ObjectiveTo observe the effect of Qishao capsules on renal injury in db/db mice with diabetic kidney disease （DKD），and explore its mechanism of protecting the kidney by inhibiting podocyte apoptosis. Methodsdb/m mice （7 mice） were used as the normal group，and db/db mice （35 mice） were randomly divided into a model group，a dapagliflozin group （0.001 g·kg^-1·d^-1），and low-，medium-，and high-dose groups of Qishao capsules （0.341 3，0.682 5，and 1.365 g·kg^-1·d^-1，respectively）. Drug intervention lasted for 8 consecutive weeks. After sampling，the serum renal function indicators ［creatinine（SCr），and urea nitrogen（BUN）］，fasting blood glucose （FBG），24 h urinary protein quantification （24 h-UTP）， and other indicators of the mice were measured. The pathological tissue morphology of the kidney was observed by periodic acid-silver methenamine （PASM） and Masson's trichrome （Masson） staining. Immunohistochemical detection of cysteine-dependent aspartate-specific protease （Caspase）-3 and B-cell lymphoma 2 （Bcl-2） was performed. Western blot was used to detect the protein expression of Caspase-8，Caspase-7，Caspase-3， and other molecules. Terminal deoxynucleotidyl transferase dUTP nick End labeling （TUNEL） staining was used to observe apoptosis in renal tissue. Immunofluorescence staining of Wilms tumor suppressor gene-1 （WT-1） was used to observe podocyte injury. Real-time polymerase chain reaction （Real-time PCR） was employed to detect Caspase-8 and Caspase-3 mRNA expression in the kidneys of experimental mice. Data analysis was conducted using statistical software GraphPad Prism 10. ResultsCompared with the normal group，the model group showed significantly increased 24 h-UTP，SCr，BUN，and FBG （P<0.01）. Additionally， PASM staining of renal tissue showed increased glycogen deposition，glomerular hypertrophy，and thickening of the basement membrane. Masson staining showed collagen fiber proliferation in renal tissue. Transmission electron microscopy showed thickening of the renal tissue basement membrane and fusion or loss of foot processes in the model group. The immunohistochemical results showed that Caspase-3 in the kidneys of the mice in the model group significantly increased （P<0.01），while the Bcl-2 protein expression level decreased significantly （P<0.01）. The number of TUNEL positive cells in renal tissue significantly increased （P<0.01）. The positive expression of WT-1 in podocytes was significantly reduced （P<0.01）. Western blot analysis showed significant upregulation of Caspase-8，Caspase-7，and Caspase-3 protein expression in renal tissue （P<0.01）. The mRNA expression levels of Caspase-8 and Caspase-3 in the kidneys increased significantly （P<0.01）. Compared with the model group，the Qishao capsules groups can significantly reduce the levels of 24 h-UTP，SCr，BUN，and FBG （P<0.01）. The pathological damage of renal tissue and podocyte injury were improved to some extent. Immunohistochemistry in the kidney showed a significant decrease in Caspase-3 （P<0.01） and a significant increase in Bcl-2 protein expression level （P<0.01）. Additionally， there were a significant decrease in the number of TUNEL positive cells in renal tissue （P<0.01），a significant increase in WT-1 positive expression in podocytes （P<0.01），marked downregulation of Caspase-8，Caspase-7，and Caspase-3 protein expression in renal tissue （P<0.05，P<0.01），and a significant decrease in Caspase-8 and Caspase-3 mRNA expression levels （P<0.01）. ConclusionQishao capsules can inhibit podocyte apoptosis by regulating the expression of Caspase-8，Caspase-7， and Caspase-3，thereby improving the diabetic renal injury in db/db mice.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo evaluate the impact of yang-reinforcing and blood-activating therapy on the long-term prognosis for patients with dilated cardiomyopathy （DCM） of yang deficiency and blood stasis syndrome. MethodsA retrospective cohort study was conducted involving 371 DCM patients with yang deficiency and blood stasis syndrome. The yang-reinforcing and blood-activating therapy was defined as the exposure factor. Patients were categorized into exposure group （186 cases） and non-exposure group （185 cases） according to whether they received yang-reinforcing and blood-activating therapy combined with conventional western medicine for 6 months or longer. The follow-up period was set at 48 months， and the Kaplan-Meier survival analysis was used to assess the cumulative incidence of major adverse cardiovascular events （MACE） in both groups. Cox regression analysis was used to explore the impact of yang-reinforcing and blood-activating therapy on the risk of MACE， and subgroup analysis was performed. Changes in traditional Chinese medicine （TCM） syndrome score， left ventricular ejection fraction （LVEF）， left ventricular fractional shortening （LVFS）， left ventricular end-diastolic diameter （LVEDD）， and Minnesota Living with Heart Failure