1.Precise detection of weak partial D type 15 in the Chinese population: evaluation of their potential impact on blood transfusion safety and development of appropriate response strategies
Xu ZHANG ; Zhuren ZHOU ; Xuying HUANG ; Lichun LI ; Weiwei LI ; Ping HOU ; Xiaofeng LI ; Jianping LI
Chinese Journal of Blood Transfusion 2025;38(8):1030-1034
Objective: To investigate the precise detection methods for weak partial D type 15 and evaluate their implications for blood transfusion safety, along with the development of corresponding strategies. Methods: A combination of serological methods, including the microplate method, indirect antiglobulin tube method, and microcolumn gel card method, was employed to identify RhD-negative and RhD variant samples. RhD-negative samples were screened for the presence of RHD genes using whole-blood direct PCR amplification. Subsequently, RhD variant samples and RhD-negative samples containing RHD genes underwent full-coding-region sequencing of the RHD gene to confirm their genotypes. The genotyping results were further correlated with the serological test findings for comprehensive analysis. Results: Among 615 549 first-time healthy blood donors, 3 401 samples with an RhD-negative phenotype and 156 samples with RhD variant were identified. Of the 3 401 RhD-negative samples, 1 054 were found to harbor RHD genes. Gene sequencing analysis of the 156 RhD variants and the 1 054 serological negative samples revealed that 89 samples contained the RHD
15 (c. 845G>A) allele. Conclusion: The integration of serological testing methods and genotyping technologies for the precise determination of RhD blood type plays a critical role in ensuring the safety and compatibility of blood transfusions.
2.Study on mechanism of Yourenji Capsules in improving osteoporosis based on network pharmacology and proteomics.
Yun-Hang GAO ; Han LI ; Jian-Liang LI ; Ling SONG ; Teng-Fei CHEN ; Hong-Ping HOU ; Bo PENG ; Peng LI ; Guang-Ping ZHANG
China Journal of Chinese Materia Medica 2025;50(2):515-526
This study aimed to explore the pharmacological mechanism of Yourenji Capsules(YRJ) in improving osteoporosis by combining network pharmacology and proteomics technologies. The SD rats were randomly divided into a blank control group and a 700 mg·kg~(-1) YRJ group. The rats were subjected to gavage administration with the corresponding drugs, and the blank serum, drug-containing serum, and YRJ samples were compared using ultra performance liquid chromatography-quadrupole time-of-flight tandem mass spectrometry(UPLC-Q-TOF-MS/MS) to analyze the main components absorbed into blood. Network pharmacology analysis was conducted based on the YRJ components absorbed into blood to obtain related targets of the components and target genes involved in osteoporosis, and Venn diagrams were used to identify the intersection of drug action targets and disease targets. The STRING database was used for protein-protein interaction(PPI) network analysis of potential target proteins to construct a PPI network. Gene Ontology(GO) functional enrichment and Kyoto Encyclopedia of Genes and Genomes(KEGG) pathway enrichment were performed using Enrichr to investigate the potential mechanism of action of YRJ. Ovariectomy(OVX) was performed to establish a rat model of osteoporosis, and the rats were divided into a sham group, a model group, and a 700 mg·kg~(-1) YRJ group. The rats were given the corresponding drugs by gavage. The femurs of the rats were subjected to label-free proteomics analysis to detect differentially expressed proteins, and GO functional enrichment and KEGG pathway enrichment analyses were performed on the differentially expressed proteins. With the help of network pharmacology and proteomics results, the mechanism by which YRJ improves osteoporosis was predicted. The analysis of the YRJ components absorbed into blood revealed 23 bioactive components of YRJ, and network pharmacology results indicated that key targets involved include tumor necrosis factor(TNF), tumor protein p53(TP53), protein kinase(AKT1), and matrix metalloproteinase 9(MMP9). These targets are mainly involved in osteoclast differentiation, estrogen signaling pathways, and nuclear factor-kappa B(NF-κB) signaling pathways. Additionally, the proteomics analysis highlighted important pathways such as peroxisome proliferator-activated receptor(PPAR) signaling pathways, mitogen-activated protein kinase(MAPK) signaling pathways, and β-alanine metabolism. The combined approaches of network pharmacology and proteomics have revealed that the mechanism by which YRJ improves osteoporosis may be closely related to the regulation of inflammation, osteoblast, and osteoclast metabolic pathways. The main pathways involved include the NF-κB signaling pathways, MAPK signaling pathways, and PPAR signaling pathways, among others.
