ObjectiveTo investigate the gene expression sequence and molecular mechanisms in the local microenvironment during the subacute to chronic phases (1-28 days) in mouse models of spinal cord compression injury and hemisection spinal cord injury, thereby revealing the molecular characteristics of spinal cord repair and providing a theoretical basis for selecting therapeutic targets for spinal cord injury. MethodsThirty-six 8-9-week-old SPF-grade ICR mice were randomly divided into three groups (n=12 per group): sham-operated control (CTR) group, hemisection spinal cord injury (HSCI) group, and spinal cord compression injury (SCC) group. Mice in the CTR group underwent the same surgical preparation and anesthesia, followed by a dorsal midline incision at the T₉-T₁₀ segment. After layer-by-layer dissection and removal of the corresponding lamina, the spinal cord dura mater was fully exposed and kept intact. The cord was exposed to air for 10 minutes (matching the duration of the compression injury group), during which any instrument contact with the cord was avoided. The incision was then irrigated and sutured. The HSCI group underwent a 70% transection of the T₉ spinal cord segment using micro-instruments to establish a hemisection spinal cord injury model. The SCC group underwent sustained compression of the T₁₀ spinal cord segment for 10 minutes using a self-made compressor (a 30 g solid small iron bar) to establish a spinal cord compression injury model. Motor function recovery was assessed using the modified Basso-Beattie-Bresnahan (BBB) score on postoperative days 1, 3, 7, 14, 21, and 28. On days 7 and 14 post-operation, mice were anesthetized, and the injured spinal cord segments were harvested. The evolution of specific molecular networks in the spinal cord injury mouse models was analyzed via RNA sequencing (RNA-Seq) and enrichment analysis, and the expression of key genes was verified using real time fluorogenic quantitative PCR. ResultsBBB scores indicated that motor function recovery in the SCC group was significantly better than that in the HSCI group, with BBB scores showing a continuously increasing trend and remaining higher than those in the HSCI group over the 4-week period (P <0.001). Gene ontology （GO)and Kyoto Encyclopedia of Genes and Genomes （KEGG） enrichment analyses based on RNA-Seq differentially expressed genes revealed that, compared to the CTR group, genes related to the extracellular matrix were significantly up-regulated (P<0.05), while genes related to axon guidance were significantly down-regulated (P <0.05) in the SCC group on day 7 post-operation. On day 21, genes involved in immune regulation and the retinol signaling pathway were significantly activated in the SCC group (P<0.05). In contrast, in the HSCI group, genes associated with inflammation and immune response were significantly up-regulated (P<0.001), while genes related to neuronal differentiation and synapse formation were significantly down-regulated (P <0.001) on day 7. On day 21, genes related to cell-matrix junctions and N-methyl-D-aspartate receptors were significantly up-regulated (P<0.001) in the HSCI group. Furthermore, compared to the SCC group, the HSCI group exhibited different pathway enrichment characteristics in GO and KEGG analyses on days 7 and 21 post-injury. On day 7, genes involved in the NOD-like receptor signaling pathway and the complement and coagulation cascades were significantly up-regulated in the HSCI group (P<0.001). On day 21, genes related to the extracellular matrix-receptor interaction and the neuroactive ligand-receptor interaction pathways were significantly activated (P<0.001). Finally, real time fluorogenic quantitative PCR validation results were highly consistent with the RNA-Seq results, further confirming the differential expression trends of key genes between the SCC and HSCI groups. ConclusionThe SCC and HSCI injury models may drive distinct repair pathways: the preservation of some axons in the SCC model predisposes it toward tissue repair, whereas the HSCI model requires the coordination of more complex molecular networks to achieve a new equilibrium. This finding further deepens the understanding of the heterogeneous regulatory mechanisms underlying spinal cord injury.