Questionnaire （MLHFQ） score were compared between groups at the time of first combined use of yang-reinforcing and blood-activating therapy （before treatment） and 1 year after receiving the therapy （after treatment）. ResultsMACE occurred in 31 cases （16.67%） in the exposure group and 47 cases （25.41%） in the non-exposure group. The cumulative incidence of MACE in the exposure group was significantly lower than that in the non-exposure group ［HR=0.559， 95%CI（0.361，0.895）， P=0.014］. Cox regression analysis showed that yang-reinforcing and blood-activating therapy was an independent factor for reducing the risk of MACE in DCM patients ［HR=0.623， 95%CI（0.396，0.980）， P=0.041］， and consistent results were observed in different subgroups. Compared with pre-treatment， the exposure group showed decreased TCM syndrome score and MLHFQ score， reduced LVEDD， and increased LVEF and LVFS after treatment （P＜0.05）； in the non-exposure group， TCM syndrome score decreased， LVEF and LVFS increased， and LVEDD reduced after treatment （P＜0.05）. After treatment， the exposure group had higher LVEF and LVFS， smaller LVEDD， and lower TCM syndrome score and MLHFQ score compared with the non-exposure group （P＜0.05）. ConclusionCombining yang-reinforcing and blood-activating therapy with conventional western medicine can reduce the risk of MACE in DCM patients with yang deficiency and blood stasis syndrome， meanwhile improving their clinical symptoms， cardiac function， and quality of life.

Objective : To investigate the biomechanical effect of alveolar bone graft (ABG) resorption on the maxillary alveolar process under occlusal force in a patient with unilateral cleft lip and palate (UCLP) and provide evidence for the clinical application of ABG. Methods: A 3D finite element maxillary model of an 11-year-old female patient with UCLP was generated. The occlusal force was applied to six models with different ABG resorption, namely non-resorption, upper 1/3 resorption, upper 2/3 resorption, lower 1/3 resorption, lower 2/3 resorption, and upper&lower 1/3 resorption. The properties of structures in all models were set to be linear, elastic, and isotropic. The displacement and Von Mises stress of each reference node of the alveolar process were compared and analyzed. Results: Under occlusal force, the most significant displacement of the alveolar process was located in the anterior area, and it decreased gradually from anterior area to both sides in all groups. The displacement values of the alveolar process under cleft side lateral occlusion were as follows: non-resorption group < lower 2/3 resorption group < upper&lower 1/3 resorption group < lower 1/3 resorption group < upper 2/3 resorption group < upper 1/3 resorption group. The displacement values of the alveolar process under centric occlusion were as follows: non-resorption group < lower 1/3 resorption group < upper&lower 1/3 resorption group < upper 2/3 resorption group < lower 2/3 resorption group < upper 1/3 resorption group. The displacement values of the alveolar process under non-cleft side lateral occlusion were as follows: non-resorption group < lower 1/3 resorption group < upper 1/3 resorption group < lower 2/3 resorption group < upper&lower 1/3 resorption group < upper 2/3 resorption group. The stress was concentrated on the premolar area on the functional side of the alveolar process, followed by the canine and molar areas in all groups. The stress values of the alveolar process under cleft side lateral occlusion were as follows: non-resorption group < lower 2/3 resorption group < upper&lower 1/3 resorption group < upper 2/3 resorption group < lower 1/3 resorption group < upper 1/3 resorption group. The stress values of the alveolar process under centric occlusion were as follows: non-resorption group < upper 1/3 resorption group < lower 1/3 resorption group < lower 2/3 resorption group < upper&lower 1/3 resorption group < upper 2/3 resorption group. The stress values of the alveolar process under non-cleft side lateral occlusion were as follows: non-resorption group < lower 2/3 resorption group < upper&lower 1/3 resorption group < lower 1/3 resorption group < upper 2/3 resorption group < upper 1/3 resorption group. Under occlusal force, the displacement and stress of the alveolar process in the non-resorption model were significantly lower than those in other models. The displacement and stress of the alveolar process in the models with resorption in the lower area of the ABG were significantly lower than those in the models with resorption in the upper-middle areas of the ABG. Conclusion After unilateral complete cleft lip and palate bone grafting, the integrity and continuity of the middle and upper parts of the alveolar process bone grafting play a key role in the biomechanical status of the alveolar process. If bone resorption occurs in the above parts, bone grafting should be considered.

