1.Finite element analysis of stress distribution of anchors at different implantation depths under different bone density conditions in rotator cuff tears
Meng WANG ; Tan LU ; Minjie LI ; Zhicheng LIU ; Xiaoyong GUO
Chinese Journal of Tissue Engineering Research 2026;30(3):561-569
BACKGROUND:Arthroscopic anchor repair has become the main treatment method for rotator cuff tears at present.Among them,the insertion status of the anchor is a key factor in the success or failure of the operation.However,currently,the impact of the insertion depth of the anchor on the stress of the bone tunnel and the anchor under different bone density conditions remains unclear.OBJECTIVE:To explore the stress distribution of the bone tunnel and the anchor when the insertion depth of the anchor varies under different bone density conditions by using three-dimensional finite element analysis technology.METHODS:The CT image data of the humerus of volunteers were collected,and the models of the humerus and the anchor were constructed by using Mimics,3-Matic,and Solidworks software.In 3-Matic,holes with distances of 0,2,4,6,and 8 mm from the surface of the humerus were respectively created at the same position of the humerus and assembled with the anchor.In Mimics,values were assigned based on the CT gray value to obtain a model with normal bone mass(T value ≥-1.0).The parameters were changed to construct models with reduced bone mass(-2.5<T value<-1.0)and osteoporosis(T value<-2.5).In each model,a 70 N pulling force was applied to the anchor along the direction tangent to the inner edge of the bone tunnel.The stress distribution and magnitude of the bone tunnel and the anchor when inserted at different depths under different bone density conditions were observed.RESULTS AND CONCLUSION:(1)When the insertion depth was the same,as the bone density decreased,the maximum equivalent stress of the anchor increased,while the maximum equivalent stress of the bone tunnel decreased.(2)When the bone density was the same,as the insertion depth of the anchor increased,the maximum equivalent stress of the anchor decreased.When the insertion depth was 4 mm,the stress of the bone tunnel was the smallest and the distribution was relatively uniform.The stress of the anchor was mainly distributed around the lower anchor hole and the proximal thread,and the stress of the bone tunnel was mainly at the part in contact with the proximal thread.The increase in the insertion depth would change the uniformity and pattern of the stress distribution,while the bone density had a relatively small impact on the stress distribution pattern.(3)It is concluded that the bone density of the humerus is crucial for the anchor repair of rotator cuff tears.It is recommended that clinicians measure the bone density of the greater tuberosity of the humerus before the operation.Excessive insertion depth of the anchor does not significantly increase its stability.Clinicians can conduct personalized preoperative assessments by using the finite element analysis method in combination with the actual situation of patients to achieve the best surgical results.
2.Finite element analysis of stress distribution of anchors at different implantation depths under different bone density conditions in rotator cuff tears
Meng WANG ; Tan LU ; Minjie LI ; Zhicheng LIU ; Xiaoyong GUO
Chinese Journal of Tissue Engineering Research 2026;30(3):561-569
BACKGROUND:Arthroscopic anchor repair has become the main treatment method for rotator cuff tears at present.Among them,the insertion status of the anchor is a key factor in the success or failure of the operation.However,currently,the impact of the insertion depth of the anchor on the stress of the bone tunnel and the anchor under different bone density conditions remains unclear.OBJECTIVE:To explore the stress distribution of the bone tunnel and the anchor when the insertion depth of the anchor varies under different bone density conditions by using three-dimensional finite element analysis technology.METHODS:The CT image data of the humerus of volunteers were collected,and the models of the humerus and the anchor were constructed by using Mimics,3-Matic,and Solidworks software.In 3-Matic,holes with distances of 0,2,4,6,and 8 mm from the surface of the humerus were respectively created at the same position of the humerus and assembled with the anchor.In Mimics,values were assigned based on the CT gray value to obtain a model with normal bone mass(T value ≥-1.0).The parameters were changed to construct models with reduced bone mass(-2.5<T value<-1.0)and osteoporosis(T value<-2.5).In each model,a 70 N pulling force was applied to the anchor along the direction tangent to the inner edge of the bone tunnel.The stress distribution and magnitude of the bone tunnel and the anchor when inserted at different depths under different bone density conditions were observed.RESULTS AND CONCLUSION:(1)When the insertion depth was the same,as the bone density decreased,the maximum equivalent stress of the anchor increased,while the maximum equivalent stress of the bone tunnel decreased.