Objective: To investigate the barrier membrane fixation performance and enhanced guided bone regeneration (GBR) capability of a thermosensitive adhesive containing bioactive glass nanoparticles in order to provide a novel solution for membrane fixation during GBR procedures. Methods: M2NP@BGN (methoxyethyl acrylate-co-N-isopropylacrylamide-co-protocatechuic acid@Bioactive glass nanoparticle), a thermosensitive adhesive, was synthesized via free radical polymerization by compositing methoxyethyl acrylate, N-isopropylacrylamide, and protocatechuic acid into a basic adhesive that was modified with bioactive glass nanoparticle (BGN). The successful fabrication of basic adhesive M2NP was characterized by attenuated total reflection-Fourier transform infrared spectroscopy and nuclear magnetic resonance spectroscopy. The thermosensitive adhesive M2NP@BGN (BGN concentration of 1 mg/mL) was characterized by scanning electron microscopy and a rheometer. By adjusting the BGN concentration (0.1 mg/mL, 0.5 mg/mL, 1 mg/mL, and 2 mg/mL), the adhesive and mechanical strengths were investigated with a universal testing machine. Biocompatibility was evaluated with a cell counting kit-8 assay and hemolysis test to identify the optimal formulation. The optimal material’s extract was co-cultured with mouse bone marrow mesenchymal stem cells, and its osteogenic activity was examined in vitro by quantitative real-time PCR, alkaline phosphatase, and alizarin red S staining. The rat mandibular defect model was established, filled with bone graft, and divided into 3 groups based on membrane fixation method: M2NP@BGN (BGN concentration of 1 mg/mL) fixation group (M2NP@BGN), titanium nail fixation group (Nail), and unfixed control group (Negative). Bone regeneration was analyzed after 8 weeks by micro computed tomography and histological staining. Results: M2NP@BGN (BGN concentration of 1 mg/mL) was successfully synthesized and demonstrated rapid gelation under warm, humid conditions. The adhesive with a BGN concentration of 1 mg/mL exhibited the highest adhesive strength (P < 0.001) and significantly enhanced mechanical strength (P < 0.001) under 37℃ wet conditions. All formulations showed excellent biocompatibility, with cell viability > 80% and hemolysis ratio < 5%. M2NP@BGN (BGN concentration of 1 mg/mL) significantly upregulated the expression of Runx2 and Col I (P < 0.001) and enhanced the activity of osteogenic differentiation markers (P < 0.05). In the animal model, the M2NP@BGN group (BGN concentration of 1 mg/mL) achieved significantly higher bone volume fraction and better bone maturity compared to the negative and nail groups (P < 0.05). Conclusion M2NP@BGN (BGN concentration of 1 mg/mL) combines excellent wet adhesion with potent osteogenic activity, enhances the bone augmentation efficacy of membranes, and presents a novel fixation strategy with significant clinical translation potential for GBR therapy.

Objective: To analyze the epidemiological characteristics and influencing factors of severe fever with thrombocytopenia syndrome (SFTS) in Zhejiang Province from 2019 to 2023, so as to provide the reference for strengthening SFTS prevention and control. Methods: Data on laboratory-confirmed SFTS cases in Zhejiang Province from 2019 to 2023 were collected through the Infectious Disease Reporting Information System of Chinese Disease Prevention and Control Information System. Meteorological data, geographic environment and socioeconomic factors during the same period were collected from the fifth-generation European Centre for Medium-Range Weather Forecasts, Geospatial Data Cloud, and Zhejiang Statistical Yearbook, respectively. Descriptive epidemiological methods were used to analyze the epidemiological characteristics of SFTS from 2019 to 2023, and a Bayesian spatio-temporal model was constructed to analyze the influencing factors of SFTS incidence. Results: A total of 578 SFTS cases were reported in Zhejiang Province from 2019 to 2023, with an annual average incidence of 0.23/105. The peak period was from May to July, accounting for 52.60%. There were 309 males and 269 females, with a male-to-female ratio of 1.15∶1. The cases were mainly aged 50-<80 years, farmers, and in rural areas, accounting for 82.53%, 77.34%, and 75.43%, respectively. Taizhou City and Shaoxing City reported more SFTS cases, while Shaoxing City and Zhoushan City had higher annual average incidences of SFTS. The Bayesian spatio-temporal interaction model showed good goodness of fit. The results showed that mean temperature (RR=1.626, 95%CI: 1.111-2.378) and mean wind speed (RR=1.814, 95%CI: 1.321-2.492) were positively correlated with SFTS risk, while altitude (RR=0.432, 95%CI: 0.230-0.829) and population density (RR=0.443, 95%CI: 0.207-0.964) were negatively correlated with SFTS risk. Conclusions SFTS in Zhejiang Province peaks from May to July. Middle-aged and elderly people and farmers are high-risk populations. Taizhou City, Shaoxing City, and Zhoushan City are high-incidence areas. Mean temperature, mean wind speed, altitude, and population density can all affect the risk of SFTS incidence.