Jiegengtang is a basic formula for treating sore throat and cough. By means of bibliometrics， this study conducted a textual research and analysis on the key information such as formula origin， decocting methods， and clinical application of Jiegengtang. After the research， it can be seen that Jiegengtang is firstly contained in Treatise on Febrile and Miscellaneous Disease， which is also known as Ganjietang， and it has been inherited and innovated by medical practitioners of various dynasties in later times. The origins of Chinese medicines in this formula is basically clear， Jiegeng is the dried roots of Platycodon grandiflorum， Gancao is the dried roots and rhizomes of Glycyrrhiza uralensis， the two medicines are selected raw products. The dosage is 27.60 g of Glycyrrhizae Radix et Rhizoma and 13.80 g of Platycodonis Radix， decocted with 600 mL of water to 200 mL， taken warmly after meals， twice a day， 100 mL for each time. In ancient times， Jiegengtang was mainly used for treating Shaoyin-heat invasion syndrome， with cough and sore throat as its core symptoms. In modern clinical practice， Jiegengtang is mainly used for respiratory diseases such as pharyngitis， esophagitis， tonsillitis and lung abscess， especially for pharyngitis and lung abscess with remarkable efficacy. This paper can provide literature reference basis for the modern clinical application and new drug development of Jiegengtang.

The medicinal use of Malvae Semen has a long history. In this paper， by consulting the ancient materia medica， prescription， agronomy， literature and other aspects of the classics， the name， origin， evolution of scientific name， quality， harvesting and processing， functions and indications and others of Malvae Semen were systematically sorted out and verified， so as to provide a basis for the development and utilization of famous classical formulas containing this herb. According to the textual research， Shennong Bencaojing began to use Dongkuizi as the correct name， which was used in the past dynasties， and there were also aliases such as Kuicaizi， Huacai， and Kuizi. Through the original research， it can be seen that Kuicai is the mainstream original plant of Malvae Semen， that is， Malva verticillata var. crispa， the Alcea rosea and M. cathayensis are also used. In modern times， the seeds of Abutilon theophrasti have been passed off as Malvae Semen， while the seeds of M. verticillata var. crispa have rarely been used in medicine. And Abutili Semen has been another medicinal material with different efficacy since the collection of Newly Revised Materia Medica in the Tang dynasty. Since the Ming and Qing dynasties， the cultivation of Kuicai has been decreasing， while A. theophrasti is more common and easy to obtain， and Abutili Semen and Malvae Semen are similar in morphology and confused， which should be corrected. In addition， Malvae Fructus is a Mongolian customary medicinal herb， which is different from the traditional use of seeds in traditional Chinese medicine. Kuicai， as an important vegetable in history， was widely cultivated and gradually shrunk after the Song dynasty， it is now mainly produced in southern provinces. The quality evaluation of Malvae Semen is better for those with dry bodies， full grain， grayish brown color， no mud， and no impurities. The harvesting is generally in the autumn and winter. After drying， it is seeded， sieved peel and impurities， mashed， or slightly stir-fried to yellow-white color with gentle fire. It is sweet， cold and slippery in nature and taste， with the main effects of laxation， diuresis， lactation and elimination of swelling. The efficacy of Abutili Semen is clearing heat and removing toxicity， promoting diuresis and removing nebula， the efficacy is quite different from that of Malvae Semen. Based on the results of textual research， it is suggested that M. verticillata var. crispa should be used as the medicinal source of Malvae Semen in the development of famous classical formulas， the corresponding processing methods should be selected according to the requirements of drug processing in the formulas， while the raw products are recommended to be used if the processing is not specified.

Jiegengtang is a basic formula for treating sore throat and cough. By means of bibliometrics， this study conducted a textual research and analysis on the key information such as formula origin， decocting methods， and clinical application of Jiegengtang. After the research， it can be seen that Jiegengtang is firstly contained in Treatise on Febrile and Miscellaneous Disease， which is also known as Ganjietang， and it has been inherited and innovated by medical practitioners of various dynasties in later times. The origins of Chinese medicines in this formula is basically clear， Jiegeng is the dried roots of Platycodon grandiflorum， Gancao is the dried roots and rhizomes of Glycyrrhiza uralensis， the two medicines are selected raw products. The dosage is 27.60 g of Glycyrrhizae Radix et Rhizoma and 13.80 g of Platycodonis Radix， decocted with 600 mL of water to 200 mL， taken warmly after meals， twice a day， 100 mL for each time. In ancient times， Jiegengtang was mainly used for treating Shaoyin-heat invasion syndrome， with cough and sore throat as its core symptoms. In modern clinical practice， Jiegengtang is mainly used for respiratory diseases such as pharyngitis， esophagitis， tonsillitis and lung abscess， especially for pharyngitis and lung abscess with remarkable efficacy. This paper can provide literature reference basis for the modern clinical application and new drug development of Jiegengtang.

