Objective: To characterize perioperative dynamic changes in immune-cell phenotypes and inflammatory cytokines in patients undergoing CPB (cardiopulmonary bypass) cardiac surgery, and to explore their associations with postoperative outcomes. Methods: In this prospective cohort study, 120 adult patients who underwent elective cardiac surgery under CPB at West China Hospital from May 2022 to March 2023 were enrolled. Perioperative immune-cell phenotypes and concentrations of 40 inflammation-related cytokines were measured. The primary outcomes were the sequential organ failure assessment (SOFA) score at 24 h after surgery and ΔSOFA (the peak SOFA score within 48 h after surgery minus the preoperative SOFA score). Secondary outcomes included major adverse cardiovascular events (MACE), acute kidney injury (AKI), respiratory failure, severe liver injury, and infection. Results: The mean age of enrolled patients was 57±10 years. Of these, 52% (62/120) were male and 90% (108/120) underwent valve surgery. During the rewarming to the end of CPB, neutrophil counts rapidly increased (7.39×10 /L vs preoperative 3.07×10 /L, P<0.001), with significant upregulation of CD11b (7.30×10 /L vs preoperative 3.05×10 /L, P<0.001) and CD54 (7.15×10 /L vs preoperative 2.99×10 /L, P<0.001). Lymphocyte counts increased at the end of CPB (1.75×10 /L vs preoperative 1.12×10 /L, P<0.001) but decreased significantly at 24 h after surgery (0.59×10 /L vs preoperative 1.12×10 /L, P<0.001). Plasma analysis showed that multiple pro-inflammatory cytokines increased during CPB and remained elevated up to 24 h after surgery; five chemokines and the anti-inflammatory cytokine IL-10 peaked at the end of CPB. The SOFA score increased from 1 (1, 2) preoperatively to 7 (5, 10) at 24 h after surgery, with a ΔSOFA of 6 (4, 8). Within 30 days after surgery, 48 patients (40.0%) developed AKI, 17 (14.2%) developed infection, 4 (3.3%) developed severe liver injury, 3 (2.5%) developed respiratory failure, and 3 (2.5%) experienced MACE. During the 2-year follow-up, 8 patients (6.7%) experienced MACE and 5 (4.2%) died. Conclusion: Multi-organ dysfunction is common after cardiac surgery under CPB (median ΔSOFA, 6), accompanied by perioperative activation of multiple immune-cell subsets and upregulation of pro-inflammatory, anti-inflammatory, and chemotactic mediators. This study provides data-driven evidence and research clues for further investigation of the associations between CPB-related immune perturbations and postoperative organ dysfunction and clinical outcomes.

Objective To investigate the impact of dietary protein intake on the prevalence of type 2 diabetes in adult residents, and to provide a reference for formulating diabetes prevention and control measures. Methods The research was based on cross-sectional survey data from the Nutrition and Health Follow-up Study of Chinese Residents in Chongqing (2021). Energy and nutrient intake was calculated in combination with the Chinese food composition table. Multivariate logistic regression was used to analyze the association between dietary protein and diabetes, and then restricted cubic spline regression (RCS) was used to analyze the dose-response relationship between dietary protein intake and the development of diabetes. Results Among the 1 415 adult residents, dietary intake of total protein, animal protein, and plant protein was 69.69g/d, 26.26g/d, and 43.43g/d, respectively. The ratio of protein to energy supply was 14.31%, and the prevalence of diabetes was 18.02%. Comparing with the residents in the first percentile of total dietary protein intake, the multivariable-adjusted odds ratios of those in the second and third percentile were 1.754 and 2.453 respectively. Comparing the residents in the third percentile with those in the first percentile, the multivariable-adjusted odds ratios of diabetes were 1.592 for protein energy supply ratio, and 1.558 for animal protein intake. Conclusion High protein intake, high protein energy supply ratio and high animal protein intake may increase the risk of diabetes, and different types of protein may have different effects on diabetes.

