Congenital blood group chimerism refers to the coexistence of two or more distinct blood types within an individual, resulting from the presence of hematopoietic cell populations with different genotypes. Consequently, red blood cells in such individuals may express different blood group antigens. Based on the timing and mechanism of formation, blood group chimerism can be classified as either congenital or acquired. Although congenital blood group chimerism is rare and involves complex mechanisms, it holds significant implications in transfusion medicine, transplantation, and obstetrics. This article reviews the formation mechanisms, detection methods, and clinical significance of congenital blood group chimerism in transfusion medicine. Particular emphasis is placed on the principles, advantages, and limitations of various detection techniques. Furthermore, the potential applications of these technologies in clinical diagnosis are discussed, providing a technical foundation for the development of precise transfusion strategies.

OBJECTIVE To evaluate the efficacy and safety of immune checkpoint inhibitors （ICIs） combined with neoadjuvant chemotherapy in the treatment of early triple-negative breast cancer （TNBC）. METHODS Randomized controlled trials （RCTs） comparing ICIs combined with neoadjuvant chemotherapy （experimental group） versus neoadjuvant chemotherapy alone （control group） were retrieved from PubMed， Cochrane Library， Embase， Web of Science， CNKI， Wanfang Data， and VIP databases， as well as relevant studies published at oncology academic conferences. The search period was from database inception to June 30， 2025. After literature screening， data extraction， and quality assessment， a meta-analysis was performed by using RevMan 5.4 software. RESULTS A total of 6 RCTs involving 3 786 patients were finally included. The meta-analysis results showed that the experimental group had superior event-free survival [HR＝0.73， 95%CI （0.62， 0.85）， P＜0.000 1]， overall survival [HR＝0.69， 95%CI （0.57， 0.84）， P＝0.000 3]， and pathological complete response （pCR） [OR＝1.57， 95%CI （1.37， 1.80）， P＜0.000 01] compared to the control group. The incidence of ≥grade 3 adverse event （AE）， severe AE （SAE）， and ≥ grade 3 immune-related adverse event （irAE） in the experimental group was significantly higher than that in the control group. There was no statistically significant difference between the two groups in the incidence of any AE or any irAE （P＞0.05）. Subgroup analysis revealed that， regardless of programmed cell death ligand 1 expression status （negative or positive），the pCR in the experimental group was significantly higher than that in the control group （P＜0.05）. Additionally， the pCR of the patients with positive lymph nodes in the experimental group was significantly higher to that in the ontrol group （P＜0.05）. There was no statistically significant difference in pCR between the two groups with negative lymph nodes （P＝0.09）. CONCLUSIONS ICIs combined with neoadjuvant chemotherapy can significantly improve event-free survival and overall survival in patients with TNBC， providing patients with long-term survival benefits. However， the risk of ≥ grade 3 AE， SAE and ≥ grade 3 irAE has increased.

Fecal microbiota transplantation (FMT) technology originated in China during the Eastern Jin Dynasty and has rapidly developed over the past two decades, becoming a primary method for studying the causal relationship between gut microbiota and the occurrence and progression of diseases. At the same time, the therapeutic effects of FMT in the field of gastrointestinal diseases have gained widespread recognition and are gradually expanding into other disease areas. The FMT procedure is relatively complex, and there is currently no standardized method; its success is influenced by various factors, including the donor, recipient, processing of the fecal material, and the method of implantation. Given the increasingly recognized relationship between gut microbiota and various diseases, FMT has become a research hotspot in both scientific studies and clinical applications, achieving a series of significant advancements. To help researchers better understand this technology, this paper will outline the development history of FMT, summarize common operational methods in research and clinical settings, review its application progress, and look forward to future development directions.

BACKGROUND:Various clinical strategies for the treatment of tendinopathy have good short-term effects but poor long-term effects,and some studies have proven that mitochondria are closely related to the occurrence and development of tendinopathy.However,the relationship between mitochondria and tendinopathy and mitochondria-targeting therapeutic strategies for tendinopathy have not been summarized so far,which is not good for specialists and scholars in related fields to understand the recent research situation.OBJECTIVE:To review the existing clinical or preclinical original studies,in order to summarize the relationship between mitochondrial dysfunction and tendinopathy and the mitochondria-targeting methods for the treatment of tendinopathy,and to provide certain prospects for the evaluation and management of mitochondria in tendinopathy in the future.METHODS:The relevant literatures in PubMed,Web of Science,CNKI,WanFang and VIP databases were searched.The search time was from January 2009 to March 2024,and the search terms were"tendinopathy,tendon injuries,tendon,tendons,mitochondria,mitochondria dysfunction,mitochondria disease"both in English and Chinese.According to the exclusion and inclusion criteria,62 articles were finally included for review and analysis.RESULTS AND CONCLUSION:(1)In clinical tendinopathy patients or tendinopathy models,mitochondrial dysfunction is common,mainly represented by excessive production of reactive oxygen species,decreased activity of superoxide dismutase,ridge clutter and decreased number of mitochondria,which indicates that mitochondrial dysfunction will occur due to tendon injury,thus further worsening tendinopathy and forming a vicious cycle.(2)When the tendon has not been injured or tendinopathy has not yet occurred,the mitochondrial function will be affected by various internal and external factors,resulting in tendinopathy.This indicates that the normal tendon will be damaged,lesioned or even ruptured due to the abnormal function of the mitochondria.(3)Mechanical tensile stress,advanced glycosylation end products,aging and other internal and external factors are the main causes of mitochondrial dysfunction,and these factors will damage and weaken the biological activity and mechanical properties of normal tendons through molecular mechanisms such as apoptosis,inflammation and respiratory chain damage,and thereby induce tendinopathy.(4)According to molecular mechanisms,mitochondria-targeting therapies mainly include mitochondrial transfer/transplantation,transplantation,targeted antioxidants,etc.(5)This review mainly aims at clinical patients with tendinopathy or animal models with similar modeling methods,providing a reliable idea for clinical exploration of the pathogenesis of tendinopathy and targeted therapies for tendinopathy.However,the disadvantage is that the included studies are mainly animal experiments,and there is a lack of more clinical trials for verification.

