1.The correlation between sleep disorder and bone mineral density and fracture risk in patients with type 2 diabetes mellitus
Jiali QIN ; Minting HUANG ; Xingyao XIAO ; Huanjun WANG ; Lin LI ; Yinzhen PI
Chinese Journal of Diabetes 2024;32(7):519-523
Objective To analyze the correlation between sleep disorder and bone mineral density(BMD)and fracture risk in middle-aged and elderly patients with type 2 diabetes mellitus(T2DM).Methods 150 T2DM patients over 50 years old who were hospitalized in the Endocrine Metabolism Department of Changsha First Hospital from September 2022 to April 2023 were selected.According to the Pittsburgh Sleep Quality Index(PSQI),they were divided into a non-sleep disorder group(66 cases)and a sleep disorder group(84 cases).The general data and biochemical indicators of the two groups were compared.The relationship between sleep disorder and BMD,fracture risk was analyzed.Results Compared with the non-sleep disorder group,HbA1c,FPG,female proportion,the proportion of hypnotics and risk scores of vertebral fracture in the sleep disorder group were higher,and BMI,BMD of femoral neck and hip were lower(P<0.05).Pearson correlation analysis showed a negative correlation between PSQI score and BMD of femoral neck and hip(P<0.05).Pearson or Spearman correlation analysis showed that the risk scores of vertebral fracture was positively correlated with age,duration of DM,use of hypnotics and sleep disorder(P<0.05 or P<0.01),and negatively correlated with BMD of femoral neck and hip(P<0.01).Binary logistic regression analysis showed that FPG,use of hypnotics and hip BMD were influencing factors of sleep disorders,while sleep disorders and PSQI scores were influencing factors of osteoporosis.Conclusions For middle-aged and elderly T2DM patients,improving sleep may help reduce the occurrence of osteoporosis and reduce the risk of fractures.
2.Clinical, imaging and histopathological features of two cases of hypothyroid myopathy
Ming JIN ; Haizhu CHEN ; Guorong XU ; Xiaodan LIN ; Naiqing CAI ; Xinyi LIU ; Minting LIN ; Ning WANG ; Zhiqiang WANG
Chinese Journal of Nervous and Mental Diseases 2018;44(3):144-148
Objective To study the clinical, laboratorial, histopathological, imaging features of two cases of hypothyroid myopathy. Method Clinical manifestations, thyroid function, electromyography, muscle MRI, muscle biopsy and follow-up results were collected, and analyzed with the literature. Result These two patients were middle-age to old age and the onset of disease was insidious. Their common clinical manifestations included subacute progressive weakness in the proximal muscles,myalgia after sports and reduction in tendon reflex.The blood test showed an increase in serum concentration of CK and TSH, and a decrease in FT3 and FT4. The electromyography showed suspicious myogenic damage.Muscle histopathological findings were largely nonspecific,such as type I fiber predominance and type 2 atrophy. The MRI revealed extensive muscular dystrophy and fatty filtration in the posterior group of thighs. Treatment of replacement therapy with L-T4 relieved the myopathic symptoms quickly. Conclusion When a patient presents with a subacute progressive weakness in the proximal muscles, the hypothyroidism should be consideration. Muscle histopathological findings may be nonspecific. The muscle MRI have a value of differential diagnosis and lesion assessment.
3.Euphorbia factor L2 induces apoptosis in A549 cells through the mitochondrial pathway.
Minting LIN ; Sili TANG ; Chao ZHANG ; Hubiao CHEN ; Wenjing HUANG ; Yun LIU ; Jianye ZHANG
Acta Pharmaceutica Sinica B 2017;7(1):59-64
Euphorbia factor L2, a lathyrane diterpenoid isolated from caper euphorbia seed (the seeds ofL.), has been traditionally applied to treat cancer. This article focuses on the cytotoxic activity of Euphorbia factor L2 against lung carcinoma A549 cells and the mechanism by which apoptosis is induced. We analyzed the cytotoxicity and related mechanism of Euphorbia factor L2 with an MTT assay, an annexin V-FITC/PI test, a colorimetric assay, and immunoblotting. Euphorbia factor L2 showed potent cytotoxicity to A549 cells. Euphorbia factor L2 led to an increase in reactive oxygen species (ROS) generation, a loss of mitochondrial electrochemical potential, release of cytochromeactivation of caspase-9 and caspase-3, and cleavage of poly(ADP-ribose) polymerase, suggesting that Euphorbia factor L2 induced apoptosis through a mitochondrial pathway. The cytotoxic activity of Euphorbia factor L2 in A549 cells and the related mechanisms of apoptotic induction provide support for the further investigation of caper euphorbia seeds.
