. Der p1 content was 4.28 (0.03, 20.77), 3.88 (0.14, 33.68), respectively. The dust mites content of urban was significantly more than that of villages and towns, the difference was statistically significant (P < 0.05). Samples were also classified by gender. The dust mites allergens content in either boy's or girl's family were similar, there was no statistically significant difference (P > 0.05).
CONCLUSION
The household dust mites of children allergic rhinitisin Wuhu area is given priority to with Der p1, and urban dust mites are significantly more than village's and town's. Enhancing health education, controlling dust mites allergens contamination inside the bedroom, especially urban areas, are positive differences for the prevention and treatment of allergic diseases such as allergic rhinitis in children.
Allergens
;
analysis
;
Animals
;
Antigens, Dermatophagoides
;
analysis
;
Arthropod Proteins
;
analysis
;
Bedding and Linens
;
Child
;
Cysteine Endopeptidases
;
analysis
;
Dermatophagoides farinae
;
Dust
;
analysis
;
Enzyme-Linked Immunosorbent Assay
;
Female
;
Humans
;
Male
;
Rhinitis, Allergic
;
epidemiology
9.Rapid diagnosis of hereditary neuropathy with liability to pressure palsies by multiplex ligation-dependent probe amplification
Wanjin CHEN ; Danni WANG ; Jin HE ; Liuqing XU ; Wei HU ; Ning WANG
Chinese Journal of Neurology 2015;48(1):23-27
Objective To introduce the application of multiplex ligation-dependent probe amplification (MLPA) assays in the diagnosis of patients with hereditary neuropathy with liability to pressure palsies (HNPP).Methods Copy numbers of the exons in peripheral myelin prolein 22 (PMP22) gene,tektin 3 (TEKT3) gene and cytochrome c oxidase assembly protein 10 (COX10) gene were analyzed by MLPA in 8 patients diagnosed with HNPP clinically and 5 normal controls.Results Among the 8 patients,7 patients were identified to have deletion mutations according to their reduced peak area of PMP22 gene,TEKT3 gene and COX10 gene compared with that of normal controls.One patient with normal peak area of PMP22 gene,TEKT3 gene and COX10 gene showed no deletion of these genes.Conclusions MLPA assays can detect the copy numbers of genes in HNPP region through semi-quantitative analysis in a rapid,accurate way,which may be utilized widely in the genetic diagnosis among HNPP patients.
10.Detection of duplication mutation and carriers of Duchenne/Becker muscular dystrophy by multiplex ligation-dependent probe amplification quantitative
Qifang LIN ; Wanjin CHEN ; Ning WANG ; Zhiying WU ; Minting LIN ; Shenxing MURONG
Chinese Journal of Neurology 2011;44(8):568-573
Objective To analyze the dystrophin gene in patients with Duchenne/Becker muscular dystrophy (DMD/BMD) and their family members by multiplex ligation-dependent probe amplification (MLPA) method and to evaluate the application of this method in the mutations detection. Methods The whole dystrophin gene (79 exons) was analyzed by MLPA in 355 patients with DMD/BMD, the mothers of 46 patients with deletion mutation and the mothers of 8 patients with duplication mutation. The results were verified by PCR and sequencing when single exon deletion was found. Results One hundred and ninety cases were found to have deletion of one or more dystrophin exons, and 34 patients were identified to have duplication mutations. In 46 mothers of patients with deletion mutations, 28 were identified the mutations;and of 8 mothers of patients with duplication mutations, 6 were identified the mutations. There was no statistical significance between the carrier incidences in the 2 groups. A 23 bp deletion of AGGGAACAGATCCTGGTAAAGCA fragment in exon 17 was found in a patient. Conclusions Comparing with the traditional quantitative methods, MLPA can detect the deletion and duplication mutation in all the 79 exons of dystrophin gene in DMD/BMD patients, and can identify the carrier status in their family members. Furthermore, MLPA is not apt to be interfered by the concentration and purity of DNA template.


Result Analysis
Print
Save
E-mail