Objective: To analyze the epidemiological characteristics of pulmonary tuberculosis (PTB) among college students in Yangzhou from 2020 to 2024, so as to provide a scientific basis for developing prevention and control strategies. Methods: An epidemiological investigation was conducted among 162 college students with PTB, and 7 134 of their contacts were screened. Data were obtained from the tuberculosis information management system and on campus screening records. Using descriptive epidemiological methods, trends in incidence, seasonal distribution, and bacteriological characteristics were analyzed. Results: From 2020 to 2024, the annual average incidence of pulmonary tuberculosis among college students in Yangzhou was 29.42 per 100 000, showing an overall fluctuating downward trend ( χ 2=12.36, P <0.01). Cases were mainly concentrated in summer and autumn, with the highest proportion in autumn (41.36%, 67/162), followed by summer (23.46%, 38/162). The proportion of etiologically positive cases increased from 37.21% in 2020 to 71.43% in 2024; among positive cases, the proportion of latent tuberculosis infection (LTBI) decreased from 66.67% (10/15) to 26.67% (4/15). The etiological positive rate was higher in females than in males ( χ 2= 11.76 , P <0.01). Comparison of screening methods showed that among index cases, the LTBI detection rate of the recombinant Mycobacterium tuberculosis fusion protein skin test (C-TST) was higher than that of the tuberculin skin test (TST), but the difference was not statistically significant ( χ 2=0.65, P =0.42); among close contacts, the detection rate of TST was higher than that of C-TST (15.1%,10.1%; χ 2=5.23, P <0.05). Conclusion From 2020 to 2024, the annual average incidence of pulmonary tuberculosis among college students in Yangzhou showed an overall fluctuating downward trend, with differences in TB infection screening methods and gender.

Objective To gain insights into the biological characteristics of different populations of Culex tritaeniorhynchus within and around the Yellow Sea wetland from the perspective of the occurrence of resistance, we investigated the levels of resistance to deltamethrin and kdr gene mutation in the wetland and its peripheral areas. Methods Specimens were collected from Cx. tritaeniorhynchus populations at two monitoring sites in the Rare Bird National Nature Reserve and Tiaozi Ni Wetland Scenic Area, and also from two populations in Yancheng City and the Liuhe District of Nanjing, and the resistance of these mosquitoes to deltamethrin was determined using the CDC biotest bottle method. For each concentration of deltamethrin assessed, a random subset of exposed specimens was selected for amplification of the kdr gene fragment, followed by Sanger sequencing to identify and analyze resistance-associated mutations. Results The LC50 levels of deltamethrin among mosquitoes from the four populations in Luhe, Yancheng, the Rare Bird National Nature Reserve and the Tiaozi Ni Wetland Scenic Area were 2.048 5, 7.798 2, 3.473 3, and 17.695 5 mg/mL, respectively, with corresponding concentrations of deltamethrin ranging from 0.005 to 5.000,0.050 to 50.000,0.050 to 25.000 and 0.050 to 50.000 mg/mL, respectively. Furthermore, the ranges of the KT50 values were 11.76-107.43, 67.05-216.30,29.77-107.43 and 28.40-329.51 min; the 1-h knockdown rates were 34.58%-99.15%, 9.52%-43.80%, 55.09%-73.01%, and 10.09%-68.07%; and the 24-h mortality rates were 12.15%-67.52%,9.52%-79.56%,13.17%-82.21%, and 11.01%-78.99%, respectively. With respect to kdr gene mutation, we assayed a total of 63,70,59, and 57 mosquitoes for the four populations, for which we detected L1014F mutation frequencies of 14.29%, 35.00%, 20.34%, and 31.58%, respectively, with a majority of these mutations being heterozygous for resistance. In addition, five adult mosquitoes were identified has having synonymous mutations at site 1011[i. e. , AAT(asparagine)mutation to AAC(asparagine)]. Conclusions Our findings revealed the clear resistance of Cx. tritaeniorhynchus to deltamethrin in the Yancheng region of the Yellow Sea wetland, and the resistance phenotype and kdr frequency of Cx. tritaeniorhynchus in the wetland environment were comparable to those of Cx. tritaeniorhynchus in the wetland environment, thereby indicating that the resistance of different populations of Cx. tritaeniorhynchus was homogeneous under the pressure of different insecticide selection within and around the wetland. However, the underlying mechanisms need to be further studied.

The accumulation of uremic toxins such as urea nitrogen, blood creatinine, and uric acid of patients with renal failure in vivo would lead to aggravated kidney damage. In this study, coated aldehyde oxy-starch (CAO) was used as an adsorbent to investigate its in vitro adsorption performance on renal failure indexes for urea, indoxyl sulfate (INS), monomethylamine (MMA), dimethylamine (DMA), uric acid (UA), and creatinine (Cr). The effects of variables such as pH, temperature, concentration, dosage, and time on the adsorption capacity of CAO were systematically investigated, employing analytical techniques of high-performance liquid chromatography (HPLC) and gas chromatography (GC). The results revealed that CAO exhibited a strong adsorption capacity for urea, INS, and MMA, alongside a moderate adsorption capacity for DMA, UA, and Cr. The adsorption kinetics and thermodynamic studies indicated that the adsorption of urea and UA by CAO were fitted in pseudo-first-order kinetics, and the adsorption isotherm aligned with the Freundlich adsorption model. The enthalpy change ΔH of urea in adsorption was in the range of 40 to 60 kJ·mol^-1, which demonstrated the presence of strong adsorption force due to the interactions of coordinating groups. The ΔH of UA was greater than 80 kJ·mol^-1, indicating the generation of chemical bonds during the adsorption. Both of them, Gibbs free energy ΔG was less than 0, within the range of -20 to 0 kJ·mol^-1, suggested that the adsorption of urea and UA by CAO occurred spontaneously as physical adsorption process. The adsorption entropy ΔS of urea and UA was > 0, which indicated an increase in entropy throughout the adsorption. The infrared spectroscopygram showed the formation of a chemical bond, specifically the imine bond, following the adsorption of urea by CAO, thereby indicating a chemical reaction during the adsorption. This study elucidates the adsorption mechanism of CAO on various indexes of renal failure, providing a scientific basis for its clinical usage.