The medicinal use of Malvae Semen has a long history. In this paper， by consulting the ancient materia medica， prescription， agronomy， literature and other aspects of the classics， the name， origin， evolution of scientific name， quality， harvesting and processing， functions and indications and others of Malvae Semen were systematically sorted out and verified， so as to provide a basis for the development and utilization of famous classical formulas containing this herb. According to the textual research， Shennong Bencaojing began to use Dongkuizi as the correct name， which was used in the past dynasties， and there were also aliases such as Kuicaizi， Huacai， and Kuizi. Through the original research， it can be seen that Kuicai is the mainstream original plant of Malvae Semen， that is， Malva verticillata var. crispa， the Alcea rosea and M. cathayensis are also used. In modern times， the seeds of Abutilon theophrasti have been passed off as Malvae Semen， while the seeds of M. verticillata var. crispa have rarely been used in medicine. And Abutili Semen has been another medicinal material with different efficacy since the collection of Newly Revised Materia Medica in the Tang dynasty. Since the Ming and Qing dynasties， the cultivation of Kuicai has been decreasing， while A. theophrasti is more common and easy to obtain， and Abutili Semen and Malvae Semen are similar in morphology and confused， which should be corrected. In addition， Malvae Fructus is a Mongolian customary medicinal herb， which is different from the traditional use of seeds in traditional Chinese medicine. Kuicai， as an important vegetable in history， was widely cultivated and gradually shrunk after the Song dynasty， it is now mainly produced in southern provinces. The quality evaluation of Malvae Semen is better for those with dry bodies， full grain， grayish brown color， no mud， and no impurities. The harvesting is generally in the autumn and winter. After drying， it is seeded， sieved peel and impurities， mashed， or slightly stir-fried to yellow-white color with gentle fire. It is sweet， cold and slippery in nature and taste， with the main effects of laxation， diuresis， lactation and elimination of swelling. The efficacy of Abutili Semen is clearing heat and removing toxicity， promoting diuresis and removing nebula， the efficacy is quite different from that of Malvae Semen. Based on the results of textual research， it is suggested that M. verticillata var. crispa should be used as the medicinal source of Malvae Semen in the development of famous classical formulas， the corresponding processing methods should be selected according to the requirements of drug processing in the formulas， while the raw products are recommended to be used if the processing is not specified.

Objective : To investigate the antidepressant effects and the underlying mechanisms of tetrahydrocurcumin(THC) and its nanoparticle formulation(THCN). Methods : Forty-six male ICR mice were randomly divided into Con group, LPS group, THC group, THCN group and SER group. A mouse depression model was established by intraperitoneal administration of LPS. The anxiety and depression-like behaviors of mice were evaluated by open field test(OFT) and forced swimming test(FST). Myelin staining was applied to assess the extent of demyelination in the prefrontal cortex of the mice. The prefrontal cortex and hippocampus were further examined for the expression levels of glial fibrillary acidic protein(GFAP) and Toll-like receptor 4(TLR4) through quantitative immunofluorescence assays. Results : Compared with the Con group, the LPS group showed increased anxiety-like and depressive-like behaviors in both the long-term and short-term experiments(P<0.05); the degree of demyelination increased in the LPS group of the long-term experiment(P<0.01); the expression of GFAP was reduced in the LPS group of the short-term experiment(P<0.01), while the expression of TLR4 increased(P<0.05); the expression of TLR4 decreased in the THC group(P<0.01); the expression of GFAP in the prefrontal cortex of the THCN group was reduced(P<0.01), while the expression of TLR4 increased(P<0.05). Compared with the LPS group, the THC group showed reduced depressive-like behaviors in the long-term experiment(P<0.05), while the anxiety-like and depressive-like behaviors of the THCN group and the SER group were reduced(P<0.05), and the anxiety-like and depressive-like behaviors of the THC group and the THCN group were reduced in the short-term experiment(P<0.05); the degree of demyelination was reduced in the THC group, THCN group and SER group in the long-term experiment(P<0.05); the expression of GFAP increased in the THC group of the short-term experiment(P<0.05), while the expression of TLR4 was reduced(P<0.05), and the expression of GFAP increased in the THCN group(P<0.05). Compared with the THC group, the THCN group and the SER group showed reduced anxiety-like behaviors in the long-term experiment(P<0.05); the expression of GFAP in the prefrontal cortex of the THCN group was reduced in the short-term experiment(P<0.05), while the expression of TLR4 in the hippocampal DG area increased in the short-term experiment(P<0.01). Conclusion Tetrahydrocurcumin and its nanoparticle formulation both exert significant ameliorative effects on depression-like behaviors and demyelination in mice induced by lipopolysaccharide. The antidepressant mechanism of THC appears to be mediated through the down-regulation of TLR4 and the up-regulation of GFAP. The mechanism underlying the antidepressant action of THCN seems predominantly focused on the enhancement of GFAP expression.