(2)When the bone density was the same,as the insertion depth of the anchor increased,the maximum equivalent stress of the anchor decreased.When the insertion depth was 4 mm,the stress of the bone tunnel was the smallest and the distribution was relatively uniform.The stress of the anchor was mainly distributed around the lower anchor hole and the proximal thread,and the stress of the bone tunnel was mainly at the part in contact with the proximal thread.The increase in the insertion depth would change the uniformity and pattern of the stress distribution,while the bone density had a relatively small impact on the stress distribution pattern.(3)It is concluded that the bone density of the humerus is crucial for the anchor repair of rotator cuff tears.It is recommended that clinicians measure the bone density of the greater tuberosity of the humerus before the operation.Excessive insertion depth of the anchor does not significantly increase its stability.Clinicians can conduct personalized preoperative assessments by using the finite element analysis method in combination with the actual situation of patients to achieve the best surgical results.
3.The Pathogenesis and Therapeutic Strategies of Nasal Inflammatory Diseases From The Perspective of Glycolytic Metabolic Reprogramming
Meng-Wei LI ; Ji-Tang CAI ; Jun-Jie WANG ; Yi-Bo CAI ; Meng-Ting TAN
Progress in Biochemistry and Biophysics 2026;53(5):1333-1355
Aberrant activation of glycolysis represents a key metabolic mechanism underlying the initiation and progression of nasal inflammation. Allergic rhinitis, chronic rhinosinusitis, and vasomotor rhinitis exhibit distinct etiologies, yet all are characterized by inflammatory responses, impaired epithelial barrier function, and neurovascular dysregulation, in which glycolytic metabolic reprogramming acts as a central hub connecting immunometabolism and inflammatory regulation.Recent evidence indicates that glycolysis-dependent activation of immune cells provides the essential energy basis for inflammatory onset. In dendritic cells, eosinophils, mast cells, and Th2 cells, the expression of key glycolytic enzymes including HK2, PKM2, and LDHA is upregulated, thereby promoting cellular activation and proinflammatory cytokine release via the mTOR-HIF-1α signaling axis. Notably, the metabolic reprogramming of eosinophils prolongs their survival and enhances the release of cytotoxic granules, while in mast cells, enhanced glycolysis facilitates IgE-mediated degranulation and histamine release. Furthermore, glycolysis also influences the Th17/Treg balance, with enhanced glycolytic flux promoting Th17 differentiation and contributing to the heterogeneous inflammatory profiles observed across different rhinitis subtypes.As a central metabolite, lactate contributes to the formation of a metabolism-inflammation vicious cycle through multiple mechanisms. Lactate acidifies the local microenvironment to activate TRPV1 channels and facilitate neuropeptide release, mediates immune cell chemotaxis through GPR81, and regulates gene expression via histone lactylation, thereby sustaining proinflammatory gene transcription. These lactate-mediated processes collectively amplify local inflammation and contribute to the persistence of nasal symptoms.Glycolytic reprogramming in epithelial cells is modulated by the EGF/EGFR pathway, and its dysregulation may result in disrupted tight junctions, abnormal goblet cell hyperplasia, and subsequent tissue remodeling. Substance P and calcitonin gene-related peptide released from sensory neurons, in conjunction with metabolic products, synergistically maintain persistent inflammatory stimulation by activating mast cells, forming a neuro-immune-metabolic regulatory network that drives disease chronicity.From a therapeutic perspective, glycolytic inhibitors such as 2-deoxyglucose, FX11, and 3-bromopyruvate exert anti-inflammatory effects by targeting key enzymes including HK2 and LDHA, each with distinct mechanisms: 2-DG competitively inhibits hexokinase, FX11 selectively targets LDHA to reduce lactate production, and 3-BrPA modulates multiple glycolytic enzymes. Moreover, traditional Chinese medicine formulas, monomeric active components, and small-molecule compounds have shown promising potential in alleviating nasal inflammation by regulating the mTOR-HIF-1α axis, exerting antioxidant effects, and modulating endoplasmic reticulum stress pathways. The multi-target characteristics of these natural products offer advantages in addressing the complex pathophysiology of nasal inflammatory diseases.Despite these advances, several challenges remain. The non-selective inhibition of glycolysis may interfere with epithelial repair and mucosal regeneration, leading to delayed wound healing. Technical limitations in dynamic metabolic monitoring and sampling precision hinder the accurate assessment of local nasal metabolism. Furthermore, current animal models, which predominantly rely on acute stimulation protocols, inadequately recapitulate the chronic tissue remodeling processes characteristic of human rhinitis.This review systematically summarizes glycolysis as a common metabolic node shared by different rhinitis subtypes, offering a novel theoretical basis for the development of precision therapeutic strategies targeting metabolic reprogramming.
