1.Qishao Capsules Improve Diabetic Renal Injury in db/db Mice by Inhibiting Podocyte Apoptosis via Regulating Caspase-8 and Caspase-3
Jingwei LIU ; Zhenhua WU ; Bing YANG ; Fengwen YANG ; Miao TAN ; Tingting LI ; Jinchuan TAN
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(2):126-135
ObjectiveTo observe the effect of Qishao capsules on renal injury in db/db mice with diabetic kidney disease (DKD),and explore its mechanism of protecting the kidney by inhibiting podocyte apoptosis. Methodsdb/m mice (7 mice) were used as the normal group,and db/db mice (35 mice) were randomly divided into a model group,a dapagliflozin group (0.001 g·kg-1·d-1),and low-,medium-,and high-dose groups of Qishao capsules (0.341 3,0.682 5,and 1.365 g·kg-1·d-1,respectively). Drug intervention lasted for 8 consecutive weeks. After sampling,the serum renal function indicators [creatinine(SCr),and urea nitrogen(BUN)],fasting blood glucose (FBG),24 h urinary protein quantification (24 h-UTP), and other indicators of the mice were measured. The pathological tissue morphology of the kidney was observed by periodic acid-silver methenamine (PASM) and Masson's trichrome (Masson) staining. Immunohistochemical detection of cysteine-dependent aspartate-specific protease (Caspase)-3 and B-cell lymphoma 2 (Bcl-2) was performed. Western blot was used to detect the protein expression of Caspase-8,Caspase-7,Caspase-3, and other molecules. Terminal deoxynucleotidyl transferase dUTP nick End labeling (TUNEL) staining was used to observe apoptosis in renal tissue. Immunofluorescence staining of Wilms tumor suppressor gene-1
2.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
3.Effect of Yang-Reinforcing and Blood-Activating Therapy on the Long-Term Prognosis for Dilated Cardio-myopathy Patients with Yang Deficiency and Blood Stasis Syndrome:A Retrospective Cohort Study
Shiyi TAO ; Jun LI ; Lintong YU ; Ji WU ; Yuqing TAN ; Xiao XIA ; Fuyuan ZHANG ; Tiantian XUE ; Xuanchun HUANG
Journal of Traditional Chinese Medicine 2026;67(1):53-59
ObjectiveTo evaluate the impact of yang-reinforcing and blood-activating therapy on the long-term prognosis for patients with dilated cardiomyopathy (DCM) of yang deficiency and blood stasis syndrome. MethodsA retrospective cohort study was conducted involving 371 DCM patients with yang deficiency and blood stasis syndrome. The yang-reinforcing and blood-activating therapy was defined as the exposure factor. Patients were categorized into exposure group (186 cases) and non-exposure group (185 cases) according to whether they received yang-reinforcing and blood-activating therapy combined with conventional western medicine for 6 months or longer. The follow-up period was set at 48 months, and the Kaplan-Meier survival analysis was used to assess the cumulative incidence of major adverse cardiovascular events (MACE) in both groups. Cox regression analysis was used to explore the impact of yang-reinforcing and blood-activating therapy on the risk of MACE, and subgroup analysis was performed. Changes in traditional Chinese medicine (TCM) syndrome score, left ventricular ejection fraction (LVEF), left ventricular fractional shortening (LVFS), left ventricular end-diastolic diameter (LVEDD), and Minnesota Living with Heart Failure Questionnaire (MLHFQ) score were compared between groups at the time of first combined use of yang-reinforcing and blood-activating therapy (before treatment) and 1 year after receiving the therapy (after treatment). ResultsMACE occurred in 31 cases (16.67%) in the exposure group and 47 cases (25.41%) in the non-exposure group. The cumulative incidence of MACE in the exposure group was significantly lower than that in the non-exposure group [HR=0.559, 95%CI(0.361,0.895), P=0.014]. Cox regression analysis showed that yang-reinforcing and blood-activating therapy was an independent factor for reducing the risk of MACE in DCM patients [HR=0.623, 95%CI(0.396,0.980), P=0.041], and consistent results were observed in different subgroups. Compared with pre-treatment, the exposure group showed decreased TCM syndrome score and MLHFQ score, reduced LVEDD, and increased LVEF and LVFS after treatment (P<0.05); in the non-exposure group, TCM syndrome score decreased, LVEF and LVFS increased, and LVEDD reduced after treatment (P<0.05). After treatment, the exposure group had higher LVEF and LVFS, smaller LVEDD, and lower TCM syndrome score and MLHFQ score compared with the non-exposure group (P<0.05). ConclusionCombining yang-reinforcing and blood-activating therapy with conventional western medicine can reduce the risk of MACE in DCM patients with yang deficiency and blood stasis syndrome, meanwhile improving their clinical symptoms, cardiac function, and quality of life.