Animals
;
Drugs, Chinese Herbal/administration & dosage*
;
Osteoporosis/metabolism*
;
Proteomics
;
Rats
;
Rats, Sprague-Dawley
;
Network Pharmacology
;
Female
;
Protein Interaction Maps/drug effects*
;
Capsules
;
Humans
;
Signal Transduction/drug effects*
3.UPLC-Q-TOF-MS combined with network pharmacology reveals effect and mechanism of Gentianella turkestanorum total extract in ameliorating non-alcoholic steatohepatitis.
Wu DAI ; Dong-Xuan ZHENG ; Ruo-Yu GENG ; Li-Mei WEN ; Bo-Wei JU ; Qiang HOU ; Ya-Li GUO ; Xiang GAO ; Jun-Ping HU ; Jian-Hua YANG
China Journal of Chinese Materia Medica 2025;50(7):1938-1948
This study aims to reveal the effect and mechanism of Gentianella turkestanorum total extract(GTI) in ameliorating non-alcoholic steatohepatitis(NASH). UPLC-Q-TOF-MS was employed to identify the chemical components in GTI. SwissTarget-Prediction, GeneCards, OMIM, and TTD were utilized to screen the targets of GTI components and NASH. The common targets shared by GTI components and NASH were filtered through the STRING database and Cytoscape 3.9.0 to identify core targets, followed by GO and KEGG enrichment analysis. AutoDock was used for molecular docking of key components with core targets. A mouse model of NASH was established with a methionine-choline-deficient high-fat diet. A 4-week drug intervention was conducted, during which mouse weight was monitored, and the liver-to-brain ratio was measured at the end. Hematoxylin-eosin staining, Sirius red staining, and oil red O staining were employed to observe the pathological changes in the liver tissue. The levels of various biomarkers, including aspartate aminotransferase(AST), alanine aminotransferase(ALT), hydroxyproline(HYP), total cholesterol(TC), triglycerides(TG), low-density lipoprotein cholesterol(LDL-C), high-density lipoprotein cholesterol(HDL-C), malondialdehyde(MDA), superoxide dismutase(SOD), and glutathione(GSH), in the serum and liver tissue were determined. RT-qPCR was conducted to measure the mRNA levels of interleukin 1β(IL-1β), interleukin 6(IL-6), tumor necrosis factor α(TNF-α), collagen type I α1 chain(COL1A1), and α-smooth muscle actin(α-SMA). Western blotting was conducted to determine the protein levels of IL-1β, IL-6, TNF-α, and potential drug targets identified through network pharmacology. UPLC-Q-TOF/MS identified 581 chemical components of GTI, and 534 targets of GTI and 1 157 targets of NASH were screened out. The topological analysis of the common targets shared by GTI and NASH identified core targets such as IL-1β, IL-6, protein kinase B(AKT), TNF, and peroxisome proliferator activated receptor gamma(PPARG). GO and KEGG analyses indicated that the ameliorating effect of GTI on NASH was related to inflammatory responses and the phosphoinositide 3-kinase(PI3K)/AKT pathway. The staining results demonstrated that GTI ameliorated hepatocyte vacuolation, swelling, ballooning, and lipid accumulation in NASH mice. Compared with the model group, high doses of GTI reduced the AST, ALT, HYP, TC, and TG levels(P<0.01) while increasing the HDL-C, SOD, and GSH levels(P<0.01). RT-qPCR results showed that GTI down-regulated the mRNA levels of IL-1β, IL-6, TNF-α, COL1A1, and α-SMA(P<0.01). Western blot results indicated that GTI down-regulated the protein levels of IL-1β, IL-6, TNF-α, phosphorylated PI3K(p-PI3K), phosphorylated AKT(p-AKT), phosphorylated inhibitor of nuclear factor kappa B alpha(p-IκBα), and nuclear factor kappa B(NF-κB)(P<0.01). In summary, GTI ameliorates inflammation, dyslipidemia, and oxidative stress associated with NASH by regulating the PI3K/AKT/NF-κB signaling pathway.
