1.Explainable Machine Learning Model for Predicting Prognosis in Patients with Malignant Tumors Complicated by Acute Respiratory Failure: Based on the eICU Collaborative Research Database in the United States
Zihan NAN ; Linan HAN ; Suwei LI ; Ziyi ZHU ; Qinqin ZHU ; Yan DUAN ; Xiaoting WANG ; Lixia LIU
Medical Journal of Peking Union Medical College Hospital 2026;17(1):98-108
To develop and validate a model for predicting intensive care unit (ICU) mortality risk in patients with malignant tumors complicated by acute respiratory failure (ARF) based on an explainable machine learning framework. Clinical data of patients with malignant tumors and ARF were extracted from the eICU Collaborative Research Database in the United States, including demographic characteristics, comorbidities, vital signs, laboratory test indicators, and major interventions within the first 24 hours after ICU admission.The study outcome was ICU death.Enrolled patients were randomly divided into a training set and a validation set at a ratio of 7:3.Predictor variables were selected using least absolute shrinkage and selection operator (LASSO) regression.Five machine learning algorithms-extreme gradient boosting (XGBoost), support vector machine (SVM), Logistic regression, multilayer perceptron (MLP), and C5.0 Decision Tree-were employed to construct predictive models.Model performance was evaluated based on the area under the receiver operating characteristic curve (AUC), accuracy, sensitivity, and other metrics.The optimal model was further interpreted using the Shapley additive explanations (SHAP) algorithm. A total of 3196 patients with malignant tumors complicated by ARF were included.The training set comprised 2, 261 patients and the validation set 935 patients; 683 patients died during ICU stay, while 2513 survived.LASSO regression ultimately selected 12 variables closely associated with patient ICU outcomes, including sepsis comorbidity, use of vasoactive drugs, and within the first 24 hours after ICU admission: minimum mean arterial pressure, maximum heart rate, maximum respiratory rate, minimum oxygen saturation, minimum serum bicarbonate, minimum blood urea nitrogen, maximum white blood cell count, maximum mean corpuscular volume, maximum serum potassium, and maximum blood glucose.After model evaluation, the XGBoost model demonstrated the best performance.The AUCs for predicting ICU mortality risk in the training and validation sets were 0.940 and 0.763, respectively; accuracy was 88.3% and 81.2%;sensitivity was 98.5% and 95.9%.Its predictive performance also remained optimal in sensitivity analyses.SHAP analysis indicated that the top five variables contributing to the model's predictions were minimum oxygen saturation, minimum serum bicarbonate, minimum mean arterial pressure, use of vasoactive drugs, and maximum white blood cell count. This study successfully developed a mortality risk prediction model for ICU patients with malignant tumors complicated by ARF based on a large-scale dataset and performed explainability analysis.The model aids clinicians in early identification of high-risk patients and implementing individualized interventions.
2.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
3.A preliminary study on horizontal sound localization in patients with unilateral sudden hearing loss during the acute phase
Mengyuan ZHU ; Xiaolin HE ; Jiaying LI ; Xing WANG ; Hongping DING ; Linan DIAO ; Xin FU ; Jiaxing LIU ; Zihui ZHAO ; Ningyu WANG ; Juan ZHANG
Chinese Archives of Otolaryngology-Head and Neck Surgery 2025;32(5):288-293
OBJECTIVE To preliminarily assess the horizontal sound localization and its influencing factors in patients with unilateral sudden sensorineural hearing loss during the acute phase.METHODS The azimuth discrimination test and azimuth identification test were completed,with the speech sound(65 dB SPL)as the stimulus.The minimum audible angle(MAA)and root-mean-square error(RMSE)were obtained,and the RMSE of the affected side and the healthy side were calculated respectively.According to the WHO(2021)hearing loss classification criteria,the data were analyzed based on the pure-tone average(PTA)of the affected ear.And the best resident hearing at each frequency of the affected ear was recorded.RESULTS The performance of the unilateral sudden sensorineural hearing loss patients in the sound localization varied greatly.Some performed close to the normal level,while others completely lost the ability to localize sound.The RMSE of the moderate hearing loss group(≥35 dB HL)was significantly higher than that of the normal hearing group(P<0.01),the MAA of the moderate to severe hearing loss group(≥50 dB HL)showed statistically significant differencescompared with normal hearing group(P<0.001).The RMSE of the affected side of patients in the severe and above hearing loss group was significantly larger than that of the healthy side.Regression analysis showed that the best resident hearing at each frequency of the affected ear was the most significant factor affecting MAA(R2=0.572,P<0.001)and RMSE(R2=0.768,P<0.001).CONCLUSION The horizontal sound localization of unilateral sudden sensorineural hearing loss patients in the acute phase varies greatly.When the PTA of the affected side reaches moderate hearing loss,the localization ability is significantly lower than that of normal-hearing individuals.The best resident hearing at each frequency of the affected ear is the key factor affecting the localization ability.