4.Clinical, pathological, imaging and genetic analysis of two cases of central core disease with different inheritance modes
Minting LIN ; Haizhu CHEN ; Xiaodan LIN ; Junjie HE ; Guorong XU ; Ning WANG ; Zhiqiang WANG
Chinese Journal of Nervous and Mental Diseases 2017;43(9):513-519
Objective To study the clinical, pathological, imaging features of two cases of central core disease (CCD) with different inheritance and to explore the similarities and differences between autosomal recessive CCD (AR-CCD) and autosomal dominant CCD (AD-CCD). Methods Clinical manifestations, family history, muscle MRI and muscle biopsy were collected. Targeted next generation sequencing (NGS) and sanger sequencing were applied for genetic analysis. Co-segregation analysis was further conducted in one family. Results Their common clinical manifestations included childhood early-onset proximal limbs muscle weakness and dystrophy accompanied with facial involvement. The MRI revealed extensive muscular dystrophy and fatty filtration in the both thighs, but not in rectus femoris. Pathology of skeletal muscle showed typical central cores in type Ⅰ muscle fibers and eccentric cores only in AR-CCD. Targeted NGS identified 3 missense mutations in RYR1, including one novel mutation. Conclusion The present study has described clinical and pathological features of two typical CCD patients with different inheritance, which may be associated with the different mutations in RYR1 gene. Targeted NGS apparently improves the genetic diagnosis of CCD.
5.Association of CYP2C19 gene polymorphisms with long-term recurrent risk of ischemic stroke among ethnic Han Chinese from Fujian.
Ling FANG ; Yuting ZHAO ; Ning WANG ; Zhenzhen YANG ; Huiping HUANG ; Minting LIN
Chinese Journal of Medical Genetics 2015;32(6):871-876
OBJECTIVETo assess the association of genetic polymorphisms of CYP2C19*2,*3,*17 with the recurrence risk of ischemic stroke during clopidogrel prevention in ethnic Han Chinese from Fujian Province.
METHODSClinical data of 985 patients with acute ischemic stroke was collected. After 1 year postdischarge follow-up evaluations, only 114 patients with persistence of clopidogrel were enrolled. CYP2C19 genetic polymorphisms were detected by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP)and direct sequencing ,then we analysis the correlation between polymorphisms and the recurrence of stroke.
RESULTSAmong the 114 patients, 23 had a second onset whilst receiving clopidogrel treatment. During the antiplatelet therapy with clopidogrel, carriers of CYP2C19 poor metabolizer (CYP2C19*2/*2 or *2/*3) had a higher rate of recurrent stroke compared with extensive metabolizers (CYP2C19*1/*1) (OR=4.71, 95%CI: 1.18-18.80, P<0.05). Carriers of CYP2C19 *2 mutant allele had increased recurrence compared with those carrying none loss-of-function allele (OR=2.31, 95%CI: 1.20-4.46, P<0.05). The rate of recurrent stroke in those carrying homozygous mutant *2 allele (CYP2C19*2/*2) was 6.14 times greater than the rate of wild-type homozygotes (CYP2C19*1/*1) (95%CI: 1.54-24.54, P<0.05). Patients with previous stroke history had increased risk of recurrence (OR= 4.146, 95%CI: 1.259-13.655, P<0.05). However, CYP2C19*17 was not detected in the group.
CONCLUSIONFor ethnic Han Chinese patients receiving clopidogrel treatment, carriers of poor metabolizer or homozygous mutant *2 allele (CYP2C19*2/*2) have a higher risk of recurrent stroke. The CYP2C19 *2 allele is an independent risk factor for recurrent stroke. Those with previous history of stroke are more prone to the recurrence.