Animals
;
Non-alcoholic Fatty Liver Disease/genetics*
;
Mice
;
Network Pharmacology
;
Male
;
Drugs, Chinese Herbal/administration & dosage*
;
Chromatography, High Pressure Liquid
;
Liver/metabolism*
;
Mice, Inbred C57BL
;
Humans
;
Mass Spectrometry
;
Tumor Necrosis Factor-alpha/metabolism*
;
Disease Models, Animal
;
Molecular Docking Simulation
4.Material basis of bitter taste and taste-effect relationship in Cistanche deserticola based on UPLC-Q-Orbitrap HRMS combined with molecular docking.
Li-Ying TIAN ; Ming-Jie LI ; Qiang HOU ; Zheng-Yuan WANG ; Ai-Sai-Ti GULIZIYE ; Jun-Ping HU
China Journal of Chinese Materia Medica 2025;50(6):1569-1580
Based on ultra-performance liquid chromatography-quadrupole-electrostatic field Orbitrap high-resolution mass spectrometry(UPLC-Q-Orbitrap HRMS) technology and molecular docking, the bitter-tasting substances(hereafter referred to as "bitter substances") in Cistanche deserticola extract were investigated, and the bitter taste and efficacy relationship was explored to lay the foundation for future research on de-bittering and taste correction. Firstly, UPLC-Q-Orbitrap HRMS was used for the qualitative analysis of the constituents of C. deserticola, and 69 chemical components were identified. These chemical components were then subjected to molecular docking with the bitter taste receptor, leading to the screening of 20 bitter substances, including 6 phenylethanol glycosides, 5 flavonoids, 3 phenolic acids, 2 cycloalkenyl ether terpenes, 2 alkaloids, and 2 other components. Nine batches of fresh C. deserticola samples were collected from the same origin but harvested at different months. These samples were divided into groups based on harvest month and plant part. The bitterness was quantified using an electronic tongue, and the content of six potential bitter-active compounds(pineconotyloside, trichothecene glycoside, tubulin A, iso-trichothecene glycoside, jinshihuaoside, and jingnipinoside) was determined by high-performance liquid chromatography(HPLC). The total content of phenylethanol glycosides, polysaccharides, alkaloids, flavonoids, and phenolic acids was determined using UV-visible spectrophotometry. Chemometric analyses were then conducted, including Pearson's correlation analysis, gray correlation analysis, and orthogonal partial least squares discriminant analysis(OPLS-DA), to identify the bitter components in C. deserticola. The results were consistent with the molecular docking findings, and the two methods mutually supported each other. Finally, network pharmacological predictions and analyses were performed to explore the relationship between the targets of bitter substances and their efficacy. The results indicated that key targets of the bitter substances included EGFR, PIK3CB, and PTK2. These substances may exert their bitter effects by acting on relevant disease targets, confirming that the bitter substances in C. deserticola are the material basis of its bitter taste efficacy. In conclusion, this study suggests that the phenylethanol glycosides, primarily pineconotyloside, mauritiana glycoside, and gibberellin, are the material basis for the "bitter taste" of C. deserticola. The molecular docking technique plays a guiding role in the screening of bitter substances in traditional Chinese medicine(TCM). The bitter substances in C. deserticola not only contribute to its bitter taste but also support the concept of the "taste-efficacy" relationship in TCM, providing valuable insights and references for future research in this area.
Molecular Docking Simulation
;
Taste
;
Chromatography, High Pressure Liquid
;
Cistanche/chemistry*
;
Drugs, Chinese Herbal/chemistry*
;
Humans
;
Mass Spectrometry
5.Effects of Saccharomyces cerevisiae chassis cells with different squalene content on triterpenoid synthesis.