4.Study on the correlation between depressive state and autonomic dysfunction in patients with Parkinson's disease
Laixiu QIU ; Qiubi TANG ; Xiaolan ZENG ; Luxi LI ; Hongyu TAN
Journal of Public Health and Preventive Medicine 2026;37(1):112-115
Objective To investigate the depressive state of patients with Parkinson's disease (PD), and to analyze the correlation of depressive state with autonomic dysfunction. Methods A total of 327 patients with PD in the hospital were selected from March 2022 to March 2024. The depressive state was evaluated by Hamilton Depression Scale (HAMD). The autonomic nerve function was assessed using the Scale for Outcomes in PD for Autonomic Symptoms (SCOPA-AUT) and heart rate variability [standard deviation of sinus RR interval (SDNN), standard deviation of average sinus RR interval (SDANN), and percentage of successive NN interval differences above 50 ms (pNN50)]. According to the positive depression (HAMD>20 points), the patients were divided into a depression group and a non-depression group. The clinical data and autonomic nerve function indicators were compared between the two groups. Pearson correlation coefficient analysis was performed to analyze the correlation between depressive state and autonomic dysfunction in PD patients. Results The positive rate of depression in patients with PD was 31.19%. There were 102 patients in the depression group and 225 patients in the non-depression group. The years of education and the proportion of mild Hoehn-Yahr stage (H-Y stage) in the depression group were lower than those in the non-depression group, while the disease course was longer, and the Unified Parkinson's Disease Rating Scale (UPDRS) II score and UPDRS III score were higher than those in the non-depression group (P<0.05). The SCOPA-AUT score in the depression group was higher while the SDNN, SDANN and pNN50 were lower compared to the non-depression group (P<0.05). HAMD score was positively correlated with SCOPA-AUT score (r=0.685), and was negatively correlated with SDNN, SDANN and pNN50 (r=-0.578, -0.685, and -0.439) (P<0.05). Conclusion Depression is a common state among patients with PD, and its level is positively correlated with the severity of autonomic dysfunction in patients.
5.Flos Buddlejae self-heating steam eye mask combined with sodium hyaluronate eye drops in the treatment of dry eye disease
Zhaodan TAN ; Qian LI ; Yan SHI ; Kangyuan HU ; Jin HUANG
Journal of Pharmaceutical Practice and Service 2026;44(2):96-102
Objective To assess the clinical efficacy of sodium hyaluronate (0.3%) eye drops combined with herbal self-heating steam eye mask in the treatment of dry eye disease. Methods A prospective randomized controlled clinical trial was performed on 60 patients diagnosed with dry eye at the ophthalmic clinic of a Grade A, Class Ⅲ hospital in Shanghai from June 2023 to September 2024. Specifically, patients were randomly divided into control group and study group. Patients in the control group were treated with sodium hyaluronate (0.3%) eye drops for six weeks; while in the study group, patients received the eye drops combined with the herbal self-heating steam eye mask mainly containing powders of Flos Buddlejae. Subsequently, comparisons and analysis were performed before and after treatment between the two groups in the clinical symptom questionnaire score traditional Chinese medicine (TCM syndrome score),the Chinese dry eye questionnaire score and determination of tear film fluorscein breakup time (FBUT), and curative effect. Results The quality control standard of the herbal powder in the self-heating steam eye mask was established through TLC and HPLC, and good heating behavior of the herbal self-heating steam eye mask was ascertained heating temperature (43±5)℃; heating duration (≥20 min), meeting requirements of the product quality control. After treatment for 6 weeks, FBUT was increased, while TCM syndrome score and the Chinese dry eye questionnaire score were both decreased in the study group (P<0.001). Besides, compared with the control group, TCM syndrome score and the Chinese dry eye questionnaire score were much lower, while the FBUT were higher in the study group (P<0.001). Moreover, the overall response rate in the study group (81.7%) was much better than that in the control group (25.9%). Conclusion The combination of sodium hyaluronate (0.3%) eye drops with herbal self-heating steam eye mask could be applied to the clinical treatment of dry eye disease due to its good clinical effects on relieving dry eye symptoms.
