1.Development and evaluation of classification system for drug-related problems in China
Shuang ZOU ; Tingting LU ; Lei BAO ; Yun LIAO ; Ling LI ; Ping ZHANG
China Pharmacy 2026;37(3):371-376
OBJECTIVE To establish a Chinese drug-related problem (DRP) classification system applicable to pharmacist-led pharmaceutical care in China, providing pharmacists with an effective and practical tool for pharmaceutical care. METHODS A multi-stage process was employed to construct the DRP classification system, including literature review and analysis, comparison of existing classification systems, refinement of classification items and framework development, two rounds of standard case validation, expert discussion, and system revision. The Fleiss′ kappa test was used to calculate the consistency coefficient κ, assessing the reliability of pharmacists participating in evaluating the classification system. An electronic questionnaire comprising six items was employed to evaluate the system’s applicability. RESULTS The constructed Chinese DRP classification system comprised six sections [problem(including potential problems), DRP evaluation, cause (including possible causes of potential problems), intervention, acceptance of intervention and DRP status], with 24 primary codes and 96 secondary codes. In the first round of case validation, κ values exceeded 0.4 for all sections except “intervention” and “DRP status”. In the second round, κ values exceeded 0.4 for all sections. In the applicability evaluation of the classification system, positive ratings (“strongly agree” or “agree”) exceeded 85% for all items. Specifically, positive ratings for“the classification system can provide appropriate category selection”,“ the classification system is comprehensive”,“ the classification system is convenient to use” and “the classification system is highly satisfactory” exceeded 92%. CONCLUSIONS The Chinese DRP classification system developed demonstrates both high reliability and applicability, providing an effective and practical classification tool for pharmacists in China to conduct pharmaceutical care.
2.Perioperative immune dynamics and clinical outcomes in patients undergoing on-pump cardiac surgery
Zhiyuan CHENG ; Xinyi LIAO ; Juan WU ; Ping YANG ; Tingting WANG ; Qinjuan WU ; Wentong MENG ; Zongcheng TANG ; Jiayi SUN ; Jia TAN ; Jing LIN ; Dan LUO ; Hao WANG ; Chaonan LIU ; Jiyue XIONG ; Liqin LING ; Jing ZHOU ; Lei DU
Chinese Journal of Blood Transfusion 2026;39(1):31-43
Objective: To characterize perioperative dynamic changes in immune-cell phenotypes and inflammatory cytokines in patients undergoing CPB (cardiopulmonary bypass) cardiac surgery, and to explore their associations with postoperative outcomes. Methods: In this prospective cohort study, 120 adult patients who underwent elective cardiac surgery under CPB at West China Hospital from May 2022 to March 2023 were enrolled. Perioperative immune-cell phenotypes and concentrations of 40 inflammation-related cytokines were measured. The primary outcomes were the sequential organ failure assessment (SOFA) score at 24 h after surgery and ΔSOFA (the peak SOFA score within 48 h after surgery minus the preoperative SOFA score). Secondary outcomes included major adverse cardiovascular events (MACE), acute kidney injury (AKI), respiratory failure, severe liver injury, and infection. Results: The mean age of enrolled patients was 57±10 years. Of these, 52% (62/120) were male and 90% (108/120) underwent valve surgery. During the rewarming to the end of CPB, neutrophil counts rapidly increased (7.39×10
/L vs preoperative 3.07×10
/L, P<0.001), with significant upregulation of CD11b (7.30×10
/L vs preoperative 3.05×10
/L, P<0.001) and CD54 (7.15×10
/L vs preoperative 2.99×10
/L, P<0.001). Lymphocyte counts increased at the end of CPB (1.75×10
/L vs preoperative 1.12×10
/L, P<0.001) but decreased significantly at 24 h after surgery (0.59×10
/L vs preoperative 1.12×10
/L, P<0.001). Plasma analysis showed that multiple pro-inflammatory cytokines increased during CPB and remained elevated up to 24 h after surgery; five chemokines and the anti-inflammatory cytokine IL-10 peaked at the end of CPB. The SOFA score increased from 1 (1, 2) preoperatively to 7 (5, 10) at 24 h after surgery, with a ΔSOFA of 6 (4, 8). Within 30 days after surgery, 48 patients (40.0%) developed AKI, 17 (14.2%) developed infection, 4 (3.3%) developed severe liver injury, 3 (2.5%) developed respiratory failure, and 3 (2.5%) experienced MACE. During the 2-year follow-up, 8 patients (6.7%) experienced MACE and 5 (4.2%) died. Conclusion: Multi-organ dysfunction is common after cardiac surgery under CPB (median ΔSOFA, 6), accompanied by perioperative activation of multiple immune-cell subsets and upregulation of pro-inflammatory, anti-inflammatory, and chemotactic mediators. This study provides data-driven evidence and research clues for further investigation of the associations between CPB-related immune perturbations and postoperative organ dysfunction and clinical outcomes.