4.Ethical reflections on narrative wills in elderly end-of-life patients
Linan CHENG ; Fuman CAI ; Huiling LI ; Qian CHEN ; Fengying ZHANG
Chinese Medical Ethics 2025;38(6):712-717
Elderly end-of-life patients often experience distress due to being caught in dilemmas of contemplation and decision-making. Narrative wills, grounded in life values and premised on respecting individual wishes and needs, present an individual’s unique life story through narrative forms, conveying their overall experience, interpretation of meaning, and understanding of life. They are preserved and passed on in a way that meets individual expectations, thereby promoting human exploration, reflection, and growth regarding the meaning of life through interpersonal interactions that transcend space and time. This paper explored the concept of narrative wills among elderly end-of-life patients, the ethical value and ethical principles of narrative wills, and the moral and ethical risks. It also provided specific ethical interpretations, assisting in the application and development of narrative wills in elderly end-of-life patients.
5.Application of pedicle or perforator flaps transfer in the stage Ⅰ tissue defect repair after vulvar cancer surgery
Yufen CHEN ; Ping BAI ; Yuqiao ZHAO ; Linan CONG ; Nan LI ; Jing ZUO ; Gongyi ZHANG ; Yangchun SUN ; Shumin LI ; Qiang LI
Chinese Journal of Obstetrics and Gynecology 2025;60(2):136-143
Objective:To investigate the application of pedicled or perforator flaps transfer in the stage Ⅰ tissue defect repair after vulvar cancer surgery.Methods:From January 2005 to December 2023, 20 patients with vulvar cancer who underwent extensive episiectomy or extended episiectomy±inguinal lymph node resection+vulvar defect flap transfer were collected in Huanxing Cancer Hospital of Chaoyang District and Cancer Hospital and Peking Union Medical College, Chinese Academy of Medical Sciences. The survival status, appearance structure, sexual function satisfaction, tumor recurrence, and survival were analyzed.Results:(1) The median age of the 20 patients was 59 years (ranged: 29-73 years). There were 14 patients with recurrence and 6 patients with initial treatment. Pathological types: 14 cases of squamous cell carcinoma, 4 cases of Paget′s disease, 1 case of malignant melanoma, 1 case of adenoid cystic carcinoma (salivary gland type carcinoma). (2) Among the 20 patients, 6 cases underwent extensive episiotomy and 14 underwent extended episiotomy (1 of them underwent extensive excision of inguinal masses). Simultaneous inguinal lymphadenectomy (or dissection) were performed in 11 cases, including 7 cases of bilateral inguinal lymph node resection (or dissection) and 4 cases of unilateral inguinal lymph node resection (or dissection). Flap source: pedicled flap in 12 cases, perforator flap in 8 cases. All the 20 patients were removed at 10-14 days after operation, and all of them survived with rosy skin color and good elasticity. Seventeen cases of transferred flaps healed at stage Ⅰ, 2 cases healed at about 6 weeks due to incision leakage, and 1 case healed at 6 weeks after incision infection debridement. Six months after the operation, 2 cases felt that the pubic mound was thick and swollen. The other 18 cases showed vulva fullness and elasticity, no displacement of urethral opening, no deviation of urethra during urination, no stenosis of vaginal opening, no vulvar scar pain. In addition to 1 unmarried 29-year-old patient and 6 patients over 65 years old who had no sexual life before and after surgery, the other 13 patients had normal sexual life after surgery. (3) The follow-up period were 6 to 100 months, and 9 cases (45%, 9/20) relapsed during the follow-up period. There were 5 deaths (25%, 5/20), who were due to recurrence of vulvar cancer. The 5-year survival rate of 20 patients was 75%, including 83% in 6 patients with initial treatment and 71% in 14 patients with recurrence and reoperation.Conclusions:The combination of flap transfer for episioplasty with vulvar cancer surgery does not affect the wound healing. Because the external structure of the vulva is repaired, it could effectively improve the local wound healing ability and improve the organ function, and has good clinical application value.
