AIM: To evaluate the postoperative clinical efficacy of non-diffractive extended depth of focus intraocular lens(EDOF IOL)in patients with highly myopic cataract(HMC).METHODS:A retrospective analysis was conducted on the clinical data of patients diagnosed with HMC at the hospital from January 2022 to December 2024. Patients were divided into an observation group [undergoing femtosecond laser-assisted cataract surgery(FLACS)combined with non-diffractive EDOF IOL implantation] and a control group(undergoing FLACS combined with aspheric monofocal IOL implantation)according to the type of implanted IOL. Postoperative visual acuity(LogMAR), visual quality, and patient satisfaction were compared between the two groups.RESULTS: A total of 33 patients(47 eyes)were finally included in this study, including 10 patients(17 eyes)in the observation group and 23 patients(30 eyes)in the control group. The observation group had a median age of 59.0(52.8, 63.8)y, with 8 males(13 eyes)and 2 females(4 eyes). The control group had a median age of 56.0(53.5, 60.0)y, with 13 males(17 eyes)and 10 females(13 eyes). At 3 mo postoperatively, the best-corrected distance visual acuity(BCDVA)was 0.10(0.08, 0.12)in the observation group and 0.20(0.10, 0.40)in the control group(P=0.586). However, the best-corrected intermediate visual acuity(BCIVA)[0.10(0.10, 0.10)vs 0.50(0.40, 0.90), P=0.032] and best-corrected near visual acuity(BCNVA)[0.20(0.18, 0.20)vs 0.60(0.45, 1.45), P=0.044] in the observation group were significantly better than those in the control group. The defocus curve showed that the uncorrected visual acuity(UCVA)in the observation group was relatively stable within the range of -2.00 to +1.00 D, which was superior to that in the control group. Postoperative questionnaires showed that the spectacle independence rate(76%)and overall satisfaction(88%)in the observation group were significantly higher than those in the control group(10% and 60%, respectively).CONCLUSION: Non-diffractive EDOF IOL significantly improves intermediate and near visual acuity, reduces spectacle dependence, and maintains distance visual acuity by extending the depth of focus, providing better postoperative visual quality and life satisfaction for HMC patients.

ObjectiveTo construct lentiviral vectors that interferes with the expression of sphingosine-1-phosphate receptor 1(S1 PR1) and stably transfect the lentiviral vectors into THP-1 cells, in order to study the effect of S1 PR1 on macrophage function and the mechanism of S1 PR1 in tumor development at the cellular level.MethodsAccording to the sequence of S1 PR1 gene(1901) registered in NCBI database, three pairs of primers were designed for the shRNA sequence of this gene. The target gene was amplified by PCR, inserted into vector pLKO.1-puro, and the corresponding lentiviral plasmids were constructed,which were identified by enzymatic digestion electrophoresis and sequencing. The correct lentiviral vector plasmids were named pLKO.1-S1 PR1-shRNA1, pLKO.1-S1 PR1-shRNA2, and pLKO.1-S1 PR1-shRNA3, and the vector pLKO.1-puro containing stuffer sequence was used as control(named pLKO.1-S1 PR1-shNC). The lentiviral vector plasmids and lentivirus packaging plasmids were co-transfected into 293T cells for virus packaging, and the titer of virus solution was determined after concentration. The screening concentration of puromycin(0, 0. 5, 1. 0, 1. 5, 2. 0, 2. 5 μg/mL), culture time(0, 24, 48, 72 h)and MOI(10, 20, 30, 40, 50) of THP-1 cells were determined. THP-1 cells were infected with the lentivirus under the optimum conditions and screened by puromycin. The relative mRNA and protein expression of S1 PR1 in THP-1 cells of each group were detected by RT-qPCR and Western blot respectively.ResultsEnzymatic digestion electrophoresis identification and sequencing indicated that pLKO.1-S1 PR1-shRNA1, pLKO.1-S1 PR1-shRNA2, and pLKO.1-S1 PR1-shRNA3 lentiviral vectors were correctly constructed. The lentivirus titers of shNC, shRNA1, shRNA2 and shRNA3 groups were 9. 5 × 10~9, 4. 25 × 10~9,2 × 10~9 and 4. 4 × 10~9 TU/mL, respectively. THP-1 cells were infected with the lentivirus at the optimum MOI of 50 for 72 h.After screening with 1. 5 μg/mL puromycin, the relative expression levels of S1 PR1 mRNA in shRNA1, shRNA2 and shRNA3 groups were significantly lower than that in shNC group(F = 44. 916, P < 0. 001); the relative expression level of S1 PR1 protein in shRNA1 group decreased with no significant difference(t = 1. 921, P > 0. 05), while the relative expression levels of S1 PR1 protein in shRNA2 and shRNA3 groups decreased significantly(t = 8. 730 and 6. 957, respectively, each P < 0. 05).ConclusionThe lentiviral vectors interfering with S1 PR1 expression and THP-1 cell lines stably expressing the vectors were successfully constructed, which can be used for further related research.