Aged ; Alleles ; Asian Continental Ancestry Group ; genetics ; Brain Ischemia ; complications ; ethnology ; China ; Cytochrome P-450 CYP2C19 ; genetics ; Female ; Gene Frequency ; Genetic Predisposition to Disease ; ethnology ; genetics ; Genotype ; Humans ; Linkage Disequilibrium ; Logistic Models ; Male ; Middle Aged ; Platelet Aggregation Inhibitors ; therapeutic use ; Polymerase Chain Reaction ; Polymorphism, Restriction Fragment Length ; Polymorphism, Single Nucleotide ; Recurrence ; Risk Factors ; Sequence Analysis, DNA ; Stroke ; ethnology ; etiology ; genetics ; prevention & control ; Ticlopidine ; analogs & derivatives ; therapeutic use ; Time Factors
6.Study on the exocellular polysaccharide of Ureaplasma urealyticum biofilm in vitro
Minting HUANG ; Chun LU ; Guoxing ZHU ; Peiying FENG ; Wei LAI ; Xiaomin YE ; Feiyan LIN ; Jinfen ZHENG ; Han MA ; Meirong LI
Chinese Journal of Microbiology and Immunology 2012;32(4):335-339
Objective To investigate the extracellular polysaccharide distribution and components of Ureaplasma urealyticum (Uu) after biofilm having been developed in.Methods The standard serotype 3 and serotype 14 belong to biovar Parvo,and the standard serotype 4 and serotype 8 belong to biovar T960 were employed to form biofilrns in vitro.Scanning electron microscope and confocal laser scanning microscope were used to analysis the biofilms and extracellular polysaccharide.We used combination of two different labeled lectins,Canavalia ensiformis(FITC-ConA) and Erythrina cristagalli(ECA) which bind to specific polysaccharide residues to visualize extracellular polysaccharide in biofilms,and average uorescence intensity was evaluated Results All the strains can form the biofilmsin vitro.The biofilm was honeycomb-Like structures mainly,and extracellular polymeric substances accounts for majority of proportions.All the extracellular polysaccharide could be combined with FITC-ConA and ECA,and the total average fluorescence intensity of FITC-ConA was higher than ECA( P<0.001 ).Conclusion Ureaplasma urealyticum biofilm is honeycomb-like structures mainly.The extracellular polysaccharide contains,galactose,and N-acetyl glucan residual,and the glucose,mannose residual are the main components.
7.Detection of duplication mutation and carriers of Duchenne/Becker muscular dystrophy by multiplex ligation-dependent probe amplification quantitative
Qifang LIN ; Wanjin CHEN ; Ning WANG ; Zhiying WU ; Minting LIN ; Shenxing MURONG
Chinese Journal of Neurology 2011;44(8):568-573
Objective To analyze the dystrophin gene in patients with Duchenne/Becker muscular dystrophy (DMD/BMD) and their family members by multiplex ligation-dependent probe amplification (MLPA) method and to evaluate the application of this method in the mutations detection. Methods The whole dystrophin gene (79 exons) was analyzed by MLPA in 355 patients with DMD/BMD, the mothers of 46 patients with deletion mutation and the mothers of 8 patients with duplication mutation. The results were verified by PCR and sequencing when single exon deletion was found. Results One hundred and ninety cases were found to have deletion of one or more dystrophin exons, and 34 patients were identified to have duplication mutations. In 46 mothers of patients with deletion mutations, 28 were identified the mutations;and of 8 mothers of patients with duplication mutations, 6 were identified the mutations. There was no statistical significance between the carrier incidences in the 2 groups. A 23 bp deletion of AGGGAACAGATCCTGGTAAAGCA fragment in exon 17 was found in a patient. Conclusions Comparing with the traditional quantitative methods, MLPA can detect the deletion and duplication mutation in all the 79 exons of dystrophin gene in DMD/BMD patients, and can identify the carrier status in their family members. Furthermore, MLPA is not apt to be interfered by the concentration and purity of DNA template.
8.An electrophysiological study of Hirayama disease
Ming LI ; Minting LIN ; Xuexian ZHOU ; Feng TAN ; Saiying WAN
Chinese Journal of Physical Medicine and Rehabilitation 2011;33(8):587-591
Objective To analyze the electrophysiological characteristics of Hirayama disease and explore their significance for its diagnosis.MethodsElectrophysiological tests were performed on 18 patients who fulfilled the clinical criteria for Hirayama disease. Sixteen were males and 2 were females. The mean age was 24.9years old ( 19-58 years), and the mean case history was 5.2 years ( 1-40 years). The Hirayama disease was clearly unilateral in 10 patients and bilateral in 3, with 5 cases suspected of being bilateral. Motor neuron conduction velocity (MCV) and sensory neuron conduction velocity (SCV) were measured in the median and ulnar nerves.Electromyograms (EMGs) of the abductor digiti minimi, abductor pollicis brevis, extensor digitorum communis,brachioradialis muscle, biceps brachii and sternocleidomastoid were recorded in all cases. The MCV and SCV of the common peroneal nerve and an EMG of the tibialis anterior muscle were examined in one leg. The MCV and SCV of the ulnar nerve and EMGs of the abductor digiti minimi, extensor