6.Sinicization and reliability and validity the European organization for research and treatment of cancer quality of life questionnaire-head and neck 43
Qing LYU ; Junqiu LI ; Fa ZHANG ; Cuimin KOU ; Yan LI ; Shuxiang ZHANG ; Yanxin ZHANG ; Lixia NIU ; Yiming ZHU ; Xin YUAN ; Linan QIN ; Shaoyan LIU
Chinese Journal of Otorhinolaryngology Head and Neck Surgery 2025;60(6):617-623
Objective:To translate the European organization for research and treatment of cancer quality of life questionnaire-head and neck 43(EORTC QLQ-H&N43) and to conduct cultural debugging and reliability and validity testing for the Chinese version of the scale.Methods:The Chinese version of EORTC QLQ-H&N43 was formed through literal translation, integration, back translation, group discussion, cultural adjustment, and pre-investigation of the English version of the scale. From March 2023 to December 2023, convenience sampling was used to investigate 254 patients with head and neck tumors at the Cancer Hospital of the Chinese Academy of Medical Sciences, including 197 males and 57 females, aged (55.6±13.6) years. SPSS 25.0 statistical software was used to analyze the performance of the scale.Results:The Chinese version of EORTC QLQ-H&N43 retained all 43 items. After evaluation by 5 experts, the content validity index (I-CVI) at the item level of the scale ranged from 0.80 to 1.00, and the average content validity index (S-CVI/Ave) at the scale level was 0.991. Through exploratory factor analysis, a total of 9 common factors were extracted, with a cumulative variance contribution rate of 68.158%; Cronbach′s α coefficient of the total scale was 0.943, and the half reliability was 0.896.Conclusion:The Chinese version of EORTC QLQ-H&N43 has good reliability and validity, which can be used as an effective tool to evaluate the quality of life of head and neck cancer patients in China.
7.Effects of different concentrations of alcoholic beverage and doses of al-cohol on a rat model of alcoholic liver disease
Chen WANG ; Jianjiao ZUO ; Yanshan MA ; Yuntong ZHOU ; Zhiwei LI ; Linan ZHANG ; Yinghua XIE
Chinese Journal of Pathophysiology 2025;41(11):2272-2280
AIM:To establish a stable and efficient rat model of alcoholic liver disease(ALD),we investigat-ed the effects of different alcoholic beverage concentrations and alcohol dosing regimens.METHODS:(1)SPF-grade male SD rats were randomized into 5 groups(n=10):blank,ALD1,ALD2,ALD3,and ALD4.Except for the blank group,rats received intragastric administration of 56%alcohol(6 mL/kg twice daily with an 8-hour interval)for 4 weeks,along with free access to 0%,5%,10%,or 15%alcoholic beverage to evaluate concentration-dependent effects.(2)An-other cohort was divided into three groups(n=10):blank,ALD5,and ALD6.Rats(except blank)were gavaged with 56%alcohol twice daily for 9 weeks(8 mL/kg for ALD5;6 mL/kg in week 1,increasing by 0.5 mL/kg weekly for ALD6),with 10%alcoholic beverage available ad libitum to assess dose-dependent effects.Serum biochemical markers[alanine aminotransferase(ALT),aspartate aminotransferase(AST),total cholesterol(TC),triglycerides(TG),high-density li-poprotein cholesterol(HDL-C),and low-density lipoprotein cholesterol(LDL-C)]and inflammatory cytokines[interleu-kin-6(IL-6),IL-1β and tumor necrosis factor-α(TNF-α)]were analyzed after modeling,complemented by imaging(B-ultrasound,CT,and MRI).Success and survival rates were calculated.RESULTS:(1)ALD1~4 groups exhibited sig-nificantly elevated ALT,AST,TC,TG,LDL-C,IL-1β,IL-6 and TNF-α(P<0.05 or P<0.01)and reduced HDL-C and liver-to-spleen CT density ratio vs blank.ALD3(10%alcoholic beverage)showed the highest modeling success rate with low mortality.(2)ALD5 and ALD6 groups also had siginificant differin terms(P<0.01),with ALD6(gradually increas-ing dose)displaying more severe liver injury,higher success rate,and better survival.CONCLUSION:The optimal ALD model was induced by intragastric administration of 56%alcohol(6 mL/kg twice daily in week 1,increasing by 0.5 mL/kg weekly for 9 weeks)combined with 10%alcoholic beverage.This protocol offers a reliable approach for ALD re-search and drug development.