3.Investigation and health risk assessment of microbial contamination of indoor air in public places in Xi'an City
Dong LIU ; Fan GAO ; Feng ZHANG ; Ping LIU ; Ling CHANG
Journal of Public Health and Preventive Medicine 2026;37(1):78-82
Objective To investigate the microbial contamination and its influencing factors of indoor air in public places in Xi'an City, to assess the health risk of employees, and to provide a scientific basis for improving the indoor environment of public places. Methods Total bacterial count and total fungal count in indoor air were monitored in hotels/inns, shopping malls/supermarkets, gyms, and waiting rooms in Xi'an from 2023 to 2024. The health risk assessment of employees was evaluated according to the Chinese Population Exposure Parameters Manual (Adult Volume). Results Overall, the standard-exceeding rate of total bacterial count in Xi'an was 3.85%, and the median values of total bacterial count and total fungal count were 350 CFU/m3 and 300 CFU/m3, respectively. The results of the generalized linear model showed that high indoor temperature and PM10 levels were associated with increased indoor bacterial concentrations (β>0, P<0.05), while high daily passenger flow, and high indoor relative humidity and PM10 levels were associated with increased indoor fungal concentrations (β>0, P<0.05). The multivariate logistic regression showed that high levels of indoor bacterial and fungal concentrations were risk factors for respiratory discomfort among employees. The hazard quotient (HQ) values for all types of public places were less than 1, indicating that the health risk of microbial aerosol exposures for employees was relatively low. Conclusion The indoor microbial pollution in public places in Xi'an is relatively mild, but countermeasures still need to be taken to reduce indoor air microbial contamination.
4.Mechanism of Yangjing Zhongyutang in Regulating SIRT1/PGC-1α Signaling Pathway to Promote Mitochondrial Function and Alleviate Oxidative Stress Damage in Rats with Diminished Ovarian Reserve
Ping ZHANG ; Lijuan YANG ; Shenghui CHEN ; Wenliang YAO ; Yuliang ZHOU ; Ling MA ; Huiying WU ; Yanwen XU ; Ziyan ZHOU
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(7):46-55
ObjectiveTo observe the effects of Yangjing Zhongyutang (YJZYT) on mitochondrial biogenesis and oxidative stress damage mediated by the silent information regulator 1 (SIRT1)/peroxisome proliferator-activated receptor gamma coactivator-1alpha (PGC-1α) signaling pathway in cyclophosphamide (CTX)-induced rats with diminished ovarian reserve (DOR), and to explore its mechanism in improving ovarian reserve function and follicular development. MethodsForty-two 8-week-old female SD rats with normal estrous cycles were randomly divided into a blank control group (n=7) and a model group (n=35). Rats in the model group received a single intraperitoneal injection of CTX (90 mg·kg-1) to establish the DOR model. After modeling, estrous cycles were monitored for 7 consecutive days, and model success was confirmed based on criteria for estrous cycle disruption. After successful modeling, rats were divided into groups for intervention: estradiol valerate group (0.09 mg·kg-1), and YJZYT