OBJECTIVE To evaluate the efficacy and safety of immune checkpoint inhibitors （ICIs） combined with neoadjuvant chemotherapy in the treatment of early triple-negative breast cancer （TNBC）. METHODS Randomized controlled trials （RCTs） comparing ICIs combined with neoadjuvant chemotherapy （experimental group） versus neoadjuvant chemotherapy alone （control group） were retrieved from PubMed， Cochrane Library， Embase， Web of Science， CNKI， Wanfang Data， and VIP databases， as well as relevant studies published at oncology academic conferences. The search period was from database inception to June 30， 2025. After literature screening， data extraction， and quality assessment， a meta-analysis was performed by using RevMan 5.4 software. RESULTS A total of 6 RCTs involving 3 786 patients were finally included. The meta-analysis results showed that the experimental group had superior event-free survival [HR＝0.73， 95%CI （0.62， 0.85）， P＜0.000 1]， overall survival [HR＝0.69， 95%CI （0.57， 0.84）， P＝0.000 3]， and pathological complete response （pCR） [OR＝1.57， 95%CI （1.37， 1.80）， P＜0.000 01] compared to the control group. The incidence of ≥grade 3 adverse event （AE）， severe AE （SAE）， and ≥ grade 3 immune-related adverse event （irAE） in the experimental group was significantly higher than that in the control group. There was no statistically significant difference between the two groups in the incidence of any AE or any irAE （P＞0.05）. Subgroup analysis revealed that， regardless of programmed cell death ligand 1 expression status （negative or positive），the pCR in the experimental group was significantly higher than that in the control group （P＜0.05）. Additionally， the pCR of the patients with positive lymph nodes in the experimental group was significantly higher to that in the ontrol group （P＜0.05）. There was no statistically significant difference in pCR between the two groups with negative lymph nodes （P＝0.09）. CONCLUSIONS ICIs combined with neoadjuvant chemotherapy can significantly improve event-free survival and overall survival in patients with TNBC， providing patients with long-term survival benefits. However， the risk of ≥ grade 3 AE， SAE and ≥ grade 3 irAE has increased.

Congenital blood group chimerism refers to the coexistence of two or more distinct blood types within an individual, resulting from the presence of hematopoietic cell populations with different genotypes. Consequently, red blood cells in such individuals may express different blood group antigens. Based on the timing and mechanism of formation, blood group chimerism can be classified as either congenital or acquired. Although congenital blood group chimerism is rare and involves complex mechanisms, it holds significant implications in transfusion medicine, transplantation, and obstetrics. This article reviews the formation mechanisms, detection methods, and clinical significance of congenital blood group chimerism in transfusion medicine. Particular emphasis is placed on the principles, advantages, and limitations of various detection techniques. Furthermore, the potential applications of these technologies in clinical diagnosis are discussed, providing a technical foundation for the development of precise transfusion strategies.