4.The Pathogenesis and Therapeutic Strategies of Nasal Inflammatory Diseases From The Perspective of Glycolytic Metabolic Reprogramming
Meng-Wei LI ; Ji-Tang CAI ; Jun-Jie WANG ; Yi-Bo CAI ; Meng-Ting TAN
Progress in Biochemistry and Biophysics 2026;53(5):1333-1355
Aberrant activation of glycolysis represents a key metabolic mechanism underlying the initiation and progression of nasal inflammation. Allergic rhinitis, chronic rhinosinusitis, and vasomotor rhinitis exhibit distinct etiologies, yet all are characterized by inflammatory responses, impaired epithelial barrier function, and neurovascular dysregulation, in which glycolytic metabolic reprogramming acts as a central hub connecting immunometabolism and inflammatory regulation.Recent evidence indicates that glycolysis-dependent activation of immune cells provides the essential energy basis for inflammatory onset. In dendritic cells, eosinophils, mast cells, and Th2 cells, the expression of key glycolytic enzymes including HK2, PKM2, and LDHA is upregulated, thereby promoting cellular activation and proinflammatory cytokine release via the mTOR-HIF-1α signaling axis. Notably, the metabolic reprogramming of eosinophils prolongs their survival and enhances the release of cytotoxic granules, while in mast cells, enhanced glycolysis facilitates IgE-mediated degranulation and histamine release. Furthermore, glycolysis also influences the Th17/Treg balance, with enhanced glycolytic flux promoting Th17 differentiation and contributing to the heterogeneous inflammatory profiles observed across different rhinitis subtypes.As a central metabolite, lactate contributes to the formation of a metabolism-inflammation vicious cycle through multiple mechanisms. Lactate acidifies the local microenvironment to activate TRPV1 channels and facilitate neuropeptide release, mediates immune cell chemotaxis through GPR81, and regulates gene expression via histone lactylation, thereby sustaining proinflammatory gene transcription. These lactate-mediated processes collectively amplify local inflammation and contribute to the persistence of nasal symptoms.Glycolytic reprogramming in epithelial cells is modulated by the EGF/EGFR pathway, and its dysregulation may result in disrupted tight junctions, abnormal goblet cell hyperplasia, and subsequent tissue remodeling. Substance P and calcitonin gene-related peptide released from sensory neurons, in conjunction with metabolic products, synergistically maintain persistent inflammatory stimulation by activating mast cells, forming a neuro-immune-metabolic regulatory network that drives disease chronicity.From a therapeutic perspective, glycolytic inhibitors such as 2-deoxyglucose, FX11, and 3-bromopyruvate exert anti-inflammatory effects by targeting key enzymes including HK2 and LDHA, each with distinct mechanisms: 2-DG competitively inhibits hexokinase, FX11 selectively targets LDHA to reduce lactate production, and 3-BrPA modulates multiple glycolytic enzymes. Moreover, traditional Chinese medicine formulas, monomeric active components, and small-molecule compounds have shown promising potential in alleviating nasal inflammation by regulating the mTOR-HIF-1α axis, exerting antioxidant effects, and modulating endoplasmic reticulum stress pathways. The multi-target characteristics of these natural products offer advantages in addressing the complex pathophysiology of nasal inflammatory diseases.Despite these advances, several challenges remain. The non-selective inhibition of glycolysis may interfere with epithelial repair and mucosal regeneration, leading to delayed wound healing. Technical limitations in dynamic metabolic monitoring and sampling precision hinder the accurate assessment of local nasal metabolism. Furthermore, current animal models, which predominantly rely on acute stimulation protocols, inadequately recapitulate the chronic tissue remodeling processes characteristic of human rhinitis.This review systematically summarizes glycolysis as a common metabolic node shared by different rhinitis subtypes, offering a novel theoretical basis for the development of precision therapeutic strategies targeting metabolic reprogramming.