It is very limited that the benefit of perioperative chemotherapy in early non-small cell lung cancer (NSCLC), and the 5-year survival rate is only 5% higher than surgery. Antibodies that block programmed cell death protein 1/programmed death-ligand 1 significantly improve the survival of advanced NSCLC. The value of immunotherapy in early NSCLC is also being explored. This paper firstly summarized and analyzed the progress of immunotherapy in the perioperative period of NSCLC. Secondly, the safety and feasibility of surgical resection after neoadjuvant immunotherapy were discussed. Finally, the clinical value of different therapeutic efficacy prediction indicators was summarized, in order to clarify the current status of immunotherapy in the perioperative period, so as to improve the clinical benefits of early NSCLC patients.

Objective: To understand the awareness of chikungunya fever knowledge and its related factors among medical college students in Baise City, so as to provide a scientific basis to offer relevant courses and special education. Methods: From July to August 2025, 7 286 enrolled medical students were selected by a sampling method from a medical college in Baise City to participate in the questionnaire survey. The questionnaire covered epidemiological characteristics, clinical symptoms, and prevention/control knowledge of chikungunya fever. Statistical analyses including the Chi quare test and multivariate Logistic regression models were performed. Results: The overall awareness rate of chikungunya fever knowledge among the medical students was 18.89%. Among the knowledge items, the awareness rate of "the high incidence season" was the highest (84.05%), while that of "the infectious period" was the lowest (17.80%). Multivariate Logistic regression analysis showed that medical students with female (a OR= 1.37 , 95%CI =1.20- 1.57 ), the age for over 25 years old (a OR=1.76, 95%CI =1.05-2.93), whose father had a middle school educational level (a OR=1.18, 95%CI =1.05-1.31), and majored in preventive medicine (a OR=1.54, 95%CI =1.10-1.67) had relatively higher awareness rates of chikungunya fever knowledge (all P <0.05). In contrast, students of Zhuang ethnicity (a OR= 0.87 , 95%CI =0.76-0.98) and majoring in nursing (a OR=0.74, 95%CI =0.61-0.91) or pharmacy (a OR=0.70, 95%CI =0.52-0.95) had relatively lower awareness rates (all P <0.05). Conclusions The awareness rate of chikungunya fever related knowledge among medical college students in Baise City is relatively low. Schools should take targeted publicity measures to improve medical students awareness.

Traditional Chinese medicine （TCM） diagnostics is a discipline that studies the basic theories and fundamental skills of diagnostic methods， disease diagnosis， and differentiation in accordance with the theories of TCM. The artificial intelligence （AI） technology has gained remarkable achievements in the intelligentization of the four diagnostic methods in TCM and the standardization of differentiation and diagnosis. However， it still faces many challenges. The standardization of clinical data collection is difficult， and the data quality is uneven， which affects the usability of the data. The integration of the four diagnostic information is insufficient. Most instruments can only collect data from a single diagnostic method， lacking overall integrity. The scientific nature of the diagnostic model needs to be improved. The existing models lack dynamics and the reasoning logic of TCM differentiation. The accuracy of intelligent methods needs to be improved， and the existing evaluation indicators cannot fully reflect the practical application effect of the model. Furthermore， the relevant laws and regulations are still not perfect， and data security and patient privacy lack guarantees. The cultivation of compound talents is insufficient， and there is a lack of interdisciplinary talents who are proficient in both TCM and AI. On this basis， this paper expounded on the current development status， difficulties， and bottlenecks of AI in TCM diagnosis and then explored the development trend of AI in the field of TCM diagnosis. It proposed solutions such as optimizing the data collection process， constructing multimodal diagnostic models， facilitating multi-disciplinary exchanges and cooperation， improving laws and regulations， and cultivating compound talents. It is hoped that modern， standardized， normalized， and intelligent TCM diagnosis can be further promoted， thereby providing new impetus and methods for the inheritance and innovation of TCM.