6.A Review of Methods for Establishing and Evaluating Animal Models of Stroke
Yunrong YANG ; Wenyu WU ; Yue TAN ; Guofeng YAN ; Yao LI ; Jin LU
Laboratory Animal and Comparative Medicine 2026;46(1):94-106
Stroke is one of the leading causes of disability and mortality worldwide. Research into its mechanisms and the development of therapeutic strategies heavily rely on animal models that accurately replicate the pathological features of human disease. An ideal animal model for stroke should not only reproduce the neurological deficits and pathological changes observed in clinical patients but also demonstrate good reproducibility and translational value. This review focuses on the preparation and evaluation methods of ischemic stroke animal models. Firstly, it elaborates on the selection criteria, advantages, and disadvantages of experimental animals, including rodents (rats, mice) and non-rodents (non-human primates, miniature pigs, rabbits, zebrafish). Secondly, it provides a detailed overview of the modeling principles, key procedures, and application scopes for ischemic stroke models and hemorrhagic stroke models. Furthermore, the review summarizes advances in the applications of emerging technologies—including gene editing [e.g., clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing], multimodal imaging (e.g., two-photon microscopy, photoacoustic imaging), artificial intelligence, optogenetics, 3D bioprinting, organoid models, and multi-omics–in model optimization, precise assessment, and mechanistic investigation. Finally, based on a systematic analysis of relevant domestic and international literature from 2019 to 2024, this review discusses model selection strategies based on research objectives, a multidimensional evaluation system encompassing behavioral, imaging, and molecular pathological assessments, and envisions future directions involving technological integration to achieve model precision and individualization. This article aims to provide a comprehensive methodological reference to help researchers select appropriate animal models of stroke according to specific scientific questions.
7.Pharmacodynamic Substances and Mechanisms of Xinglou Chengqi Tang in Treating Post-stroke Complications: A Review
Yujin ZHANG ; Xiangzhuo LIU ; Zhouyang CHEN ; Zihao SONG ; Xinyi LIU ; Yizhi YAN ; Chaoya LI ; Yingyan FANG ; Shasha YANG ; Xueqin CHENG ; Zhou XIE ; Sijie TAN ; Peng ZENG ; Yue ZHANG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(1):327-337
Stroke is the leading cause of death and disability among adults in China, and its common complications include digestive system abnormalities, cognitive impairment, depression, stroke-associated pneumonia, and hemiplegia. The combination of traditional Chinese and Western medicine has great potential in treating post-stroke complications. Xinglou Chengqitang (XLCQT) is a representative prescription of alleviating the disease in the upper part by treating the lower part. It has definite therapeutic effect and high safety. Clinically, XLCQT is often used to treat stroke and its complications. However, the quantity and quality of clinical trials of XLCQT in treating post-stroke complications need to be improved. Additionally, since the basic research is weak, the material basis and multi-target mechanism for the efficacy of this prescription are unknown. This article reviews XLCQT in terms of the pharmacodynamic basis, medicinal properties, safety evaluation, and progress in clinical research and mechanisms in treating post-stroke complications. This article summarizes 22 key active ingredients of XLCQT in treating acute stroke complicated with syndrome of phlegm heat and fu-organ excess. Among these key active ingredients, resveratrol, kaempferol, luteolin, chrysoeriol, apigenin, (+)-catechin, and adenosine have good pharmacokinetic properties and high bioavailability. The mechanisms of XLCQT in treating post-stroke complications are complex, including inflammatory response, brain-gut axis, hypothalamic-pituitary-adrenal (HPA) axis, intestinal flora, neurotrophic factors, autophagy, oxidative stress, and free radical damage. This review helps to deeply understand the pharmacodynamic basis and mechanisms of XLCQT in treating post-stroke complications and provides a theoretical basis for the clinical application of XLCQT against post-stroke complications and the development of drugs.