high-, medium-, and low-dose groups (19.98, 9.99, 5.00 g·kg-1). The blank control group and model group were given an equal volume of distilled water by gavage. All groups received daily gavage once for 4 consecutive weeks. The general state, body weight, and ovarian wet weight of rats were observed and recorded, and the ovarian organ index was calculated. Enzyme-linked immunosorbent assay (ELISA) was used to measure serum levels of follicle-stimulating hormone (FSH), luteinizing hormone (LH), estradiol (E2), anti-Müllerian hormone (AMH), superoxide dismutase (SOD), and glutathione peroxidase (GSH-Px). Hematoxylin-eosin (HE) staining was performed to observe ovarian histomorphological changes and follicular development status. Immunofluorescence was used to detect reactive oxygen species (ROS) expression levels. Colorimetric assays were employed to measure adenosine triphosphate (ATP) and malondialdehyde (MDA) content in ovarian tissues. Quantitative Real-time polymerase chain reaction (Real-time PCR) was used to detect mitochondrial DNA (mtDNA) copy number and the mRNA expression levels of key genes including SIRT1, PGC-1α, nuclear respiratory factor 1 (NRF1), and mitochondrial transcription factor A (TFAM). Western blot was performed to detect the protein expression levels of SIRT1, PGC-1α, NRF1, and TFAM. ResultsCompared with the blank group, rats in the model group exhibited disrupted estrous cycles, obviously reduced body weight, and decreased ovarian index (P<0.05). Ovarian histopathology revealed cortical thinning, loose structure, and a significant reduction in both primordial and growing follicles (P<0.01). Serum FSH and LH levels were significantly elevated (P<0.01), while E2 and AMH levels were obviously reduced (P<0.05, P<0.01). ATP content and mtDNA copy number decreased in ovarian tissue (P<0.01), ROS expression increased, MDA levels rose, while SOD and GSH-Px activities obviously decreased (P<0.05, P<0.01), mRNA and protein expression levels of SIRT1, PGC-1α, NRF1, and TFAM were obviously downregulated (P<0.05, P<0.01). After treatment, compared with the model group, body weight and ovarian index obviously recovered in rats administered various doses of YJZYT (P<0.05), serum E2 and AMH levels increased, while FSH and LH levels obviously decreased (P<0.05, P<0.01), ovarian tissue ATP content and mtDNA copy number were up-regulated, ROS and MDA levels decreased, and antioxidant enzymes SOD and GSH-Px activity obviously increased (P<0.05, P<0.01), Gene and protein expression levels related to the SIRT1/PGC-1α /NRF1/TFAM signaling pathway were obviously up-regulated compared to the model group (P<0.05, P<0.01), HE staining revealed that ovarian structure gradually recovered to integrity in all treatment groups, with a obviously increase in the number of primordial and growing follicles (P<0.05, P<0.01). Granulosa cells were neatly arranged, indicating marked improvement in ovarian function. ConclusionYJZYT may improve ovarian function and follicular development in rats with diminished ovarian reserve by activating the SIRT1/PGC-1α signaling pathway, promoting mitochondrial biogenesis, enhancing mitochondrial function, and alleviating oxidative stress damage.