ObjectiveTo investigate the potential mechanism of Danggui Buxuetang （DBT） in the treatment of vascular dementia （VAD）. MethodsSixty male SD rats were randomly assigned to the sham-operated group， model group， DBT low-， medium-， and high-dose groups， and the donepezil group. Except for the sham-operated group， rats in all other groups underwent bilateral common carotid artery ligation. After successful modeling， DBT was administered at doses of 9.2， 18.4， 36.8 g·kg^-1 for the low-， medium-， and high-dose groups， respectively， while the donepezil group received 3 mg·kg^-1 donepezil solution by gavage once daily. After 4 consecutive weeks of drug treatment， rats underwent the Morris water maze test， novel object recognition test， Nissl staining to observe hippocampal neurons， and immunofluorescence staining to detect the expression of neuronal nuclear protein （NeuN） in the hippocampus. Western blot was used to assess the expression of PTEN-induced kinase 1 （PINK1）， Parkin， microtubule-associated protein 1 light chain 3Ⅱ （LC3Ⅱ）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax）. Transmission electron microscopy was used to observe hippocampal neuronal ultrastructure. Real-time PCR was used to detect the expression of NADPH oxidase subunits p22^phox and p47^phox in hippocampal tissues. The levels of malondialdehyde （MDA）， glutathione （GSH）， superoxide dismutase （SOD）， and total antioxidant capacity were measured to evaluate oxidative stress levels. ResultsIn the Morris water maze test， escape latency changed significantly over time in all groups except the model group. Compared with the sham-operated group， the model group showed significantly prolonged escape latency （P<0.01）. Compared with the model group， rats in the DBT groups and the donepezil group exhibited significantly shorter escape latency （P<0.05， P<0.01）. The number of crossings over the original platform was significantly reduced in the model group compared with the sham-operated group （P<0.01）， whereas rats in the DBT and donepezil groups showed significantly increased platform crossings compared with the model group （P<0.05， P<0.01）. Compared with the sham-operated group， exploration time of new objects was significantly reduced in the model group （P<0.01）. Compared with the model group， exploration time of new objects increased significantly in the medium- and high-dose DBT groups and the donepezil group （P<0.05， P<0.01）， while no significant change was observed in the low-dose DBT group. Compared with the high-dose DBT group， rats in the donepezil group had significantly prolonged escape latency and reduced platform crossings and new-object exploration time （P<0.05）. Nissl staining showed decreased density of healthy neurons in the CA1 and CA3 regions of the hippocampus in the model group， with loss of Nissl bodies and nuclear atrophy or disappearance. In the high-dose DBT group， neuronal density in CA1 and CA3 increased， with neurons arranged closely and displaying normal morphology. Immunofluorescence showed that compared with the sham-operated group， the hippocampal NeuN⁺ cell count in the VAD model group was significantly decreased（P<0.01）， compared with the VAD model group， the hippocampal NeuN⁺ cell count in the high-dose DBT group was significantly increased（P<0.01）. Compared with the sham-operated group， the expression of PINK1， Parkin， LC3Ⅱ， and Bax proteins was significantly increased（P<0.01）， while the expression of Bcl-2 was significantly decreased in the VAD model group（P<0.01）. Compared with the VAD model group， the high-dose DBT group showed significantly decreased expression of PINK1， Parkin， LC3Ⅱ， and Bax proteins（P<0.01）and significantly upregulated Bcl-2 expression（P<0.01）. The medium-dose DBT group exhibited significantly reduced expression of Parkin， LC3Ⅱ， and Bax proteins（P<0.05，P<0.01） and significantly increased Bcl-2 expression（P<0.01）， while no statistically significant differences were observed in the low-dose DBT group. Transmission electron microscopy showed mitochondrial pyknosis， thickened cristae， increased electron density， and the presence of mitochondrial autophagy in the model group. In contrast， hippocampal neurons in the high-dose DBT group contained abundant mitochondria with intact morphology， clear cristae， and uniform matrix. Compared with the sham-operated group， total antioxidant capacity， SOD activity， and GSH levels were significantly decreased， while MDA levels were significantly increased in the model group （P<0.01）. Compared with the model group， total antioxidant capacity and antioxidant levels （SOD， GSH） increased significantly， and MDA decreased significantly in the medium- and high-dose DBT groups （P<0.01）， while no significant changes were observed in the low-dose DBT group. Compared with the sham-operated group， mRNA expression of p22^phox and p47^phox was significantly increased in the model group （P<0.01）. Compared with the model group， expression of p22^phox and p47^phox was significantly decreased in the DBT groups （P<0.05， P<0.01）. ConclusionDBT may exert neuroprotective effects by regulating PINK1/Parkin-mediated mitochondrial autophagy， thereby improving learning and memory abilities and treating VAD.