5.Qishao Capsules Improve Diabetic Renal Injury in db/db Mice by Inhibiting Podocyte Apoptosis via Regulating Caspase-8 and Caspase-3
Jingwei LIU ; Zhenhua WU ; Bing YANG ; Fengwen YANG ; Miao TAN ; Tingting LI ; Jinchuan TAN
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(2):126-135
ObjectiveTo observe the effect of Qishao capsules on renal injury in db/db mice with diabetic kidney disease (DKD),and explore its mechanism of protecting the kidney by inhibiting podocyte apoptosis. Methodsdb/m mice (7 mice) were used as the normal group,and db/db mice (35 mice) were randomly divided into a model group,a dapagliflozin group (0.001 g·kg-1·d-1),and low-,medium-,and high-dose groups of Qishao capsules (0.341 3,0.682 5,and 1.365 g·kg-1·d-1,respectively). Drug intervention lasted for 8 consecutive weeks. After sampling,the serum renal function indicators [creatinine(SCr),and urea nitrogen(BUN)],fasting blood glucose (FBG),24 h urinary protein quantification (24 h-UTP), and other indicators of the mice were measured. The pathological tissue morphology of the kidney was observed by periodic acid-silver methenamine (PASM) and Masson's trichrome (Masson) staining. Immunohistochemical detection of cysteine-dependent aspartate-specific protease (Caspase)-3 and B-cell lymphoma 2 (Bcl-2) was performed. Western blot was used to detect the protein expression of Caspase-8,Caspase-7,Caspase-3, and other molecules. Terminal deoxynucleotidyl transferase dUTP nick End labeling (TUNEL) staining was used to observe apoptosis in renal tissue. Immunofluorescence staining of Wilms tumor suppressor gene-1
6.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
7.Effect of Yang-Reinforcing and Blood-Activating Therapy on the Long-Term Prognosis for Dilated Cardio-myopathy Patients with Yang Deficiency and Blood Stasis Syndrome:A Retrospective Cohort Study
Shiyi TAO ; Jun LI ; Lintong YU ; Ji WU ; Yuqing TAN ; Xiao XIA ; Fuyuan ZHANG ; Tiantian XUE ; Xuanchun HUANG
Journal of Traditional Chinese Medicine 2026;67(1):53-59
ObjectiveTo evaluate the impact of yang-reinforcing and blood-activating therapy on the long-term prognosis for patients with dilated cardiomyopathy (DCM) of yang deficiency and blood stasis syndrome. MethodsA retrospective cohort study was conducted involving 371 DCM patients with yang deficiency and blood stasis syndrome. The yang-reinforcing and blood-activating therapy was defined as the exposure factor. Patients were categorized into exposure group (186 cases) and non-exposure group (185 cases) according to whether they received yang-reinforcing and blood-activating therapy combined with conventional western medicine for 6 months or longer. The follow-up period was set at 48 months, and the Kaplan-Meier survival analysis was used to assess the cumulative incidence of major adverse cardiovascular events (MACE) in both groups. Cox regression analysis was used to explore the impact of yang-reinforcing and blood-activating therapy on the risk of MACE, and subgroup analysis was performed. Changes in traditional Chinese medicine (TCM) syndrome score, left ventricular ejection fraction (LVEF), left ventricular fractional shortening (LVFS), left ventricular end-diastolic diameter (LVEDD), and Minnesota Living with Heart Failure Questionnaire (MLHFQ) score were compared between groups at the time of first combined use of yang-reinforcing and blood-activating therapy (before treatment) and 1 year after receiving the therapy (after treatment). ResultsMACE