digitorum communis and brachioradialis muscles were inspected on the contralateral sides of 8 cases, including the patients suspected of suffering bilateral Hirayama disease. The MCVs of the median and ulnar nerves were examined segmentally by stimulating the nerves distally as well as proximally, and recording the amplitude, duration and area of compound muscle action potentials (CMAP) and changes in wave form, then determining whether there was a nerve conduction block.Results (1) No conduction block was detected in any median nerve or ulnar nerve among the 18 cases. (2) All the SCVs and sensory nerve action potentials of the median and ulnar nerves were normal. ( 3 ) All the MCVs and SCVs of the common peroneal nerve and the EMGs of the anterior tibialis muscles were normal. (4) MCV slowing in the upper limbs accounted for 41.3% (19/44) of the examined nerves. The rates of MCV decrease were 72.2% (13/18)in the ulnar nerve on the affected sides, 33.3% (6/18) in the median nerve on the affected sides and 0% (0/8)in the ulnar nerve on the contralateral sides. (5) Amplitude reduction in the CMAP in the upper limbs accounted for 81.8% (36/44) of the examined nerves. The rates of amplitude decrease were 100% (18/18) in the ulnar nerves of the affected sides, 77.8%(14/18) of median nerves on the affected side and 50%(4/8) of ulnar nerves on the contralateral side. ( 6 ) Upper limb EMGs revealed a rate of neurogenic damage of 47.0% ( 62/132). The EMGs decreased in 100% (18/18) of the abductor digiti minimi and abductor pollicis brevis on the affected side, 88.9% (16/18) of extensor digitorum communis on the affected side, 62.5% (5/8) of the abductor digiti minimi on the contralateral side, 37.5% (3/8) of the extensor digitorum communis on the contralateral side,5.6% ( 1/18 ) of the brachioradialis and biceps brachii muscles on the affected sides. There was no neurogenic damage of the contralateral brachioradialis muscle or the sternocleidomastoid on the affected side.Conclusions The electrophysiological features of Hirayama disease include unilateral or bilateral neurogenic damage in the upper limbs. According to the abnormal EMGs, spinal anterior horn cells on the affected sides were injured at C7-T1. C6and above C6 were rarely involved. The electrophysiological characteristics of Hirayama disease could provide a clear basis for localization and differentiation in Hirayama disease diagnosis.
9.A preliminary study on the reinnervation effect of the Riche-Cannieu anastomosis
Ming LI ; Liya XIAO ; Minting LIN ; Xuexian ZHOU
Chinese Journal of Microsurgery 2011;34(6):464-467
ObjectiveTo study whether the abductor pollicis brevis been effected by the reinnervation of the Riche-Cannieu anastomosis in the median nerve injury cases.MethodsCollect 43 cases (29male,14 female,mean age 32.6)corresponds with the study needs: (1)The traumatic median nerve injury (proved by the results of electrophysiological examine and the clinic diagnose)on or below the forearm.(2)The existence of RCA was verified by the electrophysiological examine results,and the amplitude of electric potential was under 1mv.(3) Rule out the cases with the other injure of nerve or nervous system disease and cervical vertebra disease,diabetes patient.The analysis base on the results of 43 case's periodical examine,the periodical criteria as following: within 2-4th week,within the 2-4thmonth and 1 year after the injury.Results Forty-three cases had not obvious recovery indication of the median nerve under the clinical and electrophysiological aspect,eight cases of abductor pollicis brevis function improved quickly in 3 months,the relevant CMAP amplitude of Riche-Cannieu anastomosis increased apparently,the EMG (Electromyography)results of abductor pollicis brevis ameliorated accordingly.ConclusionIn the case of RCA combined with the median nerve injury,the abductor pollicis brevis fibra might be dominated by RCA reinnervation when losing domination of median nerve,the reinnervation process will much faster than the regeneration process of the broken nerve.
10.Mutation analysis of senataxin gene in sporadic amyotrophic lateral sclerosis
Huiling XIONG ; Wenzu CHEN ; Zhiying WU ; Zhenhua ZHAO ; Ning WANG ; Minting LIN ; Shenxing MURONG
Chinese Journal of Neurology 2010;43(2):90-92
Objective To investigate the spectrum of senataxin gene mutations in Chinese patients with sporadic amyotrophic lateral sclerosis (SALS). Methods Sixty sporadic SALS patients and 200 unrelated normal individuals were screened for mutations of senataxin by PCR-sequencing methodology. Results Two silent mutations, Asp844Asp and Phe998Phe, were identified in two SALS patients, respectively. They were not found in controls. However, a homology search of senataxin gene in different species revealed that these two amino acids were not evolutionarily conserved, indicating that the mutations were not pathogenic. Additional 19 polymorphisms were detected. Conclusion The identification of two silent mutations and 19 polymorphisms has further broadened the spectrum of mutations and polymorhpisms in senataxin.

Result Analysis
Print
Save
E-mail