8.Application of pedicle or perforator flaps transfer in the stage Ⅰ tissue defect repair after vulvar cancer surgery
Yufen CHEN ; Ping BAI ; Yuqiao ZHAO ; Linan CONG ; Nan LI ; Jing ZUO ; Gongyi ZHANG ; Yangchun SUN ; Shumin LI ; Qiang LI
Chinese Journal of Obstetrics and Gynecology 2025;60(2):136-143
Objective:To investigate the application of pedicled or perforator flaps transfer in the stage Ⅰ tissue defect repair after vulvar cancer surgery.Methods:From January 2005 to December 2023, 20 patients with vulvar cancer who underwent extensive episiectomy or extended episiectomy±inguinal lymph node resection+vulvar defect flap transfer were collected in Huanxing Cancer Hospital of Chaoyang District and Cancer Hospital and Peking Union Medical College, Chinese Academy of Medical Sciences. The survival status, appearance structure, sexual function satisfaction, tumor recurrence, and survival were analyzed.Results:(1) The median age of the 20 patients was 59 years (ranged: 29-73 years). There were 14 patients with recurrence and 6 patients with initial treatment. Pathological types: 14 cases of squamous cell carcinoma, 4 cases of Paget′s disease, 1 case of malignant melanoma, 1 case of adenoid cystic carcinoma (salivary gland type carcinoma). (2) Among the 20 patients, 6 cases underwent extensive episiotomy and 14 underwent extended episiotomy (1 of them underwent extensive excision of inguinal masses). Simultaneous inguinal lymphadenectomy (or dissection) were performed in 11 cases, including 7 cases of bilateral inguinal lymph node resection (or dissection) and 4 cases of unilateral inguinal lymph node resection (or dissection). Flap source: pedicled flap in 12 cases, perforator flap in 8 cases. All the 20 patients were removed at 10-14 days after operation, and all of them survived with rosy skin color and good elasticity. Seventeen cases of transferred flaps healed at stage Ⅰ, 2 cases healed at about 6 weeks due to incision leakage, and 1 case healed at 6 weeks after incision infection debridement. Six months after the operation, 2 cases felt that the pubic mound was thick and swollen. The other 18 cases showed vulva fullness and elasticity, no displacement of urethral opening, no deviation of urethra during urination, no stenosis of vaginal opening, no vulvar scar pain. In addition to 1 unmarried 29-year-old patient and 6 patients over 65 years old who had no sexual life before and after surgery, the other 13 patients had normal sexual life after surgery. (3) The follow-up period were 6 to 100 months, and 9 cases (45%, 9/20) relapsed during the follow-up period. There were 5 deaths (25%, 5/20), who were due to recurrence of vulvar cancer. The 5-year survival rate of 20 patients was 75%, including 83% in 6 patients with initial treatment and 71% in 14 patients with recurrence and reoperation.Conclusions:The combination of flap transfer for episioplasty with vulvar cancer surgery does not affect the wound healing. Because the external structure of the vulva is repaired, it could effectively improve the local wound healing ability and improve the organ function, and has good clinical application value.