5.Analysis of soil-borne nematode infection status among rural communities in Yubei, Chongqing
Dan JIANG ; Yong-dong HAO ; Sen-ping YANG ; Xiao-yuan SU ; Hua-jun BAI ; Bo LYU ; Ya-ling RAN ; He-yi GUAN ; Ling HU
Acta Parasitologica et Medica Entomologica Sinica 2026;33(2):85-89
Objective To analyze the infection status and epidemic trends of soil-borne nematode infections in Yubei, Chongqing City, in 2010,2021, and 2022. Methods The local populations from four survey sites of four towns in 2010 and five sites of five towns in 2021 and 2022 were surveyed regarding their basic information using a unified form. Fecal samples of the participants were collected and tested for soil-borne nematode infections using the modified Kato-Katz thick smear method. Results In 2010, 2 049 participants were surveyed, followed by 1 000 participants in 2021 and 2022. The overall prevalence of parasitic infections declined significantly from 3.86% to 0.20%. In 2010, soil-transmitted nematode included hookworms(3.81%) and roundworms(0.29%). In 2021, the infection rates of roundworms and hookworms were 1.70% and 0.10% respectively. Notably, only Ascaris was identified in 2022(0.20%). The≥60 age group consistently exhibited the highest infection rates across all surveys, followed by the 40-59 age group. The infection rates of males in the three surveys were 3.31%,1.92%, and 0.20% respectively, and those of females were 4.37%, 1.46%, and 0.20% respectively. There was no statistically significant difference in the infection rates between males and females. Educational attainment was inversely associated with infection; in 2010, the highest prevalence was observed among those with primary education or below, whereas in 2021, illiterate or semi-literate individuals showed the highest susceptibility. The occupational distribution of infections in 2010 indicated that retirees (8.33%), farmers(4.86%), and homemakers or unemployed individuals(3.45%)were the most affected. However, in 2021 and 2022, farmers emerged as the predominant occupational group with soil-transmitted nematode infections. Conclusions The infection rate of soil-borne nematodes showed a decreasing trend in Yubei, and the infection species changed from hookworms in 2010 to Ascaris in 2022. Farmers, the elderly, and people with low education levels should continue to be the focus of preventive and control efforts.
6.Unilateral congenital ptosis on ocular biometric parameters and refractive status in children
Yun FENG ; Shasha ZHANG ; Jiaojiao LIANG ; Feng XU ; Ping LIN ; Ling CHEN
International Eye Science 2026;26(8):1485-1490
AIM: To investigate differences in ocular biological parameters and refractive status among children with unilateral congenital ptosis.METHODS:This was a retrospective cohort study enrolling patients with unilateral congenital ptosis in the Department of Ophthalmology, Xi'an Children's Hospital between August 2018 and March 2025, with the contralateral healthy eyes serving as the control group. All patients underwent a detailed ophthalmic examination to assess the degree of ptosis and evaluate refractive errors. Biometric measurements were performed using the IOL Master 700 biometer, including axial length(AL), central corneal thickness(CCT), anterior chamber depth(ACD), lens thickness(LT), and astigmatism(AST).RESULTS:A total of 100 eyes from 100 children(affected eye group)with unilateral congenital ptosis were enrolled, and their 100 contralateral normal eyes without ptosis were set as the control group(healthy eyes group). Among the subjects, there were 67 males(67%)and 33 females(33%), with a mean age of 6.43±2.47 y; 45 affected eyes were the right eye and 55 were the left eye. Among the 100 patients, mild, moderate, and severe ptosis accounted for 7%, 21%, and 72%, respectively. The incidence of amblyopia in patients with unilateral congenital ptosis was 32%, all of which occurred in the affected eye. Compared with the healthy eye group, K2(total)and K2(severe ptosis)in eyes with severe ptosis were significantly lower(P<0.05), indicating that the cornea in the ptotic eye was flatter. In patients with moderate ptosis, the affected eye had a significantly greater corneal thickness(CCT)compared to the healthy eye(P<0.05), indicating that the corneas of eyes with moderate ptosis were thicker. The incidence of against-the-rule and oblique astigmatism in the affected eye group(39%)was significantly higher than that in the healthy eye group(14%); there was a significant difference in the corneal astigmatism axis between the affected and healthy eye groups(P<0.01). There were no differences in refractive status or biological parameters such as AL, K1, AST, ACD, and LT between the affected and healthy eyes.CONCLUSION:Congenital ptosis can affect refractive errors, lead to oblique and against-the-rule astigmatism, increase the prevalence of amblyopia, and also result in corneal thickening and flattening. However, it has minimal effects on AL, LT, and ACD.