8.Chufeng Yisuntang Ameliorates PM2.5-induced Dry Eye via ROS/p38 MAPK Signaling Pathway
Yuan ZHONG ; Pan ZHAO ; Shi TAN ; Yu TANG ; Dongdong LI ; Lihao CHEN ; Jun PENG ; Qinghua PENG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(7):191-200
ObjectiveTo establish a mouse model of particulate matter 2.5 (PM2.5)-induced dry eye and investigate whether Chufeng Yisuntang can ameliorate the PM2.5-induced ocular surface damage by regulating the reactive oxygen species (ROS)/p38 mitogen-activated protein kinase (p38 MAPK) signaling pathway. MethodsSixty 8-week-old male C57BL/6J mice were used. Ten were randomly selected as the control group. The remaining 50 mice received topical instillation of 1 drop (0.1 mL) of 5 g·L-1 PM2.5 suspension in both eyes, four times daily. Successfully modeled mice were randomized into four groups (n=10): Model, p38 MAPK inhibitor, Chufeng Yisuntang, and combination (Chufeng Yisuntang at 7.3 g·kg-1 + p38 MAPK inhibitor SB203580 at 5 mg·kg-1). Chufeng Yisuntang was administered via gavage, and the inhibitor group via intraperitoneal injection. The control and model groups received equal volumes of distilled water by gavage. All treatments lasted for 4 weeks. General conditions were dynamically observed. Tear secretion, tear film break-up time, and corneal fluorescein staining were assessed. After intervention for 4 weeks, hematoxylin and eosin (HE) staining was used to examine the histopathological changes. Enzyme-linked immunosorbent assay (ELISA) was adopted to measure serum levels of ROS, malondialdehyde (MDA), superoxide dismutase (SOD) 1, and SOD2. Western blot and Real-time PCR were employed to determine the protein and gene levels, respectively, of p38 MAPK, B-cell lymphoma-2 (Bcl-2), Bcl-2-associated X protein (Bax), and cysteinyl aspartate-specific proteinase-3 (Caspase-3) in the corneal tissue. ResultsCompared with the control group, the model group exhibited reduced tear secretion volume and tear film breakup time, along with increased corneal fluorescein staining scores (P<0.01). Compared with the model group, the Chufeng Yisuntang group, p38 MAPK inhibitor group, and combination group demonstrated increased tear secretion volume and tear film breakup time, along with decreased corneal fluorescein staining scores (P<0.01). HE staining revealed that compared with the control group, the model group exhibited marked increases in corneal epithelial cell layers and epithelial thickness, along with reduced meibomian gland acini and intensely stained, densely packed nuclei around the acini. Compared with the model group, the Chufeng Yisuntang group, p38 MAPK inhibitor group, and combination group showed intact corneal structure, improved cell morphology, and reduced damage severity. ELISA revealed elevated ROS and MDA levels (P<0.01) and decreased SOD1 and SOD2 levels (P<0.01) in the model group compared with the control group. Compared with the model group, Chufeng Yisuntang, p38 MAPK inhibitor, and the combination lowered ROS and MDA levels (P<0.01), while raising SOD1 and SOD2 levels (P<0.05, P<0.01). Western blot revealed that compared with the control group, the model group exhibited increased protein levels of p38 MAPK, Bax, and Caspase-3 (P<0.01) and reduced protein level of Bcl-2 (P<0.01). Compared with the model group, Chufeng Yisuntang, p38 MAPK inhibitor, and the combination down-regulated the protein levels of p38 MAPK, Bax, and Caspase-3 (P<0.01), while up-regulating the protein level of Bcl-2 (P<0.01). Compared with the Chufeng Yisuntang group, the combination group exhibited decreased protein levels of p38 MAPK, Bax, and Caspase-3 (P<0.01) and increased protein level of Bcl-2 (P<0.01). Real-time PCR revealed that compared with the control group, the model group exhibited upregulated mRNA levels of p38 MAPK, Bax, and Caspase-3 (P<0.01), and downregulated mRNA level of Bcl-2 (P<0.01). Compared with the model group, Chufeng Yisuntang, p38 MAPK inhibitor, and the combination down-regulated the mRNA levels of p38 MAPK, Bax, and Caspase-3 (P<0.01), while up-regulating the mRNA level of Bcl-2 (P<0.05, P<0.01). Compared with the Chufeng Yisuntang group, the combination group exhibited decreased mRNA levels of p38 MAPK, Bax, and Caspase-3 expression (P<0.05, P<0.01) and increased mRNA level of Bcl-2 (P<0.01). ConclusionChufeng Yisuntang may partially protect against PM2.5-induced corneal injury by inhibiting the ROS/p38 MAPK pathway, enhancing antioxidant defense, and reducing epithelial apoptosis.