Objective: To examine the association of joint effect of overweight and obesity with dyslipidemia on left ventricular hypertrophy (LVH) in children, so as to provide scientific evidence for the prevention of early cardiovascular damage in children. Methods: Data were obtained from the second followup crosssectional survey of Huantai Childhood Cardiovascular Health Cohort study in 2021, comprising 1 047 children aged 10-15 years with complete information. Based on overweight and obesity status and dyslipidemia status, all participants were divided into four groups:normal weight with normal lipid levels, normal weight with dyslipidemia, overweight and obesity with normal lipid levels, and overweight and obesity with dyslipidemia. Left ventricular mass index (LVMI) levels and prevalence of LVH across four groups were compared. Multivariate Logistic regression model was used to examine the association of joint effect of overweight and obesity with dyslipidemia on LVH in children. Results: There were significant differences in LVMI levels [(28.66±7.10, 29.63±4.71,31.49±5.86,32.65±4.80)g/m2.7] and prevalence of LVH (4.28%, 12.50%, 22.74%, 31.30%) across four groups (F/χ2=50.76, 90.92, P<0.05). After adjustment for confounding variables such as gender,age,screen time,sleep duration,fruit and vegetable intake,carbonated beverage consumption,physical activity and elevated blood pressure, compared to children with both normal weight and normal lipid levels, the risk of LVH in children with dyslipidemia alone increased (OR=3.27, 95%CI=1.57-6.82，P<0.05). Children with overweight and obesity alone also had a significantly increased risk of LVH (OR=6.33, 95%CI=3.76-10.66), and the highest risk was observed in those with both overweight and obesity with dyslipidemia (OR=9.66, 95%CI=5.35-17.43) (P<0.05). Conclusions The joint effect of overweight and obesity with dyslipidemia is positively correlated with LVH in children. To prevent LVH in children, both overweight and obesity with dyslipidemia should be paid attention to.

Objective To evaluate the environmental radioactive safety level in China, monitor the radioactivity of strontium-90 (⁹⁰Sr) in seafood from selected marine regions of China, and optimize the di-(2-ethylhexyl)phosphoric acid (HDEHP) extraction chromatography method for determining Sr-90 in seafood. Methods In 2023, seafoods of fish, shrimp, shellfish, and seaweed were collected from the Shandong Province (Bohai Sea and Yellow Sea) and Hainan Province (South China Sea). The levels of Sr in the samples were determined by inductively coupled plasma atomic emission spectrometer (ICP-AES). The ⁹⁰Sr separation were performed using HDEHP extraction chromatography, while the recovery of ⁹⁰Sr were determined by the gravitmetry with the assistant of ICP-AES. Results The content of strontium in seafoods varies greatly, and excessive strontium and calcium in seafood may lead to overestimated recovery due to insufficient leaching during chromatographic separation by HDEHP extraction. Therefore, the yttrium content in the eluent should be analyzed by ICP . The radioactivity of ⁹⁰Sr in seafood from the sea areas in Shandong Province was 0.22-1.85 Bq/kg (dry weight), and that of seafood from Hainan Province was 0.19-1.82 Bq/kg (dry weight). Conclusion For the analysis of shirmp and seaweed samples, the recovery rate of ⁹⁰Sr should be analyzed using both gravimetry and ICP-AES. There is no significant linear correlation between total Sr and ⁹⁰Sr in seafood. There is no significant difference in ⁹⁰Sr radioactivity between the seafood samples collected from Shandong and Hainan. The ⁹⁰Sr radioactivity levels of all 28 samples are below the limit specified in the Limited concentrations of radioactive materials in foods (GB 14882—1994) and are within the range of environmental background fluctuations.