ObjectiveTo investigate the clinical features of tumor-induced acute pancreatitis （TIAP）， to construct and validate a predictive model for TIAP， and to provide help for early identification in clinical practice. MethodsA retrospective analysis was performed for the clinical data of 3 051 patients with acute pancreatitis （AP） who were admitted to The First Affiliated Hospital of Xinjiang Medical University from January 2020 to January 2026， among whom there were 72 patients with TIAP. To reduce class imbalance， 216 patients with non-tumor-related AP （2 979 patients） were randomly selected as conventional group using sex-stratified sampling， resulting in a cohort of 288 patients， and this cohort was randomly divided into a training set with 201 patients and a test set with 87 patients at a ratio of 7∶3. The two groups were compared in terms of general information and laboratory markers. The independent-samples t test was used for comparison of normally distributed continuous data between two groups， and the Mann-Whitney U test was used for comparison of non-normally distributed continuous data between two groups； the chi-square test was used for comparison of categorical data between two groups. Recursive feature elimination and least absolute shrinkage and selection operator regression were used for screening of characteristic variables， and five machine learning models were constructed， i.e.， logistic regression model， random forest model， support vector machine model， extreme gradient boosting model， and light gradient boosting machine model. The receiver operating characteristic curve and the precision-recall curve were used to assess model performance； the calibration curve was used to assess goodness of fit； decision curve analysis was used to evaluate clinical applicability and practicality； Shapley additive explanations were used to assess model interpretability. ResultsIn the training set of 201 patients， there were 52 patients （25.9%） in the TIAP group， and in the test set of 87 patients， there were 20 patients （23.0%） in the TIAP group. Compared with the conventional group， the TIAP group had a significantly higher proportion of patients with pancreatic duct dilatation （χ²=79.474， P<0.05）， a significantly higher age （Z=-5.838， P<0.05）， and significantly lower levels of white blood cell count （Z=5.630， P<0.05）， amylase （Z=2.606， P<0.05）， hemoglobin （Z=5.038， P<0.05）， and neutrophil percentage （Z=5.269， P<0.05）， as well as a lower level of direct bilirubin （Z=0.936， P>0.05）. The five machine learning models constructed based on these seven variables had a certain predictive ability， among which the logistic regression model had the best performance in the test set， with an area under the curve of 0.893 （95% confidence interval： 0.821 — 0.953）， an average precision of 0.654 in the precision-recall curve， good calibration， and good clinical benefits based on the decision curve analysis. ConclusionThe predictive model for TIAP based on pancreatic duct dilatation， age， white blood cell count， amylase， hemoglobin， neutrophil percentage， and direct bilirubin shows good predictive performance and can provide important guidance for the early diagnosis of TIAP.

Objective To explore the method for establishing a pig left lung orthotopic transplantation model. Methods A total of 4 male Yorkshire pigs weighing (40.0±2.5) kg underwent surgical procedures, including anesthesia, tracheal intubation, donor lung procurement, and recipient lung transplantation. Histological morphology and blood gas analysis of the transplanted lungs were assessed 2 hours after reperfusion to evaluate the histological changes and function of the transplanted lungs. Results The pigs underwent left lung in situ transplantation, effectively simulating conditions relevant to human lung transplantation. Two hours after the transplantation, arterial blood gas analysis showed that arterial partial pressure of oxygen was 155.4-178.6 mm Hg, arterial partial pressure of carbon dioxide was 53.1-62.4 mm Hg, and the oxygenation index was 310.8-357.2 mm Hg. Hematoxylin and eosin staining indicated a low degree of pulmonary edema and minimal cellular infiltration. Conclusion The pig left lung orthotopic transplantation model possesses strong operability and stability. Researchers can replicate this model according to the described methods and further conduct basic research and explore clinical translational applications.

Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.

Background and Purpose:Previous studies have investigated the prognostic significance of skeletal muscle and adipose tissue composition and distribution in colorectal cancer patients,yet most have not differentiated between rectal and colon cancer patient cohorts.This study aimed to explore the relationship between body composition and long-term prognosis,and to develop a postoperative predictive model.Methods:Clinical data of rectal cancer patients who underwent surgical treatment at Qingdao University Affiliated Hospital from January 2018 to December 2021 were retrospectively collected.Inclusion criteria:①Age＞18 years;② Preoperative colonoscopy and pathological diagnosis of colorectal cancer;③ Complete surgical resection;④Abdominal computed tomography(CT)scan 1 month before surgery.Exclusion criteria:① Clinical data is missing;② Multiple metastases of tumors;③ Tumor T stage 0 or carcinoma in situ;④ Severe artifacts lead to poor quality CT imaging,making it difficult to distinguish between fat and muscle;⑤ Inability to obtain follow-up results.This study has been approved by the Medical Ethics Committee of the Affiliated Hospital of Qingdao University(approval number:QYFYWZLL30313),and informed consent has been waived in the ethical approval process.The skeletal muscle index(SMI)and subcutaneous adipose tissue index(SATI)were calculated by dividing the areas of skeletal muscle and subcutaneous fat observed on CT scans by the square of the patient's height.Univariate and multivariate COX regression analyses were conducted to identify risk factors influencing recurrence-free survival(RFS)and overall survival(OS)in rectal cancer patients.Based on the results of the multivariate analysis,a nomogram prediction model was developed,its predictive power and accuracy were assessed using the receiver operating characteristic(ROC)curve,calibration plots and decision curve analysis(DCA),and internal validation was conducted.Results:A total of 696 patients were included in this study,with 96(13.8%)patients experiencing postoperative recurrence and 89(12.8%)patients dying.Multivariate COX regression analysis showed that SMI,SATI,tumor T stage and N stage were independent factors affecting the postoperative RFS and OS of patients.Nomogram prediction models for RFS and OS in rectal cancer patients were constructed based on the above independent predictors.The area under ROC curve(AUC)for 3-,4-and 5-year RFS was 0.862,0.846 and 0.824,respectively;the AUC for 3-,4-and 5-year OS was 0.886,0.898 and 0.875,respectively.The models were evaluated using calibration curves and decision curves,and internal validation was performed,which showed that the prediction accuracy of the models was good.Conclusion:CT body composition is an independent predictor of RFS and OS in rectal cancer patients,and the nomogram model developed based on these factors demonstrates good predictive value for patient prognosis.