ObjectiveTo observe the effect of Qishao capsules on renal injury in db/db mice with diabetic kidney disease （DKD），and explore its mechanism of protecting the kidney by inhibiting podocyte apoptosis. Methodsdb/m mice （7 mice） were used as the normal group，and db/db mice （35 mice） were randomly divided into a model group，a dapagliflozin group （0.001 g·kg^-1·d^-1），and low-，medium-，and high-dose groups of Qishao capsules （0.341 3，0.682 5，and 1.365 g·kg^-1·d^-1，respectively）. Drug intervention lasted for 8 consecutive weeks. After sampling，the serum renal function indicators ［creatinine（SCr），and urea nitrogen（BUN）］，fasting blood glucose （FBG），24 h urinary protein quantification （24 h-UTP）， and other indicators of the mice were measured. The pathological tissue morphology of the kidney was observed by periodic acid-silver methenamine （PASM） and Masson's trichrome （Masson） staining. Immunohistochemical detection of cysteine-dependent aspartate-specific protease （Caspase）-3 and B-cell lymphoma 2 （Bcl-2） was performed. Western blot was used to detect the protein expression of Caspase-8，Caspase-7，Caspase-3， and other molecules. Terminal deoxynucleotidyl transferase dUTP nick End labeling （TUNEL） staining was used to observe apoptosis in renal tissue. Immunofluorescence staining of Wilms tumor suppressor gene-1 （WT-1） was used to observe podocyte injury. Real-time polymerase chain reaction （Real-time PCR） was employed to detect Caspase-8 and Caspase-3 mRNA expression in the kidneys of experimental mice. Data analysis was conducted using statistical software GraphPad Prism 10. ResultsCompared with the normal group，the model group showed significantly increased 24 h-UTP，SCr，BUN，and FBG （P<0.01）. Additionally， PASM staining of renal tissue showed increased glycogen deposition，glomerular hypertrophy，and thickening of the basement membrane. Masson staining showed collagen fiber proliferation in renal tissue. Transmission electron microscopy showed thickening of the renal tissue basement membrane and fusion or loss of foot processes in the model group. The immunohistochemical results showed that Caspase-3 in the kidneys of the mice in the model group significantly increased （P<0.01），while the Bcl-2 protein expression level decreased significantly （P<0.01）. The number of TUNEL positive cells in renal tissue significantly increased （P<0.01）. The positive expression of WT-1 in podocytes was significantly reduced （P<0.01）. Western blot analysis showed significant upregulation of Caspase-8，Caspase-7，and Caspase-3 protein expression in renal tissue （P<0.01）. The mRNA expression levels of Caspase-8 and Caspase-3 in the kidneys increased significantly （P<0.01）. Compared with the model group，the Qishao capsules groups can significantly reduce the levels of 24 h-UTP，SCr，BUN，and FBG （P<0.01）. The pathological damage of renal tissue and podocyte injury were improved to some extent. Immunohistochemistry in the kidney showed a significant decrease in Caspase-3 （P<0.01） and a significant increase in Bcl-2 protein expression level （P<0.01）. Additionally， there were a significant decrease in the number of TUNEL positive cells in renal tissue （P<0.01），a significant increase in WT-1 positive expression in podocytes （P<0.01），marked downregulation of Caspase-8，Caspase-7，and Caspase-3 protein expression in renal tissue （P<0.05，P<0.01），and a significant decrease in Caspase-8 and Caspase-3 mRNA expression levels （P<0.01）. ConclusionQishao capsules can inhibit podocyte apoptosis by regulating the expression of Caspase-8，Caspase-7， and Caspase-3，thereby improving the diabetic renal injury in db/db mice.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