9.Effects of different concentrations of alcoholic beverage and doses of al-cohol on a rat model of alcoholic liver disease
Chen WANG ; Jianjiao ZUO ; Yanshan MA ; Yuntong ZHOU ; Zhiwei LI ; Linan ZHANG ; Yinghua XIE
Chinese Journal of Pathophysiology 2025;41(11):2272-2280
AIM:To establish a stable and efficient rat model of alcoholic liver disease(ALD),we investigat-ed the effects of different alcoholic beverage concentrations and alcohol dosing regimens.METHODS:(1)SPF-grade male SD rats were randomized into 5 groups(n=10):blank,ALD1,ALD2,ALD3,and ALD4.Except for the blank group,rats received intragastric administration of 56%alcohol(6 mL/kg twice daily with an 8-hour interval)for 4 weeks,along with free access to 0%,5%,10%,or 15%alcoholic beverage to evaluate concentration-dependent effects.(2)An-other cohort was divided into three groups(n=10):blank,ALD5,and ALD6.Rats(except blank)were gavaged with 56%alcohol twice daily for 9 weeks(8 mL/kg for ALD5;6 mL/kg in week 1,increasing by 0.5 mL/kg weekly for ALD6),with 10%alcoholic beverage available ad libitum to assess dose-dependent effects.Serum biochemical markers[alanine aminotransferase(ALT),aspartate aminotransferase(AST),total cholesterol(TC),triglycerides(TG),high-density li-poprotein cholesterol(HDL-C),and low-density lipoprotein cholesterol(LDL-C)]and inflammatory cytokines[interleu-kin-6(IL-6),IL-1β and tumor necrosis factor-α(TNF-α)]were analyzed after modeling,complemented by imaging(B-ultrasound,CT,and MRI).Success and survival rates were calculated.RESULTS:(1)ALD1~4 groups exhibited sig-nificantly elevated ALT,AST,TC,TG,LDL-C,IL-1β,IL-6 and TNF-α(P<0.05 or P<0.01)and reduced HDL-C and liver-to-spleen CT density ratio vs blank.ALD3(10%alcoholic beverage)showed the highest modeling success rate with low mortality.(2)ALD5 and ALD6 groups also had siginificant differin terms(P<0.01),with ALD6(gradually increas-ing dose)displaying more severe liver injury,higher success rate,and better survival.CONCLUSION:The optimal ALD model was induced by intragastric administration of 56%alcohol(6 mL/kg twice daily in week 1,increasing by 0.5 mL/kg weekly for 9 weeks)combined with 10%alcoholic beverage.This protocol offers a reliable approach for ALD re-search and drug development.
10.Sinicization and reliability and validity the European organization for research and treatment of cancer quality of life questionnaire-head and neck 43
Qing LYU ; Junqiu LI ; Fa ZHANG ; Cuimin KOU ; Yan LI ; Shuxiang ZHANG ; Yanxin ZHANG ; Lixia NIU ; Yiming ZHU ; Xin YUAN ; Linan QIN ; Shaoyan LIU
Chinese Journal of Otorhinolaryngology Head and Neck Surgery 2025;60(6):617-623
Objective:To translate the European organization for research and treatment of cancer quality of life questionnaire-head and neck 43(EORTC QLQ-H&N43) and to conduct cultural debugging and reliability and validity testing for the Chinese version of the scale.Methods:The Chinese version of EORTC QLQ-H&N43 was formed through literal translation, integration, back translation, group discussion, cultural adjustment, and pre-investigation of the English version of the scale. From March 2023 to December 2023, convenience sampling was used to investigate 254 patients with head and neck tumors at the Cancer Hospital of the Chinese Academy of Medical Sciences, including 197 males and 57 females, aged (55.6±13.6) years. SPSS 25.0 statistical software was used to analyze the performance of the scale.Results:The Chinese version of EORTC QLQ-H&N43 retained all 43 items. After evaluation by 5 experts, the content validity index (I-CVI) at the item level of the scale ranged from 0.80 to 1.00, and the average content validity index (S-CVI/Ave) at the scale level was 0.991. Through exploratory factor analysis, a total of 9 common factors were extracted, with a cumulative variance contribution rate of 68.158%; Cronbach′s α coefficient of the total scale was 0.943, and the half reliability was 0.896.Conclusion:The Chinese version of EORTC QLQ-H&N43 has good reliability and validity, which can be used as an effective tool to evaluate the quality of life of head and neck cancer patients in China.

Result Analysis
Print
Save
E-mail