Feng ZHANG ; Kang-Xin HOU ; Yue ZHANG ; Hong-Ping HOU ; Yue ZHANG ; Chao-Yue LIU ; Xue-Mi HAO ; Jia LIU ; Cai-Xia WANG
China Journal of Chinese Materia Medica 2025;50(8):2130-2136
Many triterpenoid compounds have been successfully heterologously synthesized in Saccharomyces cerevisiae. To increase the yield of triterpenoids, various metabolic engineering strategies have been developed. One commonly applied strategy is to enhance the supply of precursors, which has been widely used by researchers. Squalene, as a precursor to triterpenoid biosynthesis, plays a crucial role in the synthesis of these compounds. This study primarily investigates the effect of different squalene levels in chassis strains on the synthesis of triterpenoids(oleanolic acid and ursolic acid), and the underlying mechanisms are further explored using real-time quantitative PCR(qPCR) analysis. The results demonstrate that the chassis strain CB-9-5, which produces high levels of squalene, inhibits the synthesis of oleanolic acid and ursolic acid. In contrast, chassis strains with moderate to low squalene production, such as Y8-1 and CNPK, are more conducive to the synthesis of oleanolic acid and ursolic acid. The qPCR analysis reveals that the expression levels of ERG1, βAS, and CrCYP716A154 in the oleanolic acid-producing strain CB-OA are significantly lower than those in the control strains C-OA and Y-OA, suggesting that high squalene production in the chassis strains suppresses the transcription of certain genes, leading to a reduced yield of triterpenoids. Our findings indicate that when constructing S. cerevisiae strains for triterpenoid production, chassis strains with high squalene content may suppress the expression of certain genes, ultimately lowering their production, whereas chassis strains with moderate squalene levels are more favorable for triterpenoid biosynthesis.
Squalene/analysis*
;
Saccharomyces cerevisiae/genetics*
;
Triterpenes/metabolism*
;
Metabolic Engineering
;
Oleanolic Acid/biosynthesis*
;
Ursolic Acid
6.A finite element biomechanical study of anterior transpedicular root screw plate fixation system in the lower cervical spine.
Xiao-Ping XU ; Zhi-Peng HOU ; Liu-Jun ZHAO
China Journal of Orthopaedics and Traumatology 2025;38(8):848-855
OBJECTIVE:
To establish a two-segment vertebrectomy model using the finite element method, and to measure and compare the biomechanical properties of the lower cervical anterior transpedicular root screw (ATPRS) plate system, lower cervical anterior pedicle screw (ATPS) plate system, and lower cervical anterior cervical locked-plate (ACLP) system on this model.
METHODS:
CT data of the cervical spine (C0-T1) from a 34-year-old healthy adult male volunteer were collected. A nonlinear complete model of the lower cervical spine (C3-C7) was established using Mimics 10.01 software, based on which the ATPRS fixation model, ATPS fixation model, and ACLP fixation model were constructed respectively. An axial pressure of 75 N and a pure couple moment of 1.5 N·m were applied to C3 to make the model perform flexion-extension, left-right lateral bending, and left-right rotation movements. The range of motion (ROM) and stress distribution of each model under different working conditions were compared.
RESULTS:
The ROM of the C4-C7 segments in the ACLP group, ATPS group, and ATPRS group was reduced to 0.65° (-95.2%), 0.58° (-95.7%), and 0.62° (-95.4%) respectively compared with the intact model during flexion-extension movement;during lateral bending movement, it was reduced to 0.58° (-95.2%), 0.51°(-95.8%), and 0.60° (-95.1%) respectively;during rotation movement, it was reduced to 1.17° (-89.6%), 1.26° (-88.8%), and 1.27°(-88.7%) respectively. In terms of the stress on the titanium mesh graft, the ATPS group and ATPRS group had the maximum load during extension and the minimum load during flexion. Compared with the ACLP group, the stress on the titanium mesh graft in ATPS and ATPRS decreased by (-33.7%) and (-15.8%) in flexion, (-29.4%) and (-13.2%) in extension, (-26.2%) and (-23.4%) in lateral bending, and (-18.8%) and (-5.4%) in rotation, respectively. In terms of bone-screw interface stress, the peak bone stress near the C7 screw in the ACLP group, ATPS group, and ATPRS group increased by 49.2%, 45.0%, and 47.6% respectively compared with the peak bone stress near the C4 screw during extension. However, during flexion and lateral bending, there was no significant difference in the peak bone stress near the C4 and C7 screws. During rotation, the difference between the peak bone stress near the C4 screw and that near the C7 screw showed that in the ACLP group, left rotation (37.6%) was similar to right rotation (36.7%), while in the ATPS group and ATPRS group, left rotation was lower than right rotation.