AIM: To compare the preoperative ocular biometry between Pentacam AXL and IOL Master 700 in cataract patients.METHODS:Prospective study. A total of 150 patients(150 eyes)with cataracts who were treated in our hospital from May to December 2024 were selected. The IOL Master 700 and Pentacam AXL were preoperatively used to measure axial length(AL), corneal curvature(K1, K2 and Km), anterior chamber depth(ACD), and white-to-white(WTW). The difference and consistency of the results of the two instruments were compared.RESULTS: There was no significant difference between the two instruments in the AL, K1, K2, Km, ACD, and WTW(all P>0.05). The Spearman correlation analysis showed that the two instruments positively correlated with the AL, K1, K2, Km, ACD and WTW of the operated eye(all P<0.001). The Bland-Altman analysis showed that for the Pentacam AXL and IOL Master 700, there were 5/150(3.3%), 7/150(4.7%), 4/150(2.7%), 5/150(3.3%), and 0 points outside the 95%LoA for the AL, K1, K2, Km, ACD, and WTW of the examined eyes, respectively, with all of these values less than 5%, indicating good consistency.CONCLUSION:The AL, K1, K2, Km, ACD and WTW of Pentacam AXL and IOL Master 700 in cataract patients before cataract phacoemulsification combined with IOL implantation show no significant differences, and have good correlation and consistency. The two instruments can be used interchangeably.

ObjectiveTo evaluate the impact of yang-reinforcing and blood-activating therapy on the long-term prognosis for patients with dilated cardiomyopathy （DCM） of yang deficiency and blood stasis syndrome. MethodsA retrospective cohort study was conducted involving 371 DCM patients with yang deficiency and blood stasis syndrome. The yang-reinforcing and blood-activating therapy was defined as the exposure factor. Patients were categorized into exposure group （186 cases） and non-exposure group （185 cases） according to whether they received yang-reinforcing and blood-activating therapy combined with conventional western medicine for 6 months or longer. The follow-up period was set at 48 months， and the Kaplan-Meier survival analysis was used to assess the cumulative incidence of major adverse cardiovascular events （MACE） in both groups. Cox regression analysis was used to explore the impact of yang-reinforcing and blood-activating therapy on the risk of MACE， and subgroup analysis was performed. Changes in traditional Chinese medicine （TCM） syndrome score， left ventricular ejection fraction （LVEF）， left ventricular fractional shortening （LVFS）， left ventricular end-diastolic diameter （LVEDD）， and Minnesota Living with Heart Failure Questionnaire （MLHFQ） score were compared between groups at the time of first combined use of yang-reinforcing and blood-activating therapy （before treatment） and 1 year after receiving the therapy （after treatment）. ResultsMACE occurred in 31 cases （16.67%） in the exposure group and 47 cases （25.41%） in the non-exposure group. The cumulative incidence of MACE in the exposure group was significantly lower than that in the non-exposure group ［HR=0.559， 95%CI（0.361，0.895）， P=0.014］. Cox regression analysis showed that yang-reinforcing and blood-activating therapy was an independent factor for reducing the risk of MACE in DCM patients ［HR=0.623， 95%CI（0.396，0.980）， P=0.041］， and consistent results were observed in different subgroups. Compared with pre-treatment， the exposure group showed decreased TCM syndrome score and MLHFQ score， reduced LVEDD， and increased LVEF and LVFS after treatment （P＜0.05）； in the non-exposure group， TCM syndrome score decreased， LVEF and LVFS increased， and LVEDD reduced after treatment （P＜0.05）. After treatment， the exposure group had higher LVEF and LVFS， smaller LVEDD， and lower TCM syndrome score and MLHFQ score compared with the non-exposure group （P＜0.05）. ConclusionCombining yang-reinforcing and blood-activating therapy with conventional western medicine can reduce the risk of MACE in DCM patients with yang deficiency and blood stasis syndrome， meanwhile improving their clinical symptoms， cardiac function， and quality of life.