occurred in 31 cases (16.67%) in the exposure group and 47 cases (25.41%) in the non-exposure group. The cumulative incidence of MACE in the exposure group was significantly lower than that in the non-exposure group [HR=0.559, 95%CI(0.361,0.895), P=0.014]. Cox regression analysis showed that yang-reinforcing and blood-activating therapy was an independent factor for reducing the risk of MACE in DCM patients [HR=0.623, 95%CI(0.396,0.980), P=0.041], and consistent results were observed in different subgroups. Compared with pre-treatment, the exposure group showed decreased TCM syndrome score and MLHFQ score, reduced LVEDD, and increased LVEF and LVFS after treatment (P<0.05); in the non-exposure group, TCM syndrome score decreased, LVEF and LVFS increased, and LVEDD reduced after treatment (P<0.05). After treatment, the exposure group had higher LVEF and LVFS, smaller LVEDD, and lower TCM syndrome score and MLHFQ score compared with the non-exposure group (P<0.05). ConclusionCombining yang-reinforcing and blood-activating therapy with conventional western medicine can reduce the risk of MACE in DCM patients with yang deficiency and blood stasis syndrome, meanwhile improving their clinical symptoms, cardiac function, and quality of life.
8.Study on the correlation between depressive state and autonomic dysfunction in patients with Parkinson's disease
Laixiu QIU ; Qiubi TANG ; Xiaolan ZENG ; Luxi LI ; Hongyu TAN
Journal of Public Health and Preventive Medicine 2026;37(1):112-115
Objective To investigate the depressive state of patients with Parkinson's disease (PD), and to analyze the correlation of depressive state with autonomic dysfunction. Methods A total of 327 patients with PD in the hospital were selected from March 2022 to March 2024. The depressive state was evaluated by Hamilton Depression Scale (HAMD). The autonomic nerve function was assessed using the Scale for Outcomes in PD for Autonomic Symptoms (SCOPA-AUT) and heart rate variability [standard deviation of sinus RR interval (SDNN), standard deviation of average sinus RR interval (SDANN), and percentage of successive NN interval differences above 50 ms (pNN50)]. According to the positive depression (HAMD>20 points), the patients were divided into a depression group and a non-depression group. The clinical data and autonomic nerve function indicators were compared between the two groups. Pearson correlation coefficient analysis was performed to analyze the correlation between depressive state and autonomic dysfunction in PD patients. Results The positive rate of depression in patients with PD was 31.19%. There were 102 patients in the depression group and 225 patients in the non-depression group. The years of education and the proportion of mild Hoehn-Yahr stage (H-Y stage) in the depression group were lower than those in the non-depression group, while the disease course was longer, and the Unified Parkinson's Disease Rating Scale (UPDRS) II score and UPDRS III score were higher than those in the non-depression group (P<0.05). The SCOPA-AUT score in the depression group was higher while the SDNN, SDANN and pNN50 were lower compared to the non-depression group (P<0.05). HAMD score was positively correlated with SCOPA-AUT score (r=0.685), and was negatively correlated with SDNN, SDANN and pNN50 (r=-0.578, -0.685, and -0.439) (P<0.05). Conclusion Depression is a common state among patients with PD, and its level is positively correlated with the severity of autonomic dysfunction in patients.