Objective To investigate the efficacy of preprocedural intracoronary injections of adenosine and sodium nitroprusside in patients with intravascular ultrasound-attenuated plaques(AP).Methods In total,200 patients with AP detected using intravascular ultrasound(IVUS)at Shijiazhuang People's Hospital from January 1,2022,to January 1,2024,were selected and randomly divided into conventional treatment and pretreatment groups,with 100 patients in each group.The conventional treatment group underwent standard percutaneous coronary intervention(PCI)procedures,whereas the pretreatment group underwent intracoronary injection of sodium nitro-prusside and adenosine through a guiding catheter prior to PCI.The observation parameters included intraoperative no-reflow(NR)inci-dence,post-PCI TIMI myocardial perfusion frame count(TMPFC),perioperative myocardial infarction(PMN),and 6-month major adverse cardiac and cerebrovascular events(MACCE).Results The pretreatment group exhibited a significantly lower intraoperative NR inci-dence,reduced postoperative TMPFC,and attenuated PMN severity than the conventional treatment group(P＜0.05).Conclusion Pre-procedural intracoronary administration of adenosine and sodium nitroprusside through a guiding catheter can effectively reduce PCI-re-lated NR occurrence,improve post-PCI TMPFC,and mitigate PMN in patients with AP,although no significant improvement in MACCE incidence can be observed at the 6-month follow-up.

Objective:To investigate the genetic etiology of 15 patients with suspected Marfan syndrome(MFS).Methods:Fifteen patients clinically suspected of having MFS who attended the Women and Children′s Hospital Affiliated to Qingdao University between January 2020 and August 2024 were enrolled. Amniotic fluid samples from fetuses and EDTA-anticoagulated peripheral blood samples from the patients and their family members were collected. Genomic DNA was extracted and subjected to whole exome sequencing(WES). Variants identified in positive cases were further validated by Sanger sequencing. The pathogenicity of the detected variants was assessed according to the guidelines and supplemental criteria of the American College of Medical Genetics and Genomics(ACMG).Results:All 15 patients were found to carry variants in the FBN1 gene, including 9 pathogenic variants, 5 likely pathogenic variants, and 1 variant of uncertain significance(VUS). Notably, eight novel pathogenic or likely pathogenic variants not previously reported in the literature were identified: c. 213G>C, c. 469G>T, c. 3337+ 2dup, c. 4087+ 1G>T, c. 7331_7334dup, c. 8146del, c. 8227dup, and c. 8425_8426insG. According to the revised Ghent criteria(2010), only 2 patients could be clinically diagnosed with MFS prior to WES. However, after incorporating WES-derived molecular evidence, 8 patients fulfilled the diagnostic criteria for MFS.Conclusion:The combination of WES and clinical phenotype assessment can substantially improve the diagnostic yield for MFS. Furthermore, the identification of these novel FBN1 variants expands the mutational spectrum of the gene and provides valuable evidence for future genetic counselling, prenatal diagnosis, and pathogenicity interpretation of neighboring variants.

Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.

Parkinson's disease(PD)is the second most prevalent neurodegenerative disease and a major cause of movement disorders.Neuroinflammation plays an important role in the pathogenesis of PD.Icilin is a small molecule compound that has been reported to inhibit inflammation.Howev-er,its role in PD has not been reported.This study explored the effects of icilin on motor behavior,nerve damage,microglia activation,and neuroinflammation in MPTP-induced PD Meriones unguic-ulatus by behavioral experiments,immunohistochemistry,Western blot,and fluorescence quantifi-cation.The results showed that Icilin not only ameliorated motor dysfunction and neurological damage in MPTP-induced Meriones unguiculatus,but also inhibited microglia hyperactivation and its mediated neuroinflammation.The present study provides an evidence that icilin attenuates MPTP-induced neurodegenerative lesions in long-pawed gerbils,suggesting that it is a promising candidate for PD.