7.Application of CRISPR/Cas System in Precision Medicine for Triple-negative Breast Cancer
Hui-Ling LIN ; Yu-Xin OUYANG ; Wan-Ying TANG ; Mi HU ; Mao PENG ; Ping-Ping HE ; Xin-Ping OUYANG
Progress in Biochemistry and Biophysics 2025;52(2):279-289
Triple-negative breast cancer (TNBC) represents a distinctive subtype, characterized by the absence of estrogen receptors, progesterone receptors, and human epidermal growth factor receptor 2 (HER2). Due to its high inter-tumor and intra-tumor heterogeneity, TNBC poses significant chanllenges for personalized diagnosis and treatment. The advant of clustered regular interspaced short palindromic repeats (CRISPR) technology has profoundly enhanced our understanding of the structure and function of the TNBC genome, providing a powerful tool for investigating the occurrence and development of diseases. This review focuses on the application of CRISPR/Cas technology in the personalized diagnosis and treatment of TNBC. We begin by discussing the unique attributes of TNBC and the limitations of current diagnostic and treatment approaches: conventional diagnostic methods provide limited insights into TNBC, while traditional chemotherapy drugs are often associated with low efficacy and severe side effects. The CRISPR/Cas system, which activates Cas enzymes through complementary guide RNAs (gRNAs) to selectively degrade specific nucleic acids, has emerged as a robust tool for TNBC research. This technology enables precise gene editing, allowing for a deeper understanding of TNBC heterogeneity by marking and tracking diverse cell clones. Additionally, CRISPR facilitates high-throughput screening to promptly identify genes involved in TNBC growth, metastasis, and drug resistance, thus revealing new therapeutic targets and strategies. In TNBC diagnostics, CRISPR/Cas was applied to develop molecular diagnostic systems based on Cas9, Cas12, and Cas13, each employing distinct detection principles. These systems can sensitively and specifically detect a variety of TNBC biomarkers, including cell-specific DNA/RNA and circulating tumor DNA (ctDNA). In the realm of precision therapy, CRISPR/Cas has been utilized to identify key genes implicated in TNBC progression and treatment resistance. CRISPR-based screening has uncovered potential therapeutic targets, while its gene-editing capabilities have facilitated the development of combination therapies with traditional chemotherapy drugs, enhancing their efficacy. Despite its promise, the clinical translation of CRISPR/Cas technology remains in its early stages. Several clinical trials are underway to assess its safety and efficacy in the treatment of various genetic diseases and cancers. Challenges such as off-target effects, editing efficiency, and delivery methods remain to be addressed. The integration of CRISPR/Cas with other technologies, such as 3D cell culture systems, human induced pluripotent stem cells (hiPSCs), and artificial intelligence (AI), is expected to further advance precision medicine for TNBC. These technological convergences can offer deeper insights into disease mechanisms and facilitate the development of personalized treatment strategies. In conclusion, the CRISPR/Cas system holds immense potential in the precise diagnosis and treatment of TNBC. As the technology progresses and becomes more costs-effective, its clinical relevance will grow, and the translation of CRISPR/Cas system data into clinical applications will pave the way for optimal diagnosis and treatment strategies for TNBC patients. However, technical hurdles and ethical considerations require ongoing research and regulation to ensure safety and efficacy.
8.Intramedullary administration of tranexamic acid reduces bleeding in proximal femoral nail antirotation surgery for intertrochanteric fractures in elderly individuals: A randomized controlled trial.
Xiang-Ping LUO ; Jian PENG ; Ling ZHOU ; Hao LIAO ; Xiao-Chun JIANG ; Xiong TANG ; Dun TANG ; Chao LIU ; Jian-Hui LIU
Chinese Journal of Traumatology 2025;28(3):201-207
PURPOSE:
Intertrochanteric fractures undergoing proximal femoral nail antirotation (PFNA) surgery are associated with significant hidden blood loss. This study aimed to explore whether intramedullary administration of tranexamic acid (TXA) can reduce bleeding in PFNA surgery for intertrochanteric fractures in elderly individuals.
METHODS:
A randomized controlled trial was conducted from January 2019 to December 2022. Patients aged over 60 years with intertrochanteric fractures who underwent intramedullary fixation surgery with PFNA were eligible for inclusion and grouped according to random numbers. A total of 249 patients were initially enrolled, of which 83 were randomly allocated to the TXA group and 82 were allocated to the saline group. The TXA group received intramedullary perfusion of TXA after the bone marrow was reamed. The primary outcomes were total peri-operative blood loss and post-operative transfusion rate. The occurrence of adverse events was also recorded. Continuous data was analyzed by unpaired t-test or Mann-Whitney U test, and categorical data was analyzed by Pearson Chi-square test.