CONCLUSION
Compared with the ACLP group, the ATPS group and ATPRS group have greater fixation stiffness and more stable fixation. However, in rotational movement, due to the uneven distribution of fixation stiffness, the stress distribution during torsion is uneven, but it is still better than the ACLP group. This indicates that ATPRS, like ATPS, has good primary stability, providing favorable conditions for bone graft fusion.
Humans
;
Finite Element Analysis
;
Male
;
Cervical Vertebrae/physiopathology*
;
Adult
;
Biomechanical Phenomena
;
Bone Plates
;
Bone Screws
;
Range of Motion, Articular
;
Fracture Fixation, Internal
7.Pathophysiological mechanisms linking chronic stress and cervical spondylosis of vertebral artery type: A theoretical framework of the neuroendocrine-immune network.
Kai HU ; Ping DONG ; Hao WU ; Yue WANG ; Ruijie HOU ; Guangyuan YAO
Chinese Journal of Cellular and Molecular Immunology 2025;41(7):655-660
Stress is a critical inducer in the onset and progression of many chronic diseases. Prolonged or intense stress can disrupt the overall balance between the nervous, immune, and endocrine systems. The resulting biological signals may act on corresponding receptors in the cervical spine region, leading to adverse pathological changes. The vertebral artery and the surrounding muscular and connective tissues are influenced by biomechanical abnormalities and inflammatory cascades associated with cervical spondylosis of vertebral artery type (CSA), which promotes the release of various hormones. These hormones, through the neuroendocrine-immune system, affect the central nervous system, inducing or exacerbating negative emotional feedback and thereby establishing a "central-local-central" vicious cycle. This article explores the mechanisms underlying the impact of stress on the key CSA symptoms through the neuroendocrine-immune network (NEI) theory, providing a more comprehensive framework for targeted therapeutic interventions in CSA.
Humans
;
Neurosecretory Systems/immunology*
;
Spondylosis/etiology*
;
Vertebral Artery/immunology*
;
Stress, Psychological/complications*
;
Chronic Disease
8.One-year recovery after lateral retinaculum release combined with chondroplasty in patients with lateral patellar compression syndrome.
Zhen-Long LIU ; Yi-Ting WANG ; Jin-Ming LIN ; Wu-Ji ZHANG ; Jiong-Yuan LI ; Zhi-Hui HE ; Yue-Yang HOU ; Jian-Li GAO ; Wei-Li SHI ; Yu-Ping YANG
Chinese Journal of Traumatology 2025;28(6):462-468
PURPOSE:
Lateral patellar compression syndrome (LPCS) is characterized by a persistent abnormally high stress exerted on the lateral articular surface of the patella due to lateral patellar tilt without dislocation and lateral retinaculum contracture, leading to anterior knee pain. The purpose of this study is to evaluate the efficacy and prognosis of lateral retinaculum release (LRR) combined with chondroplasty in the treatment of LPCS.
METHODS:
This retrospective study evaluated 40 patients who underwent LRR combined with chondroplasty for LPCS between 2020 and 2021. The assessment included improvement in postoperative tenderness and knee joint function. Patients were evaluated using the Lysholm, Tegner, and International Knee Documentation Committee 2000 scoring systems, as well as the visual analog scale, both preoperatively and postoperatively, with the paired comparisons analyzed using a t-test. Additionally, intraoperative observations were made regarding knee joint lesions, including cartilage damage and osteophyte formation, with analysis by the Chi-square test.
RESULTS:
The visual analog scale score for tenderness showed a significant decrease after surgery (p < 0.001). Evaluation of knee joint function also indicated significant improvements, as demonstrated by increased Lysholm, Tegner, and International Knee Documentation Committee 2000 scores postoperatively (p < 0.001, p = 0.011, p < 0.001, respectively). Furthermore, all LPCS patients included in the study presented with cartilage injuries and osteophyte formation. Significant differences were noted in the incidence of cartilage damage and osteophyte formation at different locations within the knee among patients with LPCS.