9.Flos Buddlejae self-heating steam eye mask combined with sodium hyaluronate eye drops in the treatment of dry eye disease
Zhaodan TAN ; Qian LI ; Yan SHI ; Kangyuan HU ; Jin HUANG
Journal of Pharmaceutical Practice and Service 2026;44(2):96-102
Objective To assess the clinical efficacy of sodium hyaluronate (0.3%) eye drops combined with herbal self-heating steam eye mask in the treatment of dry eye disease. Methods A prospective randomized controlled clinical trial was performed on 60 patients diagnosed with dry eye at the ophthalmic clinic of a Grade A, Class Ⅲ hospital in Shanghai from June 2023 to September 2024. Specifically, patients were randomly divided into control group and study group. Patients in the control group were treated with sodium hyaluronate (0.3%) eye drops for six weeks; while in the study group, patients received the eye drops combined with the herbal self-heating steam eye mask mainly containing powders of Flos Buddlejae. Subsequently, comparisons and analysis were performed before and after treatment between the two groups in the clinical symptom questionnaire score traditional Chinese medicine (TCM syndrome score),the Chinese dry eye questionnaire score and determination of tear film fluorscein breakup time (FBUT), and curative effect. Results The quality control standard of the herbal powder in the self-heating steam eye mask was established through TLC and HPLC, and good heating behavior of the herbal self-heating steam eye mask was ascertained heating temperature (43±5)℃; heating duration (≥20 min), meeting requirements of the product quality control. After treatment for 6 weeks, FBUT was increased, while TCM syndrome score and the Chinese dry eye questionnaire score were both decreased in the study group (P<0.001). Besides, compared with the control group, TCM syndrome score and the Chinese dry eye questionnaire score were much lower, while the FBUT were higher in the study group (P<0.001). Moreover, the overall response rate in the study group (81.7%) was much better than that in the control group (25.9%). Conclusion The combination of sodium hyaluronate (0.3%) eye drops with herbal self-heating steam eye mask could be applied to the clinical treatment of dry eye disease due to its good clinical effects on relieving dry eye symptoms.
10.A Review of Methods for Establishing and Evaluating Animal Models of Stroke
Yunrong YANG ; Wenyu WU ; Yue TAN ; Guofeng YAN ; Yao LI ; Jin LU
Laboratory Animal and Comparative Medicine 2026;46(1):94-106
Stroke is one of the leading causes of disability and mortality worldwide. Research into its mechanisms and the development of therapeutic strategies heavily rely on animal models that accurately replicate the pathological features of human disease. An ideal animal model for stroke should not only reproduce the neurological deficits and pathological changes observed in clinical patients but also demonstrate good reproducibility and translational value. This review focuses on the preparation and evaluation methods of ischemic stroke animal models. Firstly, it elaborates on the selection criteria, advantages, and disadvantages of experimental animals, including rodents (rats, mice) and non-rodents (non-human primates, miniature pigs, rabbits, zebrafish). Secondly, it provides a detailed overview of the modeling principles, key procedures, and application scopes for ischemic stroke models and hemorrhagic stroke models. Furthermore, the review summarizes advances in the applications of emerging technologies—including gene editing [e.g., clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing], multimodal imaging (e.g., two-photon microscopy, photoacoustic imaging), artificial intelligence, optogenetics, 3D bioprinting, organoid models, and multi-omics–in model optimization, precise assessment, and mechanistic investigation. Finally, based on a systematic analysis of relevant domestic and international literature from 2019 to 2024, this review discusses model selection strategies based on research objectives, a multidimensional evaluation system encompassing behavioral, imaging, and molecular pathological assessments, and envisions future directions involving technological integration to achieve model precision and individualization. This article aims to provide a comprehensive methodological reference to help researchers select appropriate animal models of stroke according to specific scientific questions.


Result Analysis
Print
Save
E-mail