RESULTS:
The total peri-operative blood loss (mL) in the TXA group was significantly lower than that in the saline group (577.23 ± 358.02 vs. 716.89 ± 420.30, p = 0.031). The post-operative transfusion rate was 30.67% in the TXA group and 47.95% in the saline group (p = 0.031). The extent of post-operative deep venous thrombosis and the 3-month mortality rate were similar between the 2 groups.
CONCLUSION
We observed that intramedullary administration of TXA in PFNA surgery for intertrochanteric fractures in elderly individuals resulted in less peri-operative blood loss and decreased transfusion rate, without any adverse effects, and is, thus, recommended.
Humans
;
Tranexamic Acid/administration & dosage*
;
Hip Fractures/surgery*
;
Male
;
Aged
;
Female
;
Fracture Fixation, Intramedullary/adverse effects*
;
Blood Loss, Surgical/prevention & control*
;
Antifibrinolytic Agents/administration & dosage*
;
Aged, 80 and over
;
Bone Nails
;
Middle Aged
;
Blood Transfusion/statistics & numerical data*
9.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
10.Predictive factors for hemodynamically significant patent ductus arteriosus in preterm infants and the construction of a nomogram prediction model.
Jun MU ; Shu-Shu LI ; Ai-Ling SU ; Shu-Ping HAN ; Jin-Gai ZHU
Chinese Journal of Contemporary Pediatrics 2025;27(3):279-285
OBJECTIVES:
To explore the predictive factors for hemodynamically significant patent ductus arteriosus (hsPDA) in preterm infants and to construct a nomogram prediction model for hsPDA occurrence in this population.
METHODS:
A retrospective analysis was conducted on the clinical data of preterm infants with gestational age <32 weeks diagnosed with patent ductus arteriosus (PDA) who were delivered at Nanjing Women and Children's Healthcare Hospital from January 2020 to December 2022. The subjects were divided into an hsPDA group (52 cases) and a non-hsPDA group (176 cases) based on the presence of hsPDA. Univariate analysis and multivariate logistic regression analysis were performed to screen predictive variables regarding the general information of the infants at birth, maternal pregnancy and delivery conditions, and relevant indicators during hospitalization. A nomogram prediction model for hsPDA occurrence was constructed using R software in preterm infants. Internal validation was performed using the Bootstrap method. Finally, the predictive model was evaluated for calibration, discrimination ability, and clinical utility.
RESULTS:
Multivariate regression analysis showed that the ratio of the left atrium to aorta diameter (LA/AO), mode of delivery (vaginal), and duration of mechanical ventilation were independent predictive factors for hsPDA in preterm infants (P<0.05). Based on the results of univariate analysis and multivariate logistic regression analysis, variables used to construct the nomogram prediction model for hsPDA risk included: LA/AO ratio, mode of delivery (vaginal), duration of mechanical ventilation, 5-minute Apgar score, and the presence of neonatal respiratory distress syndrome requiring surfactant therapy. The area under the receiver operating characteristic curve for this model was 0.876 (95%CI: 0.824-0.927), and the calibrated curve was close to the ideal reference line, indicating good calibration. The Hosmer-Lemeshow test demonstrated that the model fit well, and the clinical decision curve was above the extreme curves.
CONCLUSIONS
The nomogram prediction model, constructed using five variables (LA/AO ratio, vaginal delivery, duration of mechanical ventilation, 5-minute Apgar score, and the presence of neonatal respiratory distress syndrome requiring surfactant therapy), has reference significance for predicting the occurrence of hsPDA in preterm infants and provides valuable guidance for the early clinical identification of hsPDA.
Humans
;
Ductus Arteriosus, Patent/etiology*
;
Nomograms
;
Female
;
Infant, Newborn
;
Infant, Premature
;
Retrospective Studies
;
Male
;
Hemodynamics
;
Logistic Models
;
Pregnancy


Result Analysis
Print
Save
E-mail