OBJECTIVE To explore the association between the use of oral progesterone drugs in early pregnancy and gestational diabetes mellitus （GDM）. METHODS Through real-world retrospective cohort research method， pregnant women who underwent the oral glucose tolerance test （OGTT） at the Affiliated Maternal and Child Health Hospital of Nantong University between January 2022 and January 2023 were enrolled. Based on whether oral progesterone drugs were used in early pregnancy， they were divided into treatment group and control group； propensity score matching （PSM） with a 1∶1 ratio was employed to control for confounding factors； Logistic regression and linear regression were employed to analyze the association between drug factors （whether use of oral progesterone drug， duration of medication， dosage， and drug type） and outcome indicators （occurrence of GDM， fasting blood glucose levels， and OGTT 1 and 2 h blood glucose levels in late pregnancy）. RESULTS A total of 709 pregnant women were enrolled in the two groups before PSM； after PSM， 256 cases were included in both the treatment group and the control group. The results of association analysis indicated that there was no significant association between the use of oral progesterone drugs and GDM （P＞0.05）； but a significant correlation was found with OGTT 1 h blood glucose levels [β＝0.965， 95%CI （0.007，1.922）， P＜0.05]， specifically with Dydrogesterone tablets [β＝0.977， 95%CI （0.009， 1.944）， P＜0.05] and Progesterone soft capsules [β ＝1.089， 95%CI （0.077， 2.102）， P＜0.05]. There was no significant correlation between other drug factors and outcome indicators （P＞0.05）. CONCLUSIONS The use of oral progestogen drugs in early pregnancy is not significantly associated with GDM. The blood glucose levels in late pregnancy， especially OGTT 1 h blood glucose levels， have a certain correlation with Progesterone soft capsules and Dydrogesterone tablets.

BackgroundDementia seriously affects the quality of life and lifespan of elderly people， with Alzheimer's disease （AD） being the most common type of dementia. Previous studies have suggested that gout may reduce the risk of developing AD， but the causal relationship between the two still requires further research. ObjectiveTo investigate the potential causal relationship between gout and AD through a two-sample Mendelian randomization （MR） analysis， so as to provide references for the prevention and treatment of AD. MethodsData from Genome-Wide Association Studies （GWAS） extracted in 2024 were analyzed， using pooled data on gout （6 810 cases in the case group and 477 788 cases in the control group） published by UK Biobank in 2021 as the exposure variable， and data on AD （3 899 cases in the case group and 214 893 cases in the control group） published by FinnGen in the same year as the outcome variable. The inverse-variance weighted， MR-Egger regression， weighted median estimation， simple model and weighted model were used to analyze the potential causal relationship between gout and AD. Pleiotropic effects were assessed using MR-Egger regression. Heterogeneity assessment was conducted using Cochran's Q test. The leave-one-out analysis was carried out for sensitivity analysis. And a funnel plot was drawn to detect potential publication bias. ResultsThe inverse-variance weighted analysis demonstrated a negative causal relationship between gout and AD （OR=0.004， 95% CI： 0~0.700， P<0.05）. The plot resembled a symmetrical inversed funnel， indicating the absence of publication bias. No heterogeneity was detected by Cochran's Q test. The MR-Egger regression indicated no significant horizontal pleiotropy. Concerning the reverse directions， no significant associations between AD and gout were noted. ConclusionThere is a negative causal relationship between gout and AD， with gout potentially reducing the risk of developing AD. ［Funded by The Third Batch of Social Welfare and Basic Research Projects （Medical and Health） of Zhongshan City in 2022 （number， 2022B3017）］

Castleman's disease is a rare polyclonal lymphoproliferative disorder.This article reports the diagnosis and treatment of a 45-year-old female patient with idiopathic multicentric Castleman's disease.The patient presented recurrent fever,enlarged lymph nodes,and elevated levels of inflammation markers.After multiple serological examinations and tissue biopsies,she was diagnosed with hyaline vascular-type Castleman's disease.Initially,the patient received siltuximab targeting interleukin-6,which significantly improved her condition.Considering the cost and convenience of long-term treatment,she subsequently switched the therapy to an oral treatment regimen of thalidomide,cyclophosphamide,and prednisone (TCP),which maintained disease control.This report aims to highlight the diagnostic complexity and diversity of treatment options for idiopathic multicentric Castleman's disease,demonstrating the potential of the TCP regimen as a cost-effective treatment choice.
Humans ; Castleman Disease/drug therapy* ; Female ; Middle Aged ; Thalidomide/therapeutic use* ; Prednisone/therapeutic use* ; Cyclophosphamide/therapeutic use* ; Antibodies, Monoclonal/administration & dosage*

Nodal marginal zone B-cell lymphoma(NMZL),the least common subtype of marginal zone lymphoma,represents a low-grade malignancy arising from the marginal zone of lymph node follicles,composed of small B-cells with an inert non-Hodgkin lymphoma nature.It accounts for 1.5% to 1.8% of all non-Hodgkin lymphomas and 10% of all marginal zone lymphomas.The low incidence and lack of typical clinical and pathological features pose a challenge to the diagnosis and clinical management of NMZL.In this article,we reported the diagnosis and treatment of a case of NMZL located in the parapharyngeal space of the left neck and reviewed the relevant literature from both domestic and international sources.We summarized the clinical manifestations,histopathological features,immunohistochemical characteristics,imaging features,diagnosis and treatment modalities,and prognosis of NMZL.
Humans ; Lymphoma, B-Cell, Marginal Zone/pathology* ; Lymph Nodes/pathology* ; Neck/pathology* ; Male

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test