ObjectiveTo explore effect of Xianlian Jiedu prescription on the recurrence of colorectal cancer （CRC） and investigate the related mechanisms. MethodsA postoperative recurrence model was established in 25 Balb/c mice by injecting CT26 cells subcutaneously into the armpit， followed by surgical removal of 99% of the subcutaneous tumor. The mice were randomly divided into model group， low-dose Xianlian Jiedu prescription （XLJDP-L） group （6.45 g·kg^-1·d^-1）， medium-dose Xianlian Jiedu prescription （XLJDP-M） group （12.9 g·kg^-1·d^-1）， high-dose Xianlian Jiedu prescription （XLJDP-H） group （25.8 g·kg^-1·d^-1）， and 5-fluorouracil （5-FU） group （1×10^-3 g·kg^-1·d^-1）. The mice were euthanized after 14 days of continuous intervention， and recurrent tumor tissue was harvested. Hematoxylin and eosin （HE） staining was used to observe pathological and morphological changes in the recurrent tumor tissue. Immunohistochemistry （IHC） was employed to assess the expression of proliferating cell nuclear antigen （Ki67）， vascular endothelial growth factor （VEGF）， and platelet-endothelial cell adhesion molecule （CD31） in recurrent tumor tissue. The Western blot was used to detect the protein expression levels of angiopoietin-2 （ANG-2）， VEGF， phosphorylated-protein kinase B （p-Akt）， protein kinase B （Akt）， phosphorylated-phosphatidylinositol 3-kinase （p-PI3K）， and phosphatidylinositol 3-kinase （PI3K） in recurrent tumor tissue. ResultsBefore treatment， there were no statistical differences in tumor volume， tumor weight， and body mass among the XLJDP-L， XLJDP-M， and XLJDP-H groups and the 5-FU group compared to the model group， indicating model stability. After treatment， compared with those in the model group， the tumor volume and tumor weight in the XLJDP-L， XLJDP-M， and XLJDP-H groups and the 5-FU group were significantly reduced （P<0.01）， showing dose dependency. Meanwhile， there were no significant differences in body weight among the XLJDP-L， XLJDP-M， and XLJDP-H groups and the 5-FU group compared to the model group. HE staining showed that compared with that in the model group， tumor tissue in the XLJDP-L， XLJDP-M， and XLJDP-H groups and the 5-FU group had loosely arranged cells， increased intercellular spaces， small and shriveled nuclei， light staining， fewer mitotic figures and atypical nuclei， and increased necrotic areas. IHC showed that compared with those of the model group， the positive rates of Ki67， VEGF， and CD31 in the recurrent tumor tissue of the XLJDP-L， XLJDP-M， and XLJDP-H groups and the 5-FU group were significantly reduced （P<0.01） in a dose-dependent manner. Western blot results showed that compared with those of the model group， the protein expression levels of ANG-2 and VEGF in the recurrent tumor tissue of the XLJDP-L， XLJDP-M， and XLJDP-H groups and the 5-FU group were significantly downregulated （P<0.05， P<0.01）， and the p-Akt/Akt and p-PI3K/PI3K ratios were significantly decreased in a dose-dependent manner （P<0.05， P<0.01）. ConclusionXianlian Jiedu prescription significantly inhibits the recurrence of CRC in mice after subcutaneous tumor surgery. The mechanism may involve regulating the PI3K/Akt pathway and downregulating key angiogenic proteins such as ANG-2， VEGF， and CD31.