Objective: To analyze the prevalence status and clustering patterns of risk factors for chronic diseases among adult residents in Rui' an City, Zhejiang Province, so as to provide a basis for formulating strategies for the prevention and control of chronic diseases and implementing risk factor interventions. Methods: A multi-stage random cluster sampling method was used to select residents aged ≥18 years in 5 townships (sub-districts) of Rui' an City as survey subjects from December 2023 to March 2024. Data on basic information, history of major chronic diseases, lifestyle behaviors, height, weight, and blood biochemical indicators were collected through questionnaire surveys, physical examinations, and laboratory tests. Descriptive analysis was used to analyze the prevalence status of 5 risk factors for chronic diseases. K-means clustering analysis was used to analyze clustering patterns. Results: A total of 3 060 people were surveyed, including 1 476 males, accounting for 48.24%, and 1 584 females, accounting for 51.76%. The median age was 49.00 (interquartile range, 25.00) years. There were 1 275 cases (41.67%) of hypertension, 462 cases (15.10%) of diabetes, and 1 460 cases (47.71%) of dyslipidemia. Insufficient fruit and vegetable intake, excessive salt intake, overweight and obesity, excessive red meat intake, and smoking involved 2 201, 1 878, 1 541, 1 337, and 571 people, with prevalences of 71.93%, 61.37%, 50.36%, 43.69%, and 18.66%, respectively. K-means clustering analysis identified 4 clustering patterns: smoking-insufficient fruit and vegetable intake type (249 people, accounting for 8.20%), low intake type (1 421 people, accounting for 46.75%). high red meat type (245 people, accounting for 8.07%), and high BMI-high salt type (1 118 people, accounting for 36.96%). The prevalences of hypertension and diabetes were higher in adult residents of the high BMI-high salt type, at 56.53% and 20.30%, respectively. The prevalence of dyslipidemia was higher in adult residents of the smoking-insufficient fruit and vegetable intake type, at 59.44%. Conclusions The prevalence of insufficient fruit and vegetable intake among adult residents in Rui' an City is relatively high. The clustering pattern of chronic disease risk factors is dominated by the low intake type. The prevalence of chronic diseases is higher in adult residents of the high BMI-high salt type and smoking-insufficient fruit and vegetable intake type. It is suggested to carry out health education and collaborative intervention of risk factors for different risk groups.