Objective To organize a nationwide interlaboratory comparison for measurement of gross α and gross β radioactivity in water, and improve the laboratory analysis of gross α and gross β radioactivity in water. Methods A unified comparison protocol was developed by the organizers. The groundwater with high natural radioactivity was used as water sample and distributed randomly to the participating laboratories. The participating laboratories used routine analytical methods to measure the samples and provided information such as analytical results, original records, and test reports. The results were evaluated using z-score. Results A total of 76 laboratories participated in the comparison, all employing the evaporation concentration-α/β counting method. Among them, 69 laboratories achieved |z| ≤ 2 for both gross α and gross β radioactivity measurements, and 32 laboratories achieved |z| ≤ 0.50 for both gross α and gross β radioactivity measurements. There were 69 laboratories with qualified results and 30 laboratories with excellent results, yielding a qualified rate of 90.8% and an excellent rate of 39.5%. Seven laboratories showed unqualified results and the unqualified rate was 9.2%. Conclusion Most laboratories have the ability to analyze gross α and gross β radioactivity in water. The main reasons for the deviation in comparison results are calibration efficiency, errors in the total residue mass caused by improper water sample processing operations. By analyzing the main technical problems existed in unqualified laboratories, their ability for measurement of gross α and gross β radioactivity in water has been improved.

This paper systematically summarizes the practical experience of the 2025 Dingri earthquake emergency medical rescue in Tibet. It analyzes the requirements for earthquake medical rescue under conditions of high-altitude hypoxia, low temperature, and low air pressure. The paper provides a detailed discussion on the strategic layout of earthquake medical rescue at the national level, local government level, and through social participation. It covers the construction of rescue organizational systems, technical systems, material support systems, and information systems. The importance of building rescue teams is emphasized. In high-altitude and cold conditions, rapid response, scientific decision-making, and multi-party collaboration are identified as key elements to enhance rescue efficiency. By optimizing rescue organizational structures, strengthening the development of new equipment, and promoting telemedicine technologies, the precision and effectiveness of medical rescue can be significantly improved, providing important references for future similar disaster rescues.

Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.

Objective:To investigate the characteristics and clinical effects of laparoscopic pneumovesical Cohen and laparoscopic Lich-Gregoir ureteral replantations for the treatment of primary obstructive megaloureter (POM) in children.Methods:A randomized controlled study was conducted.The clinical data of 51 children with unilateral POM admitted to the First Affiliated Hospital of Zhengzhou University from October 2018 to October 2023 were collected.Random number table method was used in the selection of surgical methods.They were divided into the laparoscopic pneumovesical Cohen ureteral replantation group (group A, 22 cases) and the laparoscopic Lich-Gregoir ureteral replantation group (group B, 29 cases) according to the surgical method.The anterior-posterior diameter(APD), maximum ureteral diameter and differential renal function parameters on the affected side were measured by color Doppler ultrasound of the urinary system, and compared between and within the two groups before and after surgery.The operation time, blood loss and postoperative intubation time were compared between the two groups.The incidence of postoperative complications such as reflux, bladder spasm, urinary retention and urinary tract infection was recorded.The independent and paired sample t-tests were used for statistical analysis. Results:The operation time and hematuria duration of group B [(125.7±14.2) min, (1.5±0.6) d] were significantly shorter than those of group A [(142.6±14.7) min, (2.8±0.7) d] (all P<0.05). The APD, maximum ureteral diameter, and differential renal function on the affected side of group A were (21.7±7.9) mm, (11.6±3.2) mm, and (28.2±4.9)% before surgery, and (10.3±4.5) mm, (6.0±2.0) mm and (43.8±4.4)% after surgery, respectively.The APD, maximum ureteral diameter, and differential renal function on the affected side of group B were (21.1±5.6) mm, (11.3±4.6) mm, and (30.2±5.5)% before surgery, and (10.2±4.5) mm, (6.6±2.0) mm, and (42.4±5.2)% after surgery, respectively.There was no statistically significant difference in the values of APD, maximum ureteral diameter, and differential renal function before and after surgery between the two groups of children (all P>0.05). However, there were statistically significant differences in the values of APD, maximum ureteral diameter, and differential renal function before and after surgery between the same group of children (all P<0.01). No significant difference was found in intraoperative blood loss, postoperative intubation time, and postoperative complications between the two groups (all P>0.05). Conclusions:Both surgical methods are effective in the treatment of POM in children.Laparoscopic Lich-Gregoir ureteral replantation has advantages of less operation time compared with laparoscopic pneumovesical Cohen ureteral replantation.