CONCLUSION
LRR combined with chondroplasty is an effective surgical approach for treating patients with LPCS, with satisfactory recovery observed at the 1-year follow-up. Additionally, the incidence of cartilage damage and osteophyte formation in LPCS patients varies significantly depending on the specific location within the knee joint.
Humans
;
Male
;
Female
;
Retrospective Studies
;
Adult
;
Middle Aged
;
Patella/surgery*
;
Knee Joint/physiopathology*
;
Recovery of Function
;
Young Adult
;
Treatment Outcome
;
Cartilage, Articular/surgery*
;
Adolescent
9.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
10.Glucocorticoid Discontinuation in Patients with Rheumatoid Arthritis under Background of Chinese Medicine: Challenges and Potentials Coexist.
Chuan-Hui YAO ; Chi ZHANG ; Meng-Ge SONG ; Cong-Min XIA ; Tian CHANG ; Xie-Li MA ; Wei-Xiang LIU ; Zi-Xia LIU ; Jia-Meng LIU ; Xiao-Po TANG ; Ying LIU ; Jian LIU ; Jiang-Yun PENG ; Dong-Yi HE ; Qing-Chun HUANG ; Ming-Li GAO ; Jian-Ping YU ; Wei LIU ; Jian-Yong ZHANG ; Yue-Lan ZHU ; Xiu-Juan HOU ; Hai-Dong WANG ; Yong-Fei FANG ; Yue WANG ; Yin SU ; Xin-Ping TIAN ; Ai-Ping LYU ; Xun GONG ; Quan JIANG
Chinese journal of integrative medicine 2025;31(7):581-589
OBJECTIVE:
To evaluate the dynamic changes of glucocorticoid (GC) dose and the feasibility of GC discontinuation in rheumatoid arthritis (RA) patients under the background of Chinese medicine (CM).
METHODS:
This multicenter retrospective cohort study included 1,196 RA patients enrolled in the China Rheumatoid Arthritis Registry of Patients with Chinese Medicine (CERTAIN) from September 1, 2019 to December 4, 2023, who initiated GC therapy. Participants were divided into the Western medicine (WM) and integrative medicine (IM, combination of CM and WM) groups based on medication regimen. Follow-up was performed at least every 3 months to assess dynamic changes in GC dose. Changes in GC dose were analyzed by generalized estimator equation, the probability of GC discontinuation was assessed using Kaplan-Meier curve, and predictors of GC discontinuation were analyzed by Cox regression. Patients with <12 months of follow-up were excluded for the sensitivity analysis.
RESULTS:
Among 1,196 patients (85.4% female; median age 56.4 years), 880 (73.6%) received IM. Over a median 12-month follow-up, 34.3% (410 cases) discontinued GC, with significantly higher rates in the IM group (40.8% vs. 16.1% in WM; P<0.05). GC dose declined progressively, with IM patients demonstrating faster reductions (median 3.75 mg vs. 5.00 mg in WM at 12 months; P<0.05). Multivariate Cox analysis identified age <60 years [P<0.001, hazard ratios (HR)=2.142, 95% confidence interval (CI): 1.523-3.012], IM therapy (P=0.001, HR=2.175, 95% CI: 1.369-3.456), baseline GC dose ⩽7.5 mg (P=0.003, HR=1.637, 95% CI: 1.177-2.275), and absence of non-steroidal anti-inflammatory drugs use (P=0.001, HR=2.546, 95% CI: 1.432-4.527) as significant predictors of GC discontinuation. Sensitivity analysis (545 cases) confirmed these findings.
CONCLUSIONS
RA patients receiving CM face difficulties in following guideline-recommended GC discontinuation protocols. IM can promote GC discontinuation and is a promising strategy to reduce GC dependency in RA management. (Trial registration: ClinicalTrials.gov, No. NCT05219214).
Adult
;
Aged
;
Female
;
Humans
;
Male
;
Middle Aged
;
Arthritis, Rheumatoid/drug therapy*
;
Glucocorticoids/therapeutic use*
;
Medicine, Chinese Traditional
;
Retrospective Studies

Result Analysis
Print
Save
E-mail