OBJECTIVE To explore the effects of CD20 coding gene （MS4A1） polymorphism on the blood concentration and efficacy of rituximab in patients with non-Hodgkin’s lymphoma. METHODS A prospective observational study was conducted on 160 newly diagnosed non-Hodgkin’s lymphoma patients who received the R-CHOP regimen at the Sun Yat Sen University Cancer Center from January 2016 to December 2020， with a minimum follow-up period of approximately 5 years. The blood concentration of rituximab was detected by enzyme-linked immunosorbent assay. MS4A1 tagSNPs were selected by Haploview4.2 software， including rs1051461， rs17155034， rs4939364， and rs10501385. The genotype of MS4A1 was detected by Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Univariate linear regression analysis was employed to examine the correlation between various factors（demographic， clinical， and genotypic variables） in patients and the steady-state trough concentration of rituximab during the first course of treatment， followed by multivariate linear regression analysis. Kaplan-Meier curves were drawn to evaluate progression-free survival （PFS） and overall survival （OS）. Using MS4A1 genotype and tumor stage as independent variables， Cox regression model was employed to evaluate the factors influencing patient prognosis. RESULTS The blood concentration of rituximab in MS4A1 rs10501385 CC carriers was 15.20 μg/mL，which was significantly lower than 21.95 μg/mL in AA+AC carriers （P＜0.05）. The multivariate linear regression model incorporating tumor stage and MS4A1 rs10501385 polymorphism explained 7.3% of the interindividual variability in rituximab concentrations. Compared with MS4A1 rs1051461 CC carriers， CT+TT carriers had significantly prolonged PFS and OS （P＜0.05）. The Cox proportional hazards regression model showed that the MS4A1 rs1051461 CC genotype （HR＝4.406， 95%CI：1.743-11.137， P＜0.05） and tumor Ⅲ&Ⅳ （HR＝3.233， 95%CI： 1.413-7.399， P＜0.05） were independent risk factors for PFS. CONCLUSIONS The tumor staging and MS4A1 rs10501385 polymorphism are key influencing factors for blood concentration of rituximab， and MS4A1 rs1051461 polymorphism significantly affects PFS in non-Hodgkin’s lymphoma patients.

To investigate the therapeutic effect and related mechanisms of hordenine on ovalbumin (OVA)-induced allergic rhinitis (AR) in rats, HE and AB-PAS staining were used to detect the improvement of pathological damage to the nasal mucosa induced by hordenine. ELISA was employed to detect the effect of hordenine on OVA-sIgE in serum and IL-4 in the nasal mucosa supernatant of rats. IHC and Western blot experiments were undertaken to examine the effect of hordenine on Th1/Th2 cell balance. Bioinformatics analysis was performed to predict pathways, which were verified by in vivo and in vitro experiments. The experimental results showed that hordenine could alleviate the behavioral manifestations of OVA-induced AR rats, alleviate nasal mucosal pathological damage caused by AR, and reduce the secretion of OVA-sIgE and IL-4. In addition, hordenine could regulate the Th1/Th2 balance. Bioinformatics analysis results showed that the potential pathway of action of hordenine on AR was the phosphoinositide 3 kinase (PI3K)/protein kinase B (Akt) signaling pathway. The in vivo experimental results showed that the expression of PI3K and p-Akt proteins in the nasal mucosa of the model group rats was significantly increased (P < 0.01), and that the protein expression level was significantly decreased after the administration of hordenine, which was also confirmed by an in vitro experiment. This study suggests that hordenine may regulate Th1/Th2 cell balance through the PI3K/Akt signaling pathway, thereby exerting an alleviating effect on OVA-induced AR.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

Objective: To compare the clinical efficacy of visual dilated sheath combined with needle nephroscope percutaneous nephrolithotomy (PCNL) with traditional PCNL for renal calculi，so as to enhance the intraoperative safety and puncture accuracy. Methods: A retrospective analysis was conducted on 100 patients with renal calculi treated on hospital during Sep.2022 to Sep.2023.Based on the surgical approaches，patients were divided into the needle nephroscope group (PCNL with visual dilator sheath and needle nephroscope，n=52) and traditional group (traditional PCNL，n=48).Clinical characteristics，surgical parameters，and outcomes were compared between the two groups. Results: There were no significant differences between the two groups in baseline data，total operation time and hospital stay (P>0.05).The needle nephroscope group had a longer channel establishment time compared to the traditional group [20.0(17.0-22.0) min vs.16.0 (15.0-21.0) min，P=0.002]，but significantly shorter puncture time [2.0 (1.0-2.6) min vs. 2.8(2.0-3.5) min，P<0.001]，and fewer adjustments of the puncture needle (9.6% vs. 64.6%，P<0.001).The channel was successfully established on the first attempt in all patients in the needle nephroscope group，while only 41 of patients in the traditional group achieved success on the first attempt，6 cases needed 2 attempts，and 1 case needed 3 attempts.Postoperative complications were absent in the needle nephroscope group，whereas postoperative bleeding requiring interventional treatment occurred in 1 case in the traditional group.There was no significant difference in the first-stage stone-clearance rate between the two groups (88.4%vs. 85.4%，P=0.872). Conclusion: PCNL using a visual dilator sheath combined with a needle nephroscope achieves a comparable first-stage stone-clearance rate to traditional PCNL.However，it offers significant advantages in terms of shorter puncture time，fewer adjustments of the puncture needle，and lower postoperative complication rate.These findings suggest superior safety and precision，making it a valuable technique for clinical application.

This study aims to explore the mechanism of Jiaotai Pills in treating depression based on metabolomics and network pharmacology. The chemical constituents of Jiaotai Pills were identified by UHPLC-Orbitrap Exploris 480, and the targets of Jiaotai Pills and depression were retrieved from online databases. STRING and Cytoscape 3.7.2 were used to construct the protein-protein interaction network of core targets of Jiaotai Pills in treating depression and the "compound-target-pathway" network. DAVID was used for Gene Ontology(GO) function and Kyoto Encyclopedia of Genes and Genomes(KEGG) pathway enrichment analyses of the core targets. The mouse model of depression was established with chronic unpredictable mild stress(CUMS) and treated with different doses of Jiaotai Pills. The behavioral changes and pathological changes in the hippocampus were observed. UHPLC-Orbitrap Exploris 120 was used for metabolic profiling of the serum, from which the differential metabolites and related metabolic pathways were screened. A "metabolite-reaction-enzyme-gene" network was constructed for the integrated analysis of metabolomics and network pharmacology. A total of 34 chemical components of Jiaotai Pills were identified, and 143 core targets of Jiaotai Pills in treating depression were predicted, which were mainly involved in the arginine and proline, sphingolipid, and neurotrophin metabolism signaling pathways. The results of animal experiments showed that Jiaotai Pills alleviated the depression behaviors and pathological changes in the hippocampus of the mouse model of CUMS-induced depression. In addition, Jiaotai Pills reversed the levels of 32 metabolites involved in various pathways such as arginine and proline metabolism, sphingolipid metabolism, and porphyrin metabolism in the serum of model mice. The integrated analysis showed that arginine and proline metabolism, cysteine and methionine metabolism, and porphyrin metabolism might be the key pathways in the treatment of depression with Jiaotai Pills. In conclusion, metabolomics combined with network pharmacology clarifies the antidepressant mechanism of Jiaotai Pills, which may provide a basis for the clinical application of Jiaotai Pills in treating depression.