9.Clinical effect of non-diffractive extended depth of focus IOL in patients with high myopia complicated with cataract
Yanhong JIA ; Xuemei LIANG ; Litao TAN ; Fang FU ; Yuanran PANG ; Kangming ZHU ; Li LI
International Eye Science 2026;26(4):700-705
AIM: To evaluate the postoperative clinical efficacy of non-diffractive extended depth of focus intraocular lens(EDOF IOL)in patients with highly myopic cataract(HMC).METHODS:A retrospective analysis was conducted on the clinical data of patients diagnosed with HMC at the hospital from January 2022 to December 2024. Patients were divided into an observation group [undergoing femtosecond laser-assisted cataract surgery(FLACS)combined with non-diffractive EDOF IOL implantation] and a control group(undergoing FLACS combined with aspheric monofocal IOL implantation)according to the type of implanted IOL. Postoperative visual acuity(LogMAR), visual quality, and patient satisfaction were compared between the two groups.RESULTS: A total of 33 patients(47 eyes)were finally included in this study, including 10 patients(17 eyes)in the observation group and 23 patients(30 eyes)in the control group. The observation group had a median age of 59.0(52.8, 63.8)y, with 8 males(13 eyes)and 2 females(4 eyes). The control group had a median age of 56.0(53.5, 60.0)y, with 13 males(17 eyes)and 10 females(13 eyes). At 3 mo postoperatively, the best-corrected distance visual acuity(BCDVA)was 0.10(0.08, 0.12)in the observation group and 0.20(0.10, 0.40)in the control group(P=0.586). However, the best-corrected intermediate visual acuity(BCIVA)[0.10(0.10, 0.10)vs 0.50(0.40, 0.90), P=0.032] and best-corrected near visual acuity(BCNVA)[0.20(0.18, 0.20)vs 0.60(0.45, 1.45), P=0.044] in the observation group were significantly better than those in the control group. The defocus curve showed that the uncorrected visual acuity(UCVA)in the observation group was relatively stable within the range of -2.00 to +1.00 D, which was superior to that in the control group. Postoperative questionnaires showed that the spectacle independence rate(76%)and overall satisfaction(88%)in the observation group were significantly higher than those in the control group(10% and 60%, respectively).CONCLUSION: Non-diffractive EDOF IOL significantly improves intermediate and near visual acuity, reduces spectacle dependence, and maintains distance visual acuity by extending the depth of focus, providing better postoperative visual quality and life satisfaction for HMC patients.
10.Chinese expert consensus on postoperative follow-up for non-small cell lung cancer (version 2025)
Lunxu LIU ; Shugeng GAO ; Jianxing HE ; Jian HU ; Di GE ; Hecheng LI ; Mingqiang KANG ; Fengwei TAN ; Fan YANG ; Qiang PU ; Kaican CAI
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(03):281-290
Surgical treatment is one of the key approaches for non-small cell lung cancer (NSCLC). Regular postoperative follow-up is crucial for early detection and timely management of tumor recurrence, metastasis, or second primary tumors. A scientifically sound and reasonable follow-up strategy not only extends patient survival but also significantly improves quality of life, thereby enhancing overall prognosis. This consensus aims to build upon the previous version by incorporating the latest clinical research advancements and refining postoperative follow-up protocols for early-stage NSCLC patients based on different treatment modalities. It provides a scientific and practical reference for clinicians involved in the postoperative follow-up management of NSCLC. By optimizing follow-up strategies, this consensus seeks to promote the standardization and normalization of lung cancer diagnosis and treatment in China, helping more patients receive high-quality care and long-term management. Additionally, the release of this consensus is expected to provide insights for related research and clinical practice both domestically and internationally, driving continuous development and innovation in the field of postoperative management for NSCLC.


Result Analysis
Print
Save
E-mail