OBJECTIVE: To explore the risk factors affecting the prognosis of patients with sepsis complicated with acute pulmonary embolism, and to construct and validate a nomogram predictive model for in-hospital mortality risk. METHODS: Based on the American Medical Information Mart for Intensive Care (MIMIC-III, MIMIC-IV) databases, the data were collected on patients with sepsis complicated with acute pulmonary embolism from 2001 to 2019, including baseline characteristics, and vital signs, disease scores, laboratory tests within 24 hours of admission to the intensive care unit (ICU), and interventions. In-hospital mortality was the outcome event. The total samples were divided into training and testing sets in a 7:3 ratio by random sampling. Univariate Cox regression analysis was used to verify the impact of all variables on the risk of in-hospital mortality, thereby screen potential influencing factors. Subsequently, a stepwise bi-directional regression method was applied to select factors one by one, leading to the construction of a nomogram prediction model. Collinearity testing was used to demonstrate the absence of strong multicollinearity among the influencing factors in the nomogram prediction model. The discrimination of the nomogram model, sequential organ failure assessment (SOFA), and simplified pulmonary embolism severity index (sPESI) was evaluated using C-index in the test set. Receiver operator characteristic curve (ROC curve) was drawn to evaluate the predictive value of various models for in-hospital mortality in patients with sepsis complicated with acute pulmonary embolism. RESULTS: A total of 562 patients with sepsis complicated with acute pulmonary embolism were included, including 393 in the training set and 169 in the testing set. Univariate Cox regression analysis showed that 30 factors associated with in-hospital mortality in patients with sepsis complicated with acute pulmonary embolism. Through stepwise bi-directional regression, 12 variables were ultimately selected, including gender, presence of malignant tumors, body temperature, red cell distribution width (RDW), blood urea nitrogen (BUN), serum potassium, prothrombin time (PT), 24-hour urine output, mechanical ventilation, vasoactive drugs, warfarin use, and sepsis-induced coagulopathy (SIC). Collinearity testing indicated no strong multicollinearity among the influencing factors [all variance inflation factor (VIF) > 10]. A nomogram model was constructed using the 12 variables mentioned above. The nomogram model predicted the C-index and its 95% confidence interval (95%CI) of in-hospital mortality in patients with sepsis complicated with acute pulmonary embolism better than SOFA score and sPESI [0.771 (0.725-0.816) vs. 0.579 (0.519-0.639), 0.608 (0.554-0.663)]. The ROC curve showed that the area under the curve (AUC) and its 95%CI of the nomogram model were higher than those of the SOFA score and sPESI [0.811 (0.766-0.857) vs. 0.630 (0.568-0.691), 0.623 (0.566-0.680)]. These findings were consistently replicated in the internal validation of the testing set. In both the training and testing sets, Delong's test showed that the AUC of the nomogram model was significantly higher than the SOFA score and sPESI (both P < 0.05). CONCLUSION The nomogram model demonstrated good predictive effectiveness for the risk of in-hospital mortality in patients with sepsis complicated with acute pulmonary embolism, enabling clinicians to predict mortality risk in advance and take timely interventions to reduce mortality.
Humans ; Pulmonary Embolism/mortality* ; Hospital Mortality ; Nomograms ; Sepsis/complications* ; Prognosis ; Risk Factors ; Intensive Care Units ; Male ; Female ; Middle Aged ; Aged

Background: Gestational diabetes mellitus (GDM) is a metabolic disorder posing significant risks to maternal and infant health, with a lack of effective early screening markers. Therefore, identifying early screening biomarkers for GDM with higher sensitivity and specificity is urgently needed. Methods: High-throughput sequencing was employed to screen for key circular RNAs (circRNAs), which were then evaluated using reverse transcription quantitative polymerase chain reaction. Logistic regression analysis was conducted to examine the relationship between clinical characteristics, circRNA expression, and adverse pregnancy outcomes. The diagnostic accuracy of circRNAs for early and mid-pregnancy GDM was assessed using receiver operating characteristic curves. Pearson correlation analysis was utilized to explore the relationship between circRNA levels and oral glucose tolerance test results. A predictive model for early GDM was established using logistic regression. Results: Significant alterations in circRNA expression profiles were detected in GDM patients, with hsa_circ_0031560 and hsa_ circ_0000793 notably upregulated during the first and second trimesters. These circRNAs were associated with adverse pregnancy outcomes and effectively differentiated GDM patients, with second trimester cohorts achieving an area under the curve (AUC) of 0.836. In first trimester cohorts, these circRNAs identified potential GDM patients with AUCs of 0.832 and 0.765, respectively. The early GDM prediction model achieved an AUC of 0.904, validated in two independent cohorts. Conclusion Hsa_circ_0031560, hsa_circ_0000793, and the developed model serve as biomarkers for early prediction or midterm diagnosis of GDM, offering clinical tools for early GDM screening.