Animals ; Drugs, Chinese Herbal/chemistry* ; Depression/genetics* ; Mice ; Network Pharmacology ; Metabolomics ; Male ; Disease Models, Animal ; Humans ; Protein Interaction Maps/drug effects* ; Antidepressive Agents

This paper aimed to use non-targeted urine metabolomics to reveal the potential biomarkers of toxicity in rats with hepatic injury induced by aqueous extracts of Dictamni Cortex(ADC). Forty-eight SD rats were randomly assigned to a blank group and high-dose, medium-dose, and low-dose ADC groups, with 12 rats in each group(half male and half female), and they were administered orally for four weeks. The hepatic injury in SD rats was assessed by body weight, liver weight/index, biochemical index, L-glutathione(GSH), malondialdehyde(MDA), and pathological alterations. The qPCR was utilized to determine the expression of metabolic enzymes in the liver and inflammatory factors. Differential metabolites were screened using principal component analysis(PCA) and partial least squares-discriminant analysis(PLS-DA), followed by a metabolic pathway analysis. The Mantel test was performed to assess differential metabolites and abnormally expressed biochemical indexes, obtaining potential biomarkers. The high-dose ADC group showed a decrease in body weight and an increase in liver weight and index, resulting in hepatic inflammatory cell infiltration and hepatic steatosis. In addition, this group showed elevated levels of MDA, cytochrome P450(CYP) 3A1, interleukin-1β(IL-1β), and tumor necrosis factor-α(TNF-α), as well as lower levels of alanine transaminase(ALT) and GSH. A total of 76 differential metabolites were screened from the blank and high-dose ADC groups, which were mainly involved in the pentose phosphate pathway, tryptophan metabolism, purine metabolism, pentose and glucuronic acid interconversion, galactose metabolism, glutathione metabolism, and other pathways. The Mantel test identified biomarkers of hepatotoxicity induced by ADC in SD rats, including glycineamideribotide, dIDP, and galactosylglycerol. In summary, ADC induced hepatotoxicity by disrupting glucose metabolism, ferroptosis, purine metabolism, and other pathways in rats, and glycineamideribotide, dIDP, and galactosylglycerol could be employed as the biomarkers of its toxicity.
Animals ; Male ; Rats, Sprague-Dawley ; Rats ; Metabolomics ; Biomarkers/metabolism* ; Liver/metabolism* ; Drugs, Chinese Herbal/adverse effects* ; Female ; Chemical and Drug Induced Liver Injury/metabolism* ; Glutathione/metabolism* ; Humans

This study aims to evaluate the efficacy of Chinese medicine injections in treating transient ischemic attack(TIA) based on network Meta-analysis. Randomized controlled trial(RCT) about Chinese medicine injections in treating TIA were retrieved from PubMed, Web of Science, Cochrane Library, EMbase, CNKI, VIP, Wanfang, and SinoMed with the time interval from inception to March 1, 2024. The methodological quality of the included articles was assessed by ROB 2.0, and the GRADE system was employed to evaluate the quality of evidence. The gemtc package of R 4.1.2 was used to perform the network Meta-analysis. Finally, 63 RCTs with a total sample size of 5 750 cases were included, involving 11 Chinese medicine injections(Shuxuetong Injection, Danhong Injection, Shuxuening Injection, Ginkgo Damo Injection, Shenxiong Glucose Injection, Ligustrazine Injection, Salviae Miltiorrhizae and Ligustrazine Hydrochloride Injection, Salvianolic Acids for Injection, Dengzhan Xixin Injection, Guhong Injection, and Xueshuantong Injection). All patients received conventional western medicine treatment, and the experimental group was additionally treated with Chinese medicine injection. Network Meta-analysis yielded the following results.(1) In terms of improving the clinical total response rate, 11 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Dengzhan Xixin Injection + conventional western medicine had the best effect.(2) In terms of reducing plasma viscosity, 7 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Shenxiong Glucose Injection + conventional western medicine had the best effect.(3) In terms of reducing whole blood high shear viscosity, 6 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Guhong Injection + conventional western medicine had the best effect.(4) In terms of reducing whole blood low shear viscosity, 6 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Shuxuening Injection + conventional western medicine had the best effect.(5) In terms of reducing fibrinogen, 9 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Ginkgo Damo Injection + conventional western medicine had the best effect.(6) In terms of increasing the average blood flow velocity, 3 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Shuxuening Injection + conventional western medicine had the best effect. In summary, compared with conventional western medicine alone, Chinese medicine injections combined with conventional western medicine were effective in improving the clinical total response rate and the average blood flow velocity, as well as reducing plasma viscosity, whole blood high shear viscosity, whole blood low shear viscosity, and fibrinogen. However, due to the limited quality and quantity of the included articles, the above conclusions need to be verified by more high-quality, multi-center, and large-sample RCT.
Humans ; Drugs, Chinese Herbal/administration & dosage* ; Injections ; Ischemic Attack, Transient/drug therapy* ; Randomized Controlled Trials as Topic ; Treatment Outcome