Aimed to find a safe and effective drug to replace nitroimidazole drugs in aquaculture pro-duction for the prevention and treatment of Trichomoniasis in pigeons,which can improve the eco-nomic benefits of meat pigeon breeding and ensure food safety.Firstly,Trichomonas was isolated and cultured from the crop of diseased pigeons and identified.After stable passage,a quantitative method for in vitro detection of Trichomonas was established by combining an automated cell counter and quantitative real-time PCR technology.To prepared the drug,powders of Sophora fla-vescent and Philodendron were made into herbal water extracts(SFPA)and mixed with copper sulfate(CS)solution.Then added the drug to the culture medium of Trichomonas to determine the effective concentration of it.A total of 135 pairs each of Silver King and Mimas breeding pigeons in the same laying period were selected and randomly divided into three groups,with 6 replicates in each group and 15 pairs of breeding pigeons in each replicate.Four days before brooding,the three groups were fed with 200 mL of pure water,0.5 g/L metronidazole(MDZ)solution,and a mixed solution of 30 g/L SFPA and 0.5 g/L CS,respectively.The feeding experiment lasted for 26 d.Results showed that the mixed solution of SFPA and CS had a significant killing effect on Trichomonas in vitro(P＜0.05).Feeding the drug to breeding pigeons significantly reduced the in-fection rate of breeding pigeons by Trichomonas(P＜0.05).The drug had no significant effect on the serum biochemical indexes,antioxidant properties,immunoglobulin levels of breeding pigeons,the average cage weight,immune organ indexes,meat quality and slaughter performance of squabs(P＞0.05).The results suggested that adding SFPA and CS to pigeons can effectively prevent and treat Trichomoniasis and improve production performance.It can replace nitroimidazole drugs without affecting the immune level of breeding pigeons and the weight,immune level,slaughter performance and meat quality of squabs,thereby reduce drug residues in poultry products and en-hance the food safety.

In traditional Chinese medicine,jaundice is a liver and gallbladder disorder,primarily characterized by yellowing of the eyes,skin,and urine,with ocular yellowing being the most prominent feature.The understanding of jaundice pathogenesis in traditional Chinese medicine can be traced back to the Inner Canon of Huangdi.Despite the continuous development and improvement of successive generations of medical practitioners and a rich theoretical understanding of its pathogenesis being formed by the end of the Qing Dynasty,no unified view exists on whether the core pathological factor was dampness or blood stasis,nor on whether the primary disease location lay in the spleen and stomach or the liver and gallbladder.This article re-examines historical perspectives on jaundice pathogenesis within the context of traditional Chinese medicine theory,focusing on two key issues:pathological factors and the location of Zang and Fu.By integrating modern research approaches based on compound pathogenesis theory,and considering pathological factors,disease location according to Zang and Fu,and disease progression,a theoretical model is reconstructed,centered on the intermingling of dampness and blood stasis and integration of liver and spleen.Additionally,the insights and therapeutic strategies of multiple renowned clinical hepatology experts are incorporated to enrich the theoretical framework for jaundice treatment in traditional Chinese medicine and to enhance clinical efficacy.

Objective To explore the value of nomogram model based on MR T1WI enhanced radiomics features and clinical fac-tors in predicting the prognosis of gliomas.Methods A retrospective selection was conducted on 135 patients with postoperative pathologically confirmed gliomas,who were categorized into poor prognosis group(n=59)and good prognosis group(n=76)according to survival condition at 20 months postoperatively.All patients were randomly divided into training group(n=94)and validation group(n=41)in a 7︰3 ratio.Radiomics features were extracted by 3D Slicer software,and the extracted radiomics features were downscaled by intraclass correlation coefficient(ICC),t-test,least absolute shrinkage and selection operator(LASSO)regression,and a total of 1 058 features were extracted for each patient,and 10 optimal radiomics features were obtained,to finally get the Radiomics score(Radscore).After combining clinical features and Radscore,a nomogram model was constructed.Results In the training group,Radscore was significantly higher in the poor prognosis group than that in the good prognosis group(t=8.773,P<0.05).The area under the curve(AUC)of receiver operating characteristic(ROC)curve of the training and validation groups of the radiomics model were 0.751[95%confidence interval(CI)0.654-0.849]and 0.606(95%CI 0.426-0.787),respectively.The AUC of the nomogram model were 0.899(95%CI 0.839-0.960)and 0.908(95%CI 0.823-0.994)in the training and validation groups,respectively,with much better predictive efficacy of the nomogram model.Conclusion A nomogram model based on MR T1WI enhanced radiomics features and clinical factors has good predictive efficacy in the prognosis of gliomas after surgery.

Objective To comparatively analyze the friction wear performance,fracture resistance,and displacement resistance before and after aging of full crowns made from PEEK,cobalt-chromium alloy,and zirconia,providing a theoretical basis for the future application of PEEK in crown fabrication.Methods Standard anatomical full crowns of PEEK,cobalt-chromium alloy,and zirconia were fabricated by preparing the upper first premolar and taking silicone rubber impressions,resulting in 25 crowns of each material.The crowns were divided into three groups:Group A(15 crowns,5 from each material),Group B(30 crowns,10 from each materi-al),and Group C(30 crowns,10 from each material,serving as a control).Group A underwent 120 000 chewing simulations under simulated oral physiological conditions,using a stereomicroscope and Micro-image Analysis & Process system to assess and compare wear of antagonists(opposing talc ceramic balls)and material wear.Group B underwent 10 000 thermal cycling aging tests and Group C were served as the control.Universal testing machines were used to evaluate and compare the fracture resistance and displacement re-sistance of Groups B and C.Results ①The wear heights of full crown materials were as follows:cobalt-chromium alloy(0.61±0.05)mm,zirconia(0.81±0.07)mm,and PEEK(0.96±0.04)mm,with PEEK＞zirconia＞cobalt-chromium alloy(P＜0.05).For antagonist wear,the wear heights were cobalt-chromium alloy＞zirconia＞PEEK(P＜0.05).②The fracture resistance of cobalt-chromium alloy be-fore and after aging was(3 665.645±71.166)N and(2 906.830±225.143)N,respectively;for zirconia it was(2 447.825±316.961)N and(1 829.229±72.046)N;and for PEEK crowns it was(1 632.378±53.046)N and(1 074.872±105.491)N,showing cobalt-chromi-um alloy＞zirconia＞PEEK(P＜0.05).The displacement resistance for cobalt-chromium alloy before and after aging was(1 604.630±95.680)N and(1 092.137±77.869)N;for zirconia it was(1 768.851±56.273)N and(1 381.618±62.326)N;and for PEEK crowns it was(1 148.811±70.417)N and(931.723±64.454)N,indicating zirconia＞cobalt-chromium alloy＞PEEK(P＜0.05).The aging degradation of cobalt-chromium alloy's fracture and displacement re-sistance was(758.815±157.734)N and(512.492±34.530)N,re-spectively;for zirconia,it was(618.597±251.281)N and(387.233±7.947)N;and for PEEK crowns,it was(557.506±61.950)N and(217.089±14.589)N,with anti-aging performance:PEEK＞zirconia＞cobalt-chromium alloy(P＜0.05).Conclusion The wear re-sistance,fracture resistance,and displacement resistance of PEEK meet the clinical standards for full crown materials,and PEEK demonstrates good anti-aging performance while effectively protecting opposing teeth.Therefore,PEEK has the potential